Mokhbatly et al., 2019, AJMS 2 (1):20-24, DOI:10.5455/ajms.

17

Arabian Journal of Medical Sciences

http://www.ajms.tk

A potential molecular mechanism and biochemical alterations associated with

bromuconazole-induced testicular toxicity in rats
Abd Alla Mokhbatly a, Abdelrahman Aburawash b, Emad Ghazi a, Wael Goda b, Zizy I. Elbialyc*, Samah
S. Abou-Asad, Mohammed A. El-Magde, Ibrahim Eleshb, Doaa H. Abdelhady a
a
Department of Clinical Pathology, Faculty Veterinary Medicine, Kafrelsheikh University, Egypt
b
Department of Pathology, Faculty of Veterinary Medicine, Damanhour University, Egypt
c
Department of Fish Processing and Biotechnology, Faculty of Aquatic and Fisheries Sciences, Kafrelsheikh University
d
Department of Pathology, Faculty Veterinary Medicine, Kafrelsheikh University
e
Department of Anatomy and Embryology, Faculty of Veterinary Medicine, Kafrelsheikh University
Article Info Abstract
Background: Bromuconazole is a widely used triazole pesticide which is toxic not only to target fungi but also to
animals and human. Aim: The present study aimed to evaluate the harmful effects of prolonged administration of
Keywords: bromuconazole fungicide-induced testicular toxicity in male rats. Materials and methods: Rats were randomly
Bromuconazole, allocated into 5 groups (10 rats per group) as following: group 1 (G1), the control group were given distilled water;
Testicular toxicity, G2 and G3 were orally administrated bromuconazole [at doses of 1/10 the oral LD50 = 32.8 mg /kg body weight
Hematological alterations, (bw) and lowest relevant oral dose of no observed adverse effect level (NOAEL) = 13.8 mg /kg bw, respectively]
Histopathology, by stomach gavage; and G4 and G5 were topically treated with bromuconazole (at doses of 1/10 dermal LD50 =
Cyp17A1, 200 mg /kg bw and dermal NOAEL = 84 mg/kg bw, respectively). Results: Among the four doses only high oral
Cyp19A1 dose (G2) showed a deteriorated blood picture. However, the four treated groups (G2-G5) showed a significant
reduction in total cholesterol and triglyceride, but no significant effect on other lipid profile parameters (high and
Received Dec 3, low density lipoproteins). Moreover, administration of bromuconazole in G2-G4 resulted in a significant declined
serum levels of testosterone and estradiol. Bromuconazole treatment except in G5 also induced testicular oxidative
Revised Dec 25,
stress as revealed by a significant elevation in malondialdehyde (MDA) level and a significant reduction in
Published Jan 12, 2019
superoxide dismutase (SOD) levels in testis. In these groups, bromuconazole also caused a decrease in relative testis
and epididymis weights and degenerative changes in seminiferous tubules. At the mRNA level, bromuconazole
down-regulated mRNA expression of the two steroidogenesis related genes Cyp19A1 and Cyp17A1 in testis.
*Corresponding author: Overall, the oral route showed higher testicular toxicity than the dermal route and all effects were dose-dependent.
zizyelbialy74@gmail.com Conclusion: These data suggest that bromuconazole considered as one of the male reproductive toxicants.

1. Introduction
Pesticides are well known endocrine-disruptors and can lead to was conducted to evaluate the toxic effects of bromuconazole long
reduction of sperm count and motility in human, feminization of exposure (90 day) on rat testis through investigation of hematological
rat males (Crouse et al., 2015; Goetz and Dix, 2009; Goetz et al., (complete blood count), biochemical (lipid profile, testosterone,
2007; Jürg et al., 2003). It is therefore crucial to study the endocrine estradiol and oxidative stress/antioxidants), histopathological and
disruption of the pesticides. Bromuconazole is a widely used triazole molecular (Cyp19A1 and Cyp17A1) parameters.
pesticide which is toxic not only to target fungi but also to animals
2. Materials and Methods
and human. High doses of triazoles can induce infertility through
inhibition of certain pathways of steroidogenesis. They have high- 2.1. Animals and sampling
affinity binding ability to aromatase cytochrome P450 enzyme
Adult male albino rats (n = 50, weighting 160-200 g) housed in
and its encoding gene Cyp19A1, which converts androgens into
separate cages with 22-25 ˚C, and 12 h light/dark cycle fed chew
the corresponding estrogens, therefore they can inhibit aromatase
diet and received drinking water ad libitum. This experiment was
and block estradiol biosynthesis (Edwards and Godley, 2010;
done according to ethical codes of experimental animals approved
Sun et al., 2006; Tully et al., 2006). Moreover, triazoles can also
by the Animal Ethical Committee, Kafrelsheikh University. Animals
inhibit CYP17A1 activity and subsequently prevent testosterone
were left 14 days for acclimatization before starting the experiment.
biosynthesis (Goetz and Dix, 2009; Trosken et al., 2004). These
previous studies focused on the effect of different triazoles on male Rats were allocated into 5 groups (10 rats per group) as
and female fertility, however none of them studied the effect of following: group 1 (G1), the control group were given distilled
bromuconazole. Instead, most of other studies only investigated the water; G2 and G3 were orally administrated bromuconazole [at
hepatotoxic effect of bromuconazole (Abdelhady et al., 2017; Osman doses of 1/10 the oral LD50 = 32.8 mg /kg body weight (bw)
et al., 2011), but only little or no information is available regarding and lowest relevant oral dose of no observed adverse effect level
bromuconazole toxic effect on testis and subsequently on fertility. (NOAEL) = 13.8 mg /kg bw, respectively] by stomach gavage; and
G4 and G5 were topically treated with bromuconazole (at doses of
There are contradictory results regarding the effect of triazoles on
1/10 dermal LD50 = 200 mg /kg bw and dermal NOAEL = 84
estrogens, where some triazoles have anti-estrogenic activity in vitro
mg/kg bw, respectively) (Abdelhady et al., 2017). Bromuconazole
(Kjærstad et al., 2010), however when the same triazoles used in vivo,
was obtained from a local herbicides market as a mixture of
the testicular weight and the testosterone levels increased (Goetz et
distereoisomers trans-bromuconazole 1-1H-1, 2, 4-triazole, and cis-
al., 2007). The lack of consistency among these data indicates a
bromuconazole 1-1H-1, 2, 4-triazole.
prompt need of more in vivo investigations. Therefore, this study
20
 Mokhbatly et al., 2019, AJMS 2 (1):20-24, DOI:10.5455/ajms.17
After treatment for 90 days, blood samples were collected
from the medial canthus of eyes. Some blood samples collected in
plain tubes were left to be clotted and serum was then separated by
centrifugation at 1845 g for 15 min (for determination of lipid profile,
estradiol and testosterone), while other samples were collected in
EDTA-coated tubes (for hematological analysis). Rats were then
euthanized by decapitation, and their testes and cauda-epididymides
were quickly excised, weighed and sliced into three parts: one part
was immediately ground in liquid nitrogen (for RNA extraction),
the second was used for preparation of tissue homogenate (for
determination of MDA and SOD), and the third was preserved in
10% formalin (for histopathological examination). The relative testis/
epididymis weight (RW) was calculated as follow: RW (%) = organ
weight (g) / body weight (g) X 100.
2.2. Hematological investigations
Hematological parameters including red blood corpuscle
(RBC) count, hemoglobin (Hb), packed cell volume (PCV), red cell
distribution width (RDW), total leukocytic count (TLC), leukocyte
differential count [granulocytic count (GC), lymphocytic count
(LC)], platelet count (PC), and mean platelet volume (MPV) were
determined using the Cell-Dyn 3700 Hematology Analyzer (Abbott
Laboratories, Illinois).
2.3. Biochemical analysis
Serum lipid profile, including triacylglyceride (TG), total
cholesterol (TC), low density lipoprotein (LDL), and high density
lipoprotein (HDL), was determined using commercially available
kits. Serum concentrations of testosterone and 17β-estradiol were
determined by radioimmunassay (RIA) kit from Immunotech
(Beckman Coulter, Marseille, France) following the manufacturer’s
protocol and as previously described (El-Magd et al., 2016).
Following homogenization in phosphate buffer saline (PBS),
testicular tissue homogenates were centrifuged at 5000 rpm for 30
min and the obtained supernatants were used to detect the levels of
lipid peroxidation biomarker MDA and SOD as previously described
by (Alzahrani et al., 2018).
2.5. Molecular analysis for Cyp19A1 and Cyp17A1
Total RNA was isolated from rat testes using Gene JET RNA
Purification Kit (Thermo Scientific, # K0731, USA) according to
the manufacturer’s protocol and as previously described by (El-
Magd et al., 2013). RNA concentration and purity were evaluated
by determining the ratio of the absorbance at 260 nm and 280 nm
using a Nanodrop. cDNA, obtained by reverse transcription of
total RNA using Quantiscript reverse transcriptase, was used as
a template to detect Cyp19A1 and Cyp17A1 expression using
Cyp19A1 primers; F: 5\ TGGAACCTGCCCCCAGGACC 3\
and R: 5\ CCACGATGCGCCTTGAGCCA 3\; and Cyp17A1
primers; F: 5\ACTGAGGGTATCGTGGATGC3\ and R: 5\
CCGTCAGGCTGGAGATAGAC3\. The reaction cycles and
melting curve temperature were performed as previously described
(Saleh and El-Magd, 2018). The quantities critical threshold
(Ct) of target genes were normalized with Ct of the internal
control β actin: (F: 5\AGGGAAATCGTGCGTGAC3\ and R: 5\
CGCTCATTGCCGATAGTG3\) and the expression fold change was
calculated using 2-∆∆Ct method. Levels were expressed relative to the
control samples.
21
2.6. Histopathological examination
The testis specimens were dehydrated in alcohol, cleaned
in xylene, embedded in paraffin, sectioned (5 μm), stained with
hematoxyline and eosin (Bancroft and Gamble, 2008) and examined
by light microscope.
2.7. Statistical analysis
The statistical significance was evaluated by one way ANOVA
using GraphPad Prism 7 Software (Inc, La Jolla, CA). Comparison
of means was carried out with Tukey’s honestly significant difference
test. All data were expressed as means ± standard error of mean
(SEM). Values were considered statistically significant when P≤0.05.
3. Results and discussion
Monitoring the change in the organ weight relative to the body
weight is a routine work in the toxicological study as it can indicate
tissue damage. Herein, we evaluated the effect of bromuconazole
administration on the relative weight of the testis and epididymides
and found a significant dose-related reduction in the treated groups
G2-G4, as compared to controls (Table 1). However, there was no
significant difference in relative testis and epididymides weights
between G5 and controls. Similarly, Crouse et al. (2015) and Lent
et al. (2015) also found a significant dose dependant decrease in
rat testis and epididymis weight following oral administration of a
nitro-triazole. This suggests toxic effect of bromuconazole and severe
damage in testis and epididymis.
Another routine test used in evaluation of toxicity induced by
certain compounds is the hematology (blood picture) as it reflects the
healthy status of the intoxicated animals. In the present study, G2
showed a significant decrease in RBCs count, Hb content, PCV%,
TLC, GC, LC relative to the control group (G1), meanwhile G3-G5
showed insignificant changes in these parameters as compared to the
control group (Table 1). However, G2 exhibited a significant increase
in RDW, PC, and MPV relative to G1, meanwhile groups 3-5 showed
insignificant changes in these parameters as compared to G1. These
results indicate that only the higher oral dose of bromuconazole can
deteriorate the blood picture as revealed by induction of anemia
and leukocytopenia, but with thrombocytosis. Reduction of WBCs,
especially lymphocytes, count also indicates immune-depressive
effect for higher doses of bromuconazole. Similar hematological
changes were also reported by Crouse et al. (2015) who reported
reduction of most of hematological parameters in rats treated with
only high doses of orally given nitro-triazole.
Serum levels of TG, TC were significantly decreased in treated
groups, with lowest level in G2, as compared to the control (G1)
(Table 1). However, no significant change was noticed in the serum
levels of HDL-C or LDL-C between all treated groups (G2-G5)
and G1. Moreover, we found a significant (P≤0.05) dose dependant
decrease in serum testosterone and estradiol levels in G2-G4, however
G5 showed insignificant decrease relative to the control group (Table
1). These serum testosterone results are consistent with previous
studies in rats exposed to other triazoles (Goetz et al., 2007). In
contrast Crouse et al. (2015) and Lent et al. (2015) reported no change
in testosterone serum levels following treatment of rats by nitro-
triazole. Reduction of cholesterol and triglycerides may be attributed
to inhibition of 14α-demethylase, an enzyme involved in cholesterol
biosynthesis, by bromuconazole (Jürg et al., 2003). This reduction is
compatable with reduced serum testosterone and estradiol levels as
cholesterol is essential for formation of these two steroid hormones.
 Mokhbatly et al., 2019, AJMS 2 (1):20-24, DOI:10.5455/ajms.17

Table 1. Effect of bromuconazole treatment on testis and epididymis relative weight, hematological and biochemical
parameters.

Data are represented as mean± standard error of mean (SEM). Means within the same raw bearing different super-
scripts (small letters) are significantly different at p<0.05. GC: granulocytic count; Hb: hemoglobin; HDL-C: high
density lipoprotein cholesterol; LC: lymphocytic count; LDL-C: low density lipoprotein cholesterol; MPV: mean
platelet volume; PC: platelet count; PCV: packed cell volume; RBCs: red blood corpuscles; RDW: Red cell distri-
bution width; RW: relative weight; TC: total cholesterol; TG: triglyceride; TLC: total leukocytic count.

Fig.1. Photomicrographs of testis sections stained by H&E show toxic effect of bromuconazole. (A) G1, (B) G2, (C)
G3, (D) G4, and (E) G5. Scale bar = 50 µm

22
 Mokhbatly et al., 2019, AJMS 2 (1):20-24, DOI:10.5455/ajms.17
Reduction of serum testosterone and estradiol levels by
bromuconazole may be caused by testicular tissue damage. To check
this possibility, we microscopically examined the stained testis sections
and found normal testicular structure in the control group (Fig. 1A). In
contrast, the testis of rats orally treated with high dose of bromuconazole
(G2) showed severe degenerative changes of seminiferous tubules with
some tubules became filled with homogenous eosinophilic materials
(black arrow) and had desquamated spermatic cell layers (orange
arrow) leading to loss of spermatic cell layers (blue arrow, Fig. 1B).
Some homogenous eosinophilic material also seen in interstitial tissues
between the degenerated tubules (green arrow, Fig. 1B). Similar, but
less severe, pathological changes [homogenous eosinophilic material
(black arrow) and desquamation of spermatic cells (orange arrow)]
with moderate thickening and hyalinization in wall of seminiferous
tubules (blue arrow) were observed in the testis of rats in G3 (Fig.
1C). Unlike G2 and G3, G4 exhibited slight degenerative changes in
some seminiferous tubules (orange arrow, Fig. 1D) while in G5 the
testis seemed somewhat normal (Fig. 1E). Similar histological changes
were observed in the testis of rats treated by bromuconazole (Osman
et al., 2011) and other members of triazole (Crouse et al., 2015). These
testicular degenerative changes can also explain the reduction in the
relative testicular and epididymeal weights in all treated groups except
G5.
Fig.2. Effect of bromuconazole toxicity on MDA, SOD levels and
relative expression of Cyp19A1 and Cyp17A1 in testis. Means in column
with different superscript letters are significantly different (P≤ 0.05).
In the present study, administration of bromuconazole resulted in a
significant dose dependant elevation in the testicular level of the lipid
peroxidation biomarker MDA in G2-G4, but no significant change in G5,
as compared to control rats (Fig. 2). In contrast, the similar treatments
led to a significant dose dependant reduction in the testicular activities
of SOD in G2-G4 relative to G1 and G5 (Fig. 2). These results suggest
that bromuconazole may cause male infertility through induction of
reactive oxygen species (ROS) release which cause oxidative damage to
testis. Because testes are rich in unsaturated fatty acids, they are easily
damaged by free radicals, where lipid peroxidation deteriorate the cell
membrane structure and integrity of sperms (Mishra and Acharya,
2004). The latter also inhibit the endogenous antioxidant enzymes, such
as SOD, thereby leading to failure of ROS elimination which further
cause oxidative damages to proteins, DNA, and membrane lipids.
Another possible pathway by which bromuconazole can exert male
infertility is through reduction of estradiol which is a potent antioxidant
inducer (Montano et al., 2004; Vina et al., 2006). It is therefore possible
23
that reduced levels of estradiol could contribute to excessive release of
free radicals and inhibition of antioxidants enzymes leading to impaired
spermatogenesis that was noticed in bromuconazole -treated rat’s testis.
To determine the associated underlying molecular mechanism
regulating the steroidogenesis disruptive effect of bromuconazole, we
used qPCR to detect the expression of Cyp19A1 and Cyp17A1 and the
obtained results exhibited a significant dose dependant down-regulation
of the two genes in the testis of G2-G4 rats as compared to control
rats (Fig. 1). Again G5 showed insignificant decrease in Cyp19A1 and
Cyp17A1 expression relative to G1. To the best of our knowledge
this may be the first study to clearly demonstrate that high dose of
bromuconazole may cause male infertility through a dual inhibition of
Cyp19A1 and Cyp17A1 and this inhibition is mediated by a reduction in
serum levels of testosterone and estradiol. In agreement with our results,
previous studies on other triazoles showed similar inhibitory effect on
aromatase activity and a subsequent reduction of estradiol biosynthesis
(Edwards and Godley, 2010; Sun et al., 2006; Tully et al., 2006) and
on CYP17A1 activity with a consequent decrease in testosterone
biosynthesis (Goetz and Dix, 2009; Trosken et al., 2004). This also can
explain the lower serum levels of estradiol and testosterone noticed in
the present study following treatment with bromuconazole. Estradiol
plays a vital role in regulation of spermatogenesis and sperm motility,
thereby its dysregulation can cause male infertility (Cacciola et al.,
2013; Carreau and Hess, 2010).
Because aromatase, which is encoded by Cyp19A1 and is
responsible for conversion of testosterone to estradiol, is targeted by
bromuconazole, it would be expected to find a high testosterone level
in testis. However, this possible elevated testicular testosterone level
was not followed by the same change in serum which in contrast
had a reduced testosterone level. This may be explained on the basis
that Leydig cells may be not affected by bromuconazole and still
able to secrete testosterone but due to testicular tissue damage this
testosterone hindered in testis and did not reach blood. In consistence
with this hypothesis, other studies showed similar increase in testicular
testosteron and a decrease in serum testosteron in mercury- and lead
acetate-exposed rats (Boujbiha et al., 2011; El-Magd et al., 2016).
As bromuconazole is widely used as a pesticide for food crops and
fruits, consumers and farmers can be exposed to it by oral and dermal
route. This was the cause for which we chose these two routes in our
study and our results collectively showed that bromuconazole can cause
male infertility through induction of cellular, functional, molecular
disruption in testis in a dose-dependent manner with higher toxic effect
in oral than dermal route. Surprisingly, we also found a deteriorated
effects at NOAEL oral doses, which means that the current oral NOAEL
set by EFSA (2010) should be revised.
Conclusion
In the present study we reported for the first time that bromuconazole
exposure can induce testicular damage and loss of function, at least in
part, through ROS overproduction and downregulation Cyp19A1 and
Cyp17A1 which subsequently reduce serum estradiol and testosteron.
Although, these data provide insight into the mode of action of
bromuconazole -induced testicular toxicity, further studies are needed
to better understand the toxicity mechanisms of this fungicide.
Conflict of interest
The authors declare that there is no conflict of interests regarding
the publication of this paper.
 Mokhbatly et al., 2019, AJMS 2 (1):20-24, DOI:10.5455/ajms.17

References

Abdelhady, D.H., El-Magd, M.A., Elbialy, Z.I., Saleh, A.A., 2017. elements in medicine and biology : organ of the Society for Minerals
Bromuconazole-induced hepatotoxicity is accompanied by and Trace Elements 18, 173-178.
upregulation of PXR/CYP3A1 and downregulation of CAR/ Montano, M.M., Deng, H., Liu, M., Sun, X., Singal, R., 2004.
CYP2B1 gene expression. Toxicol Mech Methods 27, 544-550. Transcriptional regulation by the estrogen receptor of antioxidative
Alzahrani, F.A., El-Magd, M.A., Abdelfattah-Hassan, A., Saleh, A.A., stress enzymes and its functional implications. Oncogene 23, 2442-
Saadeldin, I.M., El-Shetry, E.S., Badawy, A.A., Alkarim, S., 2018. 2453.
Potential Effect of Exosomes Derived from Cancer Stem Cells and Osman, A.H., EL-Shama, S.E., Osman, A.S., Abd El-Hamed, A.K.,
MSCs on Progression of DEN-Induced HCC in Rats. Stem Cells 2011. Toxicological and pathological evaluation of prolonged
International 2018, 17 https://doi.org/10.1155/2018/8058979. bromuconazole fungicide exposure in male rats. Med J Cairo Univ
Bancroft, J.D., Gamble, M., 2008. Theory and Practice of Histological 79, 555-564.
Techniques. . 6th ed. New York/London: Churchill Livingstone; , Saleh, A.A., El-Magd, M.A., 2018. Beneficial effects of dietary silver
p. 165e175. nanoparticles and silver nitrate on broiler nutrition. Environmental
Boujbiha, M.A., Hamden, K., Guermazi, F., Bouslama, A., Omezzine, Science and Pollution Research. doi: 10.1007/s11356-018-2730-7.
A., El Feki, A., 2011. Impairment of spermatogenesis in rats by Sun, G., Thai, S.F., Lambert, G.R., Wolf, D.C., Tully, D.B., Goetz,
mercuric chloride: involvement of low 17beta-estradiol level A.K., George, M.H., Grindstaff, R.D., Dix, D.J., Nesnow, S., 2006.
in induction of acute oxidative stress. Biological trace element Fluconazole-induced hepatic cytochrome P450 gene expression and
research 142, 598-610. enzymatic activities in rats and mice. Toxicology letters 164, 44-53.
Cacciola, G., Chioccarelli, T., Fasano, S., Pierantoni, R., Cobellis, Trosken, E.R., Scholz, K., Lutz, R.W., Volkel, W., Zarn, J.A., Lutz, W.K.,
G., 2013. Estrogens and spermiogenesis: new insights from type 2004. Comparative assessment of the inhibition of recombinant
1 cannabinoid receptor knockout mice. Int J Endocrinol 2013, human CYP19 (aromatase) by azoles used in agriculture and as
501350. drugs for humans. Endocrine research 30, 387-394.
Carreau, S., Hess, R.A., 2010. Oestrogens and spermatogenesis. Philos Tully, D.B., Bao, W., Goetz, A.K., Blystone, C.R., Ren, H., Schmid,
Trans R Soc Lond B Biol Sci 365, 1517-1535. J.E., Strader, L.F., Wood, C.R., Best, D.S., Narotsky, M.G., Wolf,
Crouse, L.C.B., Lent, E.M., Leach, G.J., 2015. Oral Toxicity of 3-Nitro- D.C., Rockett, J.C., Dix, D.J., 2006. Gene expression profiling
1,2,4-triazol-5-one in Rats. International Journal of Toxicology, in liver and testis of rats to characterize the toxicity of triazole
1-12. fungicides. Toxicology and applied pharmacology 215, 260-273.
Edwards, S.G., Godley, N.P., 2010. Reduction of Fusarium head blight Vina, J., Borras, C., Gomez-Cabrera, M.C., Orr, W.C., 2006. Part of the
and deoxynivalenol in wheat with early fungicide applications of series: from dietary antioxidants to regulators in cellular signalling
prothioconazole. Food additives & contaminants. Part A, Chemistry, and gene expression. Role of reactive oxygen species and (phyto)
analysis, control, exposure & risk assessment 27, 629-635. oestrogens in the modulation of adaptive response to stress. Free
El-Magd, M.A., Abbas, H.E., El-kattawy, A.M., Mokhbatly, A., 2013. radical research 40, 111-119.
Novel polymorphisms of the IGF1R gene and their association with
average daily gain in Egyptian buffalo (Bubalus bubalis). Domestic
animal endocrinology 45, 105-110.
El-Magd, M.A., Kahilo, K.A., Nasr, N.E., Kamal, T., Shukry, M., Saleh,
A.A., 2016. A potential mechanism associated with lead-induced
testicular toxicity in rats. Andrologia 49, e12750.
Goetz, A.K., Dix, D.J., 2009. Mode of action for reproductive
and hepatic toxicity inferred from a genomic study of triazole
antifungals. Toxicological sciences : an official journal of the
Society of Toxicology 110, 449-462.
Goetz, A.K., Ren, H., Schmid, J.E., Bystone, R.C., Thillainadarajah, I.,
al., e., 2007. Disruption of Testosterone Homeostasis as a Mode of
Action for the Reproductive Toxicity of Triazole Fungicides in the
Male Rat. Toxicological Sciences 95, 227-239.
Jürg, A.Z., Beat, J.B., Schlatter, J.R., 2003. Azole Fungicides Affect
Mammalian Steroidogenesis by Inhibiting Sterol 14α-Demethylase
and Aromatase. Environmental Health Perspectives 111, 255-261.
Kjærstad, M.B., Taxvig, C., Nellemann, C., Vinggaard, A.M., Adersen,
H.R., 2010. Endocrine disrupting effects in vitro of conazole
antifungals used as pesticides and pharmaceuticals. Reproductive
Toxicology 30, 73-82.
Lent, E., Crouse, L., Wallace, S., Carroll, E., 2015. Peri-pubertal
Administration of 3-Nitro-1,2,4-Triazol-5-One (NTO) Affects
Reproductive Organ Development in Male but Not Female Sprague
Dawley Rats. Reproductive Toxicology http://dx.doi.org/10.1016/j.
reprotox.2015.04.013.
Mishra, M., Acharya, U.R., 2004. Protective action of vitamins on
the spermatogenesis in lead-treated Swiss mice. Journal of trace
24