Anda di halaman 1dari 11

Downloaded from www.sciencemag.org on April 13, 2007

Downloaded from <a href=www.sciencemag.org on April 13, 2007 CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes Rodolphe Barrangou, et al. Science 315 , 1709 (2007); DOI: 10.1126/science.1138140 The following resources related to this article are available online at www.sciencemag.org (this information is current as of April 13, 2007 ): Updated information and services, including high-resolution figures, can be found in the online version of this article at: http://www.sciencemag.org/cgi/content/full/315/5819/1709 Supporting Online Material can be found at: http://www.sciencemag.org/cgi/content/full/315/5819/1709/DC1 A list of selected additional articles on the Science Web sites related to this article can be found at: http://www.sciencemag.org/cgi/content/full/315/5819/1709#related-content This article cites 20 articles , 9 of which can be accessed for free: http://www.sciencemag.org/cgi/content/full/315/5819/1709#otherarticles This article appears in the following subject collections : Microbiology http://www.sciencemag.org/cgi/collection/microbio Information about obtaining reprints of this article or about obtaining permission to reproduce this article in whole or in part can be found at: http://www.sciencemag.org/about/permissions.dtl Science (print ISSN 0036-8075; online ISSN 1095-9203) is published weekly, except the last week in December, by the American Association for the Advancement of Science, 1200 New York Avenue NW, Washington, DC 20005. Copyright c 2007 by the American Association for the Advancement of Science; all rights reserved. The title SCIENCE is a registered trademark of AAAS. " id="pdf-obj-0-6" src="pdf-obj-0-6.jpg">

CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes Rodolphe Barrangou, et al. Science 315, 1709 (2007); DOI: 10.1126/science.1138140

Downloaded from <a href=www.sciencemag.org on April 13, 2007 CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes Rodolphe Barrangou, et al. Science 315 , 1709 (2007); DOI: 10.1126/science.1138140 The following resources related to this article are available online at www.sciencemag.org (this information is current as of April 13, 2007 ): Updated information and services, including high-resolution figures, can be found in the online version of this article at: http://www.sciencemag.org/cgi/content/full/315/5819/1709 Supporting Online Material can be found at: http://www.sciencemag.org/cgi/content/full/315/5819/1709/DC1 A list of selected additional articles on the Science Web sites related to this article can be found at: http://www.sciencemag.org/cgi/content/full/315/5819/1709#related-content This article cites 20 articles , 9 of which can be accessed for free: http://www.sciencemag.org/cgi/content/full/315/5819/1709#otherarticles This article appears in the following subject collections : Microbiology http://www.sciencemag.org/cgi/collection/microbio Information about obtaining reprints of this article or about obtaining permission to reproduce this article in whole or in part can be found at: http://www.sciencemag.org/about/permissions.dtl Science (print ISSN 0036-8075; online ISSN 1095-9203) is published weekly, except the last week in December, by the American Association for the Advancement of Science, 1200 New York Avenue NW, Washington, DC 20005. Copyright c 2007 by the American Association for the Advancement of Science; all rights reserved. The title SCIENCE is a registered trademark of AAAS. " id="pdf-obj-0-14" src="pdf-obj-0-14.jpg">

The following resources related to this article are available online at www.sciencemag.org (this information is current as of April 13, 2007 ):

Updated information and services, including high-resolution figures, can be found in the online version of this article at:

A list of selected additional articles on the Science Web sites related to this article can be found at:

This article appears in the following subject collections:

Information about obtaining reprints of this article or about obtaining permission to reproduce this article in whole or in part can be found at:

Downloaded from www.sciencemag.org on April 13, 2007

REPORTS

Fig. 3. Drag coefficient as a function of wind speed. C D is shown for an observation- based resistance coefficient, r = 0.02 cm s 1 . The red open circles are the eval- uated C D from the current and wind observations, the solid red line is a fitted quadratic curve to the C D estimates, and the red dashed lines are the 95% confidence limits for this quadratic curve. The black dotted lines represent the window for C D reported in (6), whereas the blue dots represent C D reported in (4).

4. M. D. Powell, P. J. Vickery, T. A. Reinhold, Nature 422, x 10 −3 4
4.
M.
D. Powell, P. J. Vickery, T. A. Reinhold, Nature 422,
x 10 −3
4
279 (2003).
5.
E.
D. Fernandez et al., J. Geophys. Res. 111, C08013
10.1029/2005JC003048 (2006).
6.
I. J. Moon, I. Ginis, T. Hara, J. Atmos. Sci. 61, 2334 (2004).
7.
J.
3
A. T. Bye, A. D. Jenkins, J. Geophys. Res. 111, C03024
10.1029/2005JC003114 (2006).
8.
K.
Emanuel, J. Atmos. Sci. 60, 1420 (2003).
9.
D.
A. Mitchell, W. J. Teague, E. Jarosz, D. W. Wang,
Geophys. Res. Lett. 32, L11610 10.1029/2005GL023014
(2005).
10.
D.
W. Wang, D. A. Mitchell, W. J. Teague, E. Jarosz,
2
M.
S. Hulbert, Science 309, 896 (2005).
11.
W.
J. Teague, E. Jarosz, D. W. Wang, D. A. Mitchell,
J.
Phys. Oceanogr., in press.
12.
W.
J. Teague, E. Jarosz, M. R. Carnes, D. A. Mitchell,
P.
J. Hogan, Cont. Shelf Res. 26, 2559 (2006).
1
13.
J.
F. Price, T. B. Sanford, G. Z. Forristall, J. Phys.
Oceanogr. 24, 233 (1994).
14.
Materials and methods are available as supporting
material on Science Online.
15.
G.
T. Mitchum, W. Sturges, J. Phys. Oceanogr. 12, 1310
0
(1982).
20
25
30
35
40
45
50
55
16.
S.
T. Lentz, J. Phys. Oceanogr. 24, 2461 (1994).
Wind Speed (W 10 , m s −1 )
17.
S.
J. Lentz, J. Phys. Oceanogr. 31, 2749 (2001).
18.
J.
M. Pringle, J. Phys. Oceanogr. 32, 3101 (2002).
19.
E.
L. Andreas, J. Phys. Oceanogr. 34, 1429 (2004).
Drag Coefficient (C D )

speeds below 30 m s 1 , are somewhat noisy as a result of measurement uncertainty and the need to calculate a velocity derivative, which tends to enhance noise. However, they consistently show a decreasing trend of C D for wind speeds greater than 32 m s 1 , the lower threshold for a category 1 hurricane on the Saffir-Simpson Scale. It is also apparent that the C D values are weakly dependent on the choice of the resistance co- efficient and are larger for increasing values of r. The drag coefficient estimates evaluated for r = 0.1 cm s 1 are, on average, 20% greater than those calculated for r = 0.001 cm s 1 from Eq. 3. To produce the best representation of C D for each r, a second-order curve (a function of the wind speed) was fitted by a least-squares technique to all estimated values of C D . The curves are displayed in Figs. 2 and 3. Addition- ally, the 95% confidence limits for the fitted curve are shown in Fig. 3. The pattern of the relationship between C D and the wind speed is robust, but the curve coefficients are determined by the value chosen for r in Eq. 3. However, all curves clearly show an initial increase of the drag coefficient and monotonic decrease as found by recent studies (38) after reaching a maximum value at ~32 m s 1 . Some of these studies (3, 19) imply that the decreasing drag at high winds seems to be related to the spray, foam, and bubbles from breaking waves that reduce the drag and allow the hurricane to slip over the sea. With the nearly full water-column ocean cur- rent measurements, the only unknown term left in the simplified equation of motion is the wind stress. Thus, the behavior of the drag coefficient (C D ) can easily be estimated for a range of strong winds. Despite the fact that the drag coefficient is evaluated differently here, estimates of C D determined bottom-upreasonably replicate the values determined top-downin recent studies (37). Results from our research show that C D peaks at a wind speed near 32 m s 1 and

then steadily decreases as the wind speed continues to rise. Our values for C D are in a range of C D values found using meteorological observations (4) for wind speeds greater than 32 m s 1 but are higher for lower wind speeds. These differences may be attributed to uncertain- ties in the wind measurements and the applica- bility of the simplified ocean dynamics at the lower wind speeds.

References and Notes

  • 20. We thank M. S. Hulbert, A. J. Quaid, and W. A. Goode for mooring support. We also thank the crews of the research vessels Seward Johnson I and II. This work was supported by the Office of Naval Research as a part of the Naval Research Laboratorys basic research project Slope to Shelf Energetics and Exchange Dynamics (SEED)under program element 0601153N, through the Minerals Management Service Environmental Studies Program Technology, and by the Minerals Management Service Technology Assessment and Research Program on Hurricane Ivan.

Supporting Online Material

www.sciencemag.org/cgi/content/full/315/5819/1707/DC1

  • 1. K. Emanuel, Nature 436, 686 (2005).

SOM Text

  • 2. S. E. Larsen et al., in Wind Stress Over the Ocean,

  • 3. M. A. Donelan et al., Geophys. Res. Lett. 31, L18306

Fig. S1

I. S. F. Jones,Y. Toba, Eds. (Cambridge Univ. Press,

References

New York, 2001), chap. 7.

18 October 2006; accepted 14 February 2007

10.1029/2004GL019460 (2004).

10.1126/science.1136466

CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes

Rodolphe Barrangou, 1 Christophe Fremaux, 2 Hélène Deveau, 3 Melissa Richards, 1 Patrick Boyaval, 2 Sylvain Moineau, 3 Dennis A. Romero, 1 Philippe Horvath 2 *

Clustered regularly interspaced short palindromic repeats (CRISPR) are a distinctive feature of the genomes of most Bacteria and Archaea and are thought to be involved in resistance to bacteriophages. We found that, after viral challenge, bacteria integrated new spacers derived from phage genomic sequences. Removal or addition of particular spacers modified the phage-resistance phenotype of the cell. Thus, CRISPR, together with associated cas genes, provided resistance against phages, and resistance specificity is determined by spacer-phage sequence similarity.

B acteriophages are arguably the most injection, restricting the incoming DNA, and

abundant biological entity on the planet

(1). Their ubiquitous distribution and

abortive infection systems. These antiviral bar-

riers can also be engineered and manipulated to

abundance have an important impact on micro- bial ecology and the evolution of bacterial genomes (2). Consequently, bacteria have devel- oped a variety of natural defense mechanisms that target diverse steps of the phage life cycle, notably blocking adsorption, preventing DNA

better control phage populations (2, 3). Numerous bacteria have been selected by humans and used extensively for fermentation and biotechnology processes. Unfortunately, do- mesticated bacteria used in industrial applications are often susceptible to phage attack, including

www.sciencemag.org SCIENCE VOL 315 23 MARCH 2007

1709

Downloaded from www.sciencemag.org on April 13, 2007

REPORTS

genera and species widely used as dairy cultures (4). Accordingly, the industry has devised various strategies to combat phage based on strain di- versity, bacteriophage-insensitive mutants, and plasmids bearing phage-resistance mechanisms. Streptococcus thermophilus is a low G+C Gram-positive bacterium and a key species ex- ploited in the formulation of dairy culture sys- tems for the production of yogurt and cheese. Comparative genomics analyses of closely related S. thermophilus strains have previously revealed that genetic polymorphism primarily occurs at hypervariable loci, such as the eps and rps operons, as well as two clustered regularly interspaced short palindromic repeats (CRISPR) loci (57). CRISPR loci typically consist of sev- eral noncontiguous direct repeats separated by stretches of variable sequences called spacers and are oftentimes adjacent to cas genes (CRISPR- associated). Although the function of CRISPR loci has not been established biologically, in silico analyses of the spacers have revealed se- quence homology with foreign elements, includ- ing bacteriophage and plasmid sequences (79). Based exclusively on in silico analyses, several hypotheses have been put forward proposing roles for CRISPR and cas genes, which include providing immunity against foreign genetic ele- ments via a mechanism based on RNA inter- ference (10). We analyzed the CRISPR sequences of vari- ous S. thermophilus strains, including closely related industrial strains and phage-resistant var- iants (fig. S1). Differences in the number and type of spacers were observed primarily at the CRISPR1 locus. Notably, phage sensitivity ap- peared to be correlated with CRISPR1 spacer content. Specifically, spacer content was nearly identical between parental strains and phage- resistant derivatives, except for additional spacers present in the latter. These findings therefore suggest a potential relation between the presence of additional spacers and the differences ob- served in the phage sensitivity of a given strain. This observation prompted us to investigate the origin and function of additional spacers present in phage-resistant mutants. First, we tested the hypothesis that CRISPR loci are altered during the natural generation of phage-resistant mutants. A phage-host model system was selected, consisting of a phage- sensitive wild-type S. thermophilus strain widely used in the dairy industry, DGCC7710 [wild type (WT)] and two distinct but closely related virulent bacteriophages isolated from industrial yogurt samples, phage 858 and phage 2972 (11).

1 Danisco USA Inc., 3329 Agriculture Drive, Madison, WI 53716, USA. 2 Danisco France SAS, Boîte Postale 10, F-86220 Dangé-Saint-Romain, France. 3 Département de Biochimie et de Microbiologie, Faculté des Sciences et de Génie, Groupe de Recherche en Ecologie Buccale, Faculté de Médecine Dentaire, Félix dHérelle Reference Center for Bacterial Viruses, Université Laval, G1K 7P4 Québec, Canada.

*To whom correspondence should be addressed. E-mail:

philippe.horvath@danisco.com

Nine phage-resistant mutants were generated independently by challenging the WT strain with phage 858, phage 2972, or simultaneously with both (12), and their CRISPR loci were analyzed. Differences were consistently observed at the CRISPR1 locus, where 1 to 4 additional spacers were inserted next to the 32 spacers present in the WT strain (Fig. 1). The addition of new spacers in response to phage infection seemed to be polarized toward one end of the CRISPR1 lo- cus. This is consistent with previous observations of spacer hypervariability at the leader end of the CRISPR locus in various strains (9, 13). Se- quence analysis of the additional spacers inserted

in the CRISPR1 locus of the various phage- resistant mutants revealed similarity to sequences found within the genomes of the phages used in the challenge (Fig. 2 and fig. S2). Interestingly, similarities were observed throughout the phage genomes, in most functional modules, both on the coding and noncoding strands. No particular se- quence, gene, or functional group seemed to be targeted specifically. These results reveal that, on becoming resistant to bacteriophages, the CRISPR1 locus was modified by the integration of novel spacers, apparently derived from phage DNA. Surprisingly, we observed that some strains were resistant to both phages, whereas others

cas5 cas1 cas6 cas7 repeat/spacer region ORF 1 2 3 4 5 6 7 8 9
cas5
cas1 cas6
cas7
repeat/spacer region
ORF
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
L
T
Sensitivity to Φ 858
Sensitivity to Φ 2972
10 -7 10 -6 10 -5 10 -4
10 -3 10 -2
10 -1
1
10 -7 10 -6 10 -5
10 -4 10 -3 10 -2 10 -1
1
L
1
2
WT
L
1
2
+S1S2
WT Φ858
L
1
2
+S3
WT Φ858
L
1
2
+S4
WT Φ2972
L
1
2
+S5
WT Φ2972
L
1
2
+S6
WT Φ2972
L
1
2
+S7
WT Φ2972
L
1
2
+S8
WT Φ2972
L
1
2
+S9S10S11S12
WT Φ858Φ2972
L
1
2
+S13S14
WT Φ858Φ2972
S9
S10
S13
S11
S1
S14
S12
S8
S7
S6
S5
S4
S3
S2

Fig. 1. Streptococcus thermophilus CRISPR1 locus overview, newly acquired spacers in phage- resistant mutants, and corresponding phage sensitivity. The CRISPR1 locus of DGCC7710 (WT) is at the top. The repeat-spacer region of WT is in the middle: repeats (black diamonds), spacers (numbered gray boxes), leader (L, white box), and terminal repeat (T, black diamond). (Bottom left) The spacer content on the leader side of the locus in phage-resistant mutants is detailed, with newly acquired spacers (white boxes, S1 to S14). (Bottom right) The sensitivity of each strain to phages 858 and 2972 is represented as a histogram of the efficiency of plaquing (EOP), which is the plaque count ratio of a mutant strain to that of the wild-type.

S9 S11 S3 S12 S5* S1 S4* S13 Φ 858 12 3 4 5 6 7
S9 S11
S3
S12
S5*
S1
S4*
S13
Φ 858
12
3
4
5
6
7
8 9 10 1112131415161718
19
20
21
22
2324252627282930 3132333435 36
37
38 39
40
414243444546
S14
S7
S10
S2*
S8*
S6
capsid
host
transcription
packaging
tail morphogenesis
replication
morphogenesis
lysis
regulation
S9 S11
S3
S12
S5
S1*
S4
S13
Φ 2972
1
2
3
4
5
6
7 8
9 1011121314151617
18
19
20
21 222324252627282930313233 34
35
36 37
38
394041424344
S14
S7
S10
S2*
S8
S6
1 kb

Fig. 2. S. thermophilus phage genome maps with the position of sequences similar to the acquired CRISPR1 spacers of the phage-resistant mutants. Spacers shown above and below the genome maps indicate that the spacer matches a sequence on the (+) and on the () strand, respectively. An asterisk indicates the existence of a SNP between the spacer sequence and that of the phage genome (fig. S1). The genome sequences of phage 2972 (accession number AY699705) and phage 858 are 93% identical.

  • 1710 23 MARCH 2007 VOL 315 SCIENCE www.sciencemag.org

Downloaded from www.sciencemag.org on April 13, 2007

REPORTS

were resistant only to the phage used in the chal- lenge (Fig. 1). The phage-resistance profile seemed correlated to the spacer content, such that strains with spacers showing 100% identity to sequences conserved in both phages were resistant to both phages, such as spacers S3, S6, and S7. In contrast, when nucleotide polymor- phisms were observed between the spacer and the phage sequence [from 1 to 15 single-nucleotide polymorphisms (SNPs) over 29 or 30 nucleo- tides], the spacer did not seem to provide re- sistance, such as spacers S1, S2, S4, S5, and S8 (Fig. 1 and fig. S2). In addition, when several spacers were inserted (S9 to S14), phage re- sistance levels were higher. These findings indi- cate that the CRISPR1 locus is subject to dynamic and rapid evolutionary changes driven by phage exposure. Altogether, these results reveal that CRISPR loci can indeed be altered during the generation of phage-resistant mutants and also establish a link between CRISPR content and phage sensitivity. These findings suggest that the presence of a CRISPR spacer identical to a phage sequence provides resistance against phages containing this particular sequence.

To determine whether CRISPR spacer con-

these observed modifications establish the link

tent defines phage resistance, we altered the between the CRISPR spacer content and phage

CRISPR1 locus by adding and deleting spacers (12) and tested subsequent strain sensitivity to phages. All constructs were generated and inte- grated into the S. thermophilus chromosome with

resistance. In the process of generating strain W T Ф 858 +S1S2 CRISPR1, we created WT Ф858 +S1S2 ::pR, a variant that contains the inte-

the system developed by Russell and Klaenhammer gration vector with a single repeat inserted be-

(14). We removed the spacers and repeats in the CRISPR1 locus of strainWT Ф858 +S1S2 and replaced them with a single repeat without any spacer (12). The resulting strain WT Ф858 +S1S2 CRISPR1 was sensitive to phage 858, which indicated that the

tween the cas genes and the native CRISPR1 locus (Fig. 3). Unexpectedly, strain WT Ф858 +S1S2 ::pR was sensitive to phage 858, although spacers S1 and S2 remained on the chromosome (Fig. 3). Similarly, the WT Ф2972 +S4 ::pS1S2 construct lost

phage resistance of the original phage-resistant the resistance to phage 2972, although spacer

mutant (WT Ф858 +S1S2 ) was probably linked to the presence of S1 and S2 (Fig. 3).

S4 is present in the chromosome (Fig. 3). These results indicated that spacers alone did not

Further, to address the critical question of provide resistance, and perhaps, that they have

whether adding spacers provides novel phage

to be in a particular genetic context to be

resistance, we replaced the CRISPR1 locus of effective.

strain WT Ф2972 +S4 with a version containing only spacers S1 and S2 (12) and tested whether the phage sensitivity was affected. Remarkably, the resulting strain WT Ф2972 +S4 ::pS1S2 gained re- sistance to phage 858, which suggested that these two spacers have the ability to provide phage resistance de novo (Fig. 3). Altogether,

Although initial work suggested involvement in DNA repair (15), the current hypothesis is that cas genes (5, 16) are involved in CRISPR- mediated immunity (10). Consequently, we in- activated two cas genes in strain WT Ф858 (12): cas5 (COG3513) and cas7, which are equiv- alent to str0657/stu0657 and str0660/stu0660, respectively (6, 7). The cas5 inactivation re-

+S1S2

L 1 2 cas5 cas1 cas6 cas7 ORF 1 kb I. L T cas5 cas1 cas6
L
1
2
cas5
cas1 cas6
cas7
ORF
1 kb
I.
L
T
cas5
cas1 cas6 cas7
ORF
II.
L
L
1
2
T
cas5
cas1 cas6 cas7
pORI
ORF
III.
L
L
T
1
2
cas5
cas1 cas6
cas7
ORF
pORI
IV.
L
1
2
pORI
cas1 cas6
cas7
ORF
V.
L
1
2
cas5
cas1 cas6
ORF
pORI
VI.
Sensitivity to Φ 858
Sensitivity to Φ 2972
S1
S1
S2
S2
S1
S1
S2
S1
S2
S4
S2
10 -7 10 -6 10 -5 10 -4 10 -3 10 -2 10 -1 1 10
10 -7 10 -6 10 -5 10 -4
10 -3 10 -2
10 -1
1
10 -7 10 -6 10 -5
10 -4 10 -3 10 -2 10 -1
1
I.
WT
+S1S2
Φ858
II.
WT Φ858 +S1S2 ∆ CRISPR1
III.
WT
+S1S2
::pR
Φ858
IV.
WT
Φ2972 +S4 ::pS1S2
V.
WT
+S1S2
::pcas5 –
Φ858
VI.
WT
+S1S2
::pcas7 –
Φ858

Fig. 3. CRISPR spacer engineering, cas gene inactivation, and corresponding phage sensi- tivity. I, mutant WT F 858 +S1S2 ; II, mutant WT F 858 +S1S2 DCRISPR1 in which CRISPR1 was deleted; III, mutant WT F 858 +S1S2 ::pR in which CRISPR1 was displaced and replaced with a unique repeat; IV, WT F 2972 +S4 ::pS1S2, mutant of strain WT F 2972 +S4 in which CRISPR1 was displaced and re- placed with a version containing S1 and S2; V, WT F 858 +S1S2 ::pcas5with cas5 inactivated; VI, WT F 858 +S1S2 ::pcas7with cas7 inactivated. pORI indicates the integrated plasmid (12). The phage sensitivity of each strain to phages 858 and 2972 is represented at the bottom as a histogram of the efficiency of plaquing (EOP).

sulted in loss of the phage resistance (Fig. 3),

and perhaps Cas5 acts as a nuclease, because it

contains an HNH-type nuclease motif. In con-

trast, inactivating cas7 did not alter the resist-

ance to phage 858 (Fig. 3). Interestingly, we

were repeatedly unable to generate CRISPR1

phage-resistant mutants from the cas7 knock-

out, perhaps because Cas7 is involved in the

synthesis and/or insertion of new spacers and

additional repeats.

When we tested the sensitivity of the phage-

resistant mutants, we found that plaque formation

was dramatically reduced, but that a relatively

small population of bacteriophage retained the

ability to infect the mutants. We further analyzed

phage variants derived from phage 858 that

retained the ability to infect WT Ф858 +S1S2 . In par-

ticular, we investigated the sequence of the ge-

nome region corresponding to additional spacers

S1 and S2 in two virulent phage variants. In both

cases, the genome sequence of the phage var- iant had mutated, and two distinct SNPs were

identified in the sequence corresponding to

spacer S1 (fig. S3).

Overall, prokaryotes appear to have evolved

a nucleic acidbased immunitysystem where-

by specificity is dictated by the CRISPR spacer

content, while the resistance is provided by the

Cas enzymatic machinery. Additionally, we spec-

ulate that some of the cas genes not directly

providing resistance are actually involved in the insertion of additional CRISPR spacers and re- peats, as part of an adaptive immuneresponse. Further studies are desired to better characterize the mechanism of action and to identify the specific function of the various cas genes. This nucleic acidbased system contrasts with amino acidbased counterparts in eukaryotes through which adaptative immunity is not inheritable.

www.sciencemag.org SCIENCE VOL 315 23 MARCH 2007

1711

Downloaded from www.sciencemag.org on April 13, 2007

REPORTS

The inheritable nature of CRISPR spacers sup- ports the use of CRISPR loci as targets for evo- lutionary, typing, and comparative genomic studies (9, 1719). Because this system is reactive to the phage environment, it likely plays a sig- nificant role in prokaryotic evolution and ecol- ogy and provides a historical perspective of phage exposure, as well as a predictive tool for phage sensitivity. The CRISPR-cas system may accordingly be exploited as a virus defense mech- anism and also potentially used to reduce the dissemination of mobile genetic elements and the acquisition of undesirable traits such as anti- biotic resistance genes and virulence markers. From a phage evolution perspective, the inte- grated phage sequences within CRISPR loci may also provide additional anchor points to facilitate recombination during subsequent phage infec- tions, thus increasing the gene pool to which phages have access (20). Because CRISPR loci are found in the majority of bacterial genera and are ubiquitous in Archaea (5, 13, 21), their study will provide new insights into the relation and codirected evolution between prokaryotes and their predators.

 

References and Notes

  • 16. H. Haft, J. Selengut, E. F. Mongodin, K. E. Nelson,

D.

1.

  • M. Breitbart, F. Rohwer, Trends Microbiol. 13, 278

PloS Comput. Biol. 1, e60 (2005).

(2005).

  • 17. M. A. Groenen, A. E. Bunschoten, D. van Soolingen,

P.

2.

  • S. Chibani-Chennoufi, A. Bruttin, M.-L. Dillmann, H. Brüssow,

  • J. D. A. van Embden, Mol. Microbiol. 10, 1057 (1993).

J.

Bacteriol. 186, 3677 (2004).

  • 18. F. Mongodin et al., J. Bacteriol. 187, 4935 (2005).

E.

3.

  • J. M. Sturino, T. R. Klaenhammer, Nat. Rev. Microbiol. 4,

    • 19. T. DeBoy, E. F. Mongodin, J. B. Emerson, K. E. Nelson,

R.

395

(2006).

  • J. Bacteriol. 188, 2364 (2006).

4.

  • H. Brüssow, Annu. Rev. Microbiol. 55, 283 (2001).

    • 20. W. Hendrix et al., Proc. Natl. Acad. Sci. U.S.A. 96,

R.

5.

  • R. Jansen, J. D. A. van Embden, W. Gaastra, L. M. Schouls,

2192 (1999).

Mol. Microbiol. 43, 1565 (2002).

  • 21. S. Godde, A. Bickerton, J. Mol. Evol. 62, 718

J.

6.

  • A. Bolotin et al., Nat. Biotechnol. 22, 1554 (2004).

(2006).

7.

  • A. Bolotin, B. Quinquis, A. Sorokin, S. D. Ehrlich,

    • 22. We thank L. Bayer, C. Vos, and A.-C. Coûté-Monvoisin

Microbiology 151, 2551 (2005).

of Danisco Innovation, as well as J. Labonté and

8.

  • F. J. M. Mojica, C. Díez-Villaseñor, J. García-Martínez,

  • D. Tremblay of Université Laval for technical support, and

  • E. Soria, J. Mol. Evol. 60, 174 (2005).

  • E. Bech Hansen for discussions and critical review of

9.

  • C. Pourcel, G. Salvignol, G. Vergnaud, Microbiology 151,

the manuscript. Also, we thank T. R. Klaenhammer for

  • 653 (2005).

providing the integration system. This work was

  • 10. S. Makarova, N. V. Grishin, S. A. Shabalina, Y. I. Wolf,

K.

supported by funding from Danisco A/S. Also, S. M. would

E.

V. Koonin, Biol. Direct 1, 7 (2006).

like to acknowledge support from the Natural Sciences

  • 11. Lévesque et al., Appl. Environ. Microbiol. 71, 4057

C.

and Engineering Research Council of Canada (NSERC)

GenBank, accession numbers EF434458 to EF434504.

(2005).

  • 12. Information on materials and methods for the generation

Discovery Program. Sequences were deposited in

of phage-resistant mutants, engineering of CRISPR spacers (Figs. S4 and S5), and inactivation of cas genes is

Supporting Online Material

available on Science Online.

www.sciencemag.org/cgi/content/full/315/5819/1709/DC1

  • 13. K Lillestøl, P. Redder, R. A. Garrett, K. Brügger,

R.

Materials and Methods

Archaea 2, 59 (2006).

Figs. S1 to S5

  • 14. M. Russell, T. R. Klaenhammer, Appl. Environ. Microbiol.

W.

References and Notes

67, 4361 (2001).

  • 15. S. Makarova, L. Aravind, N. V. Grishin, I. B. Rogozin,

K.

29 November 2006; accepted 16 February 2007

E.

V. Koonin, Nucleic Acids Res. 30, 482 (2002).

10.1126/science.1138140

A G ProteinCoupled Receptor Is a Plasma Membrane Receptor for the Plant Hormone Abscisic Acid

Xigang Liu, 1,2 Yanling Yue, 1 Bin Li, 3 Yanli Nie, 1 Wei Li, 2 Wei-Hua Wu, 3 Ligeng Ma 1,2 *

The plant hormone abscisic acid (ABA) regulates many physiological and developmental processes in plants. The mechanism of ABA perception at the cell surface is not understood. Here, we report that a G proteincoupled receptor genetically and physically interacts with the G protein a subunit GPA1 to mediate all known ABA responses in Arabidopsis. Overexpressing this receptor results in an ABA-hypersensitive phenotype. This receptor binds ABA with high affinity at physiological concentration with expected kinetics and stereospecificity. The binding of ABA to the receptor leads to the dissociation of the receptor-GPA1 complex in yeast. Our results demonstrate that this G proteincoupled receptor is a plasma membrane ABA receptor.

A bscisic acid (ABA) is an important In contrast, several earlier experiments had sug- hormone that mediates many aspects of gested that extracellular perception is critical for

plant growth and development, particu-

larly in response to the environmental stresses (13). Several components involved in the ABA signaling pathway have been identified (4). Two recent reports have shown that the nuclear RNA binding protein flowering time control protein (FCA) (5) and the chloroplast protein Mg chelatase H subunit (6) are ABA receptors (6).

ABA to achieve its functions (79). Thus, other ABA receptors, especially plasma membranelocalized receptors, may be the major players for perceiving extracellular ABA and mediating the classic ABA signaling responses. Ligand-mediated signaling through G proteincoupled receptors (GPCRs) is a conserved mechanism for the extracellular signal percep-

tion at the plasma membrane in eukaryotic

1 National Institute of Biological Sciences, 7 Science Park Road, Zhongguancun Life Science Park, Beijing 102206, China. 2 Laboratory of Molecular and Cellular Biology, Hebei Normal University, Shijiazhuang, Hebei 050016, China. 3 State Key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing 100094, China.

*To whom correspondence should be addressed. E-mail:

maligeng@nibs.ac.cn

organisms (10). The GPCR-mediated signaling pathway plays a central role in vital processes such as vision, taste, and olfaction in animals (11). However, the higher plant Arabidopsis thaliana has only one canonical Ga (GPA1) subunit, one Gb subunit, and two Gg subunits (1216). The significance of these subunits in plant systems is poorly understood; only one

Arabidopsis putative GPCR protein (GCR1) has been characterized in plants (1720), and no ligand has been defined for any plant GPCR. To identify previously unrecognized GPCR proteins in Arabidopsis, we started by searching the Arabidopsis genome and found a gene (GCR2, GenBank accession code At1g52920) encoding a putative GPCR. Transmembrane structure prediction suggests that GCR2 is a membrane protein with seven transmembrane helices (fig. S1, A and B). The subsequent cel- lular localization analysis confirmed its plasma membrane localization in the transgenic plant root (fig. S1C). GCR2yellow fluorescent pro- tein (YFP) is detected in the membrane fraction isolated from the GCR2-YFP transgenic plant. Similar to GCR1 (19), GCR2 is mostly asso- ciated with the membrane fraction (fig. S1D). Furthermore, even after washing with detergent or a higher pH buffer, GCR2 is retained with the membrane fraction, suggesting that GCR2 is an integral membrane protein (fig. S1D). One feature of the GPCR is its ability to interact with G protein to form a complex. To confirm the physical interaction between GCR2 and Ga, we used four different approaches to detect their interaction. We first used surface plasmon resonance spectroscopy to investigate the interaction between GCR2 and GPA1. For this purpose, we expressed and purified recom- binant GCR2 and GPA1 proteins in bacteria (fig. S2). This in vitro assay clearly indicated that GPA1 is capable of binding to GCR2, where- as no binding activity was detected between GPA1 and bovine serum albumin (BSA) (fig. S3, A and B). The dissociation binding con- stant (K d ) for GCR2 and GPA1 is 2.1 × 10 9 M (fig. S3C).

  • 1712 23 MARCH 2007 VOL 315 SCIENCE www.sciencemag.org

MATERIALS AND METHODS

Isolation of phage-resistant mutants and confirmation of CRISPR sequences Streptococcus thermophilus phage-resistant mutants were obtained by challenging the wild-type host strain DGCC7710 (also called RD534) with phage 2972 and/or phage 858 (1). The host strain was grown at 42ºC in 10 ml of M17 broth supplemented with 0.5% lactose (LM17). When the optical density (600 nm) reached 0.3, phages and calcium chloride 10mM were added at a final concentration of 10 7 pfu/ml and 50 mM, respectively. The phage-containing culture was incubated at 42ºC for 24 hours and monitored for lysis. Then, 100 µl of the lysate were inoculated into 10 ml of fresh LM17. The remaining lysate was centrifuged and the pellet was inoculated into another tube containing 10 ml of fresh LM17. These two cultures were incubated at 42ºC for 16 hours. Finally, these cultures were diluted and plated on LM17. Isolated colonies were tested for phage sensitivity as previously described (2). The CRISPR loci of the resistant isolates were verified by sequencing PCR products, and using relevant phage genome information (1).

CRISPR spacer engineering

Enzymes used to carry out restriction digests and PCR were purchased from Invitrogen and used according to the manufacturer’s instructions. PCRs were carried out on an Eppendorf Mastercycler Gradient thermocycler. Gene inactivation and site-specific plasmid insertion via homologous recombination in the S. thermophilus chromosome were carried out by sub-cloning into the pCR2.1-TOPO system (Invitrogen), by subsequent cloning in the pORI system using Escherichia coli as a host, and the constructs were ultimately purified and transformed into S. thermophilus as previously described (3). DNA from mutant WT F858 +S1S2 was used as a template to amplify two distinct PCR fragments using P1 (5'-acaaacaacagagaagtatctcattg-3') and P2 (5'-aacgagtacactcactatttgtacg-3') in one reaction, and P3 (5'-tccactcacgtacaaatagtgagtgtactcgtttttgtattctcaagatttaagtaactgtacagtttgattcaacataaaaag-3') and P4 (5'-ctttccttcatcctcgctttggtt-3') in another reaction. Both PCR products were subsequently used as templates in another PCR reaction using primers P1 and P4 to generate the S1S2 construct (fig. S4). The S1S2 construct was sub-cloned into the Invitrogen pCR2.1-TOPO system. This construct was digested with NotI and HindIII and subsequently cloned into pORI at the NotI and HindIII sites, providing the pS1S2 construct. Integration of pS1S2 into the CRISPR1 locus of strain WT F2972 occurred via homologous recombination at the 3' end of cas7, to generate WT F2972 +S4 ::pS1S2. The pR construct was generated using the pS1S2 construct as a template. Specifically, the S1S2 construct sub-cloned into pCR2.1-TOPO was digested using BsrGI, which cuts within the CRISPR repeat. Then, the digest was religated and a plasmid containing a single repeat and no spacer was used subsequently for cloning into pORI using NotI and HindIII, generating pR. Integration of pR into the chromosome of strain WT F858 +S1S2 at the 3' end of cas7 via homologous recombination generated WT F858 +S1S2 ::pR, a mutant where the CRISPR1 locus is displaced and a unique repeat is inserted in its place.

+S4

The mutant WT F858 +S1S2 ::pR was subsequently grown in the absence of erythromycin, and antibiotic-sensitive variants were analyzed to find a mutant that had a complete deletion of the CRISPR1 locus. The deletion was derived from homologous recombination occurring at the 3' end of ORF (as opposed to a recombination event occurring at the 3' end of cas7, which would have resulted

in restoration of the strain WT F858 +S1S2 ), generating WT F858 +S1S2 DCRISPR1, a mutant where the CRISPR1 locus is deleted (fig. S5).

Inactivation of cas genes For cas5 inactivation, a 801-bp internal piece of cas5 was amplified by PCR using primers 5'-caaatggatagagaaacgc-3' and 5'-ctgataaggtgttcgttgtcc-3' and sub-cloned into Escherichia coli pCR2.1- TOPO (Invitrogen). This construct was digested with EcoRV and HindIII and subsequently cloned into pORI at the EcoRV and HindIII sites. Integration of this construct into the cas5 gene of strain WT F858 +S1S2 occurred via homologous recombination of the internal piece of the gene, resulting into

WT F858 +S1S2 ::pcas5-.

Similarly, a 672-bp internal piece of cas7 was amplified by PCR using primers 5'-ggagcagatggaatacaagaaagg-3' and 5'-gagagactaggttgtctcagca-3' and sub-cloned into Escherichia coli pCR2.1-TOPO (Invitrogen). This construct was digested with EcoRV and HindIII and subsequently cloned into pORI at the EcoRV and HindIII sites. Integration of this construct into the cas7 gene of

strain WT F858 +S1S2 occurred via homologous recombination of the internal piece of the gene, resulting into WT F858 +S1S2 ::pcas7-.

SUPPORTING FIGURES

Strain
Strain
Accession GenBank
Accession
GenBank
Lysotype
Lysotype
Comment 4 5 1 2 3
Comment
4
5
1
2
3
n n 28 29 38 39 47 48 36 37 42 43 34 35 32 33
n n
28
29
38
39
47
48
36
37
42
43
34
35
32
33
30
31
9
10
53
54
49
50
45
46
11
12
40
41
7
8
51
52
18
19
6
15
13
20
16
26
25
23
14
27
24
22
21
44
17
l
l u l u u u u n u u l u u u u l
l
u
l
u
u
u
u
n
u
u
l
u
u
u
u
l
x
x
u
u
u
l
u
u
u
u
u
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
x
u
u
u
u
x
l
u
l
u
u
L
u
u
L
u
u
x
u
u
u
u
u
u
u
u
l
¦
¦
l
l
u
u
u
u
u
u
u
u
u
u
u
u
u
n
u
u
u
u
l
u
u
u
u
¦
u
u
u
u
u
n
u
u
u
u
u
¦
n
¦
¦
¦
¦
¦
¦
¦
u
u
u
¦
u
u
u
u
u
u
u
u
u
n
u
u
n
u
u
u
u
u
u
l
u
u
l
u
u
u
n
u
u
l
l
u
u
n
u
u
l
l
u
u
n
u
l
n
u
u
l
u
¦
L
u
u
u
u
u
n
u
L
n
u
u
l
u
¦
l
u
u
n
u
n
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
u
l
n
u
u
l
u
l
L
u
u
u
u
u
u
u
u
u
l
u
L
u
u
l
u
l
l
u
u
u
u
u
u
u
u
u
u
u
l
u
u
u
l
u
u
L
u
u
u
¦
¦
¦
u
u
u
u
l
u
u
¦
u
u
l
¦
u
u
u
u
l
u
u
u
u
u
u
u
u
u
l
u
u
l
n
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
n
u
l
u
l
u
u
x
u
u
u
u
l
L
u
¦
¦
¦
u
l
l
u
u
x
u
n
u
x
u
L
u
u
l
u
x
u
u
u
u
u
u
x
x
u
u
x
x
u
u
l
u
u
u
u
u
u
u
u
u
u
u
x
x
n
x
u
u
u
u
u
u
u
x
u
u
u
u
u
x
l
u
u
u
l
L
u
n
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
u
u
u
u
u
u
u
u
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
x
u
u
u
u
u
u
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
x
x
u
u
u
u
x
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
x
u
u
u
u
u
u
u
u
u
l
u
u
u
u
u
u
u
u
u
u
x x x x x x x
u
u
u
u
u
u
u
u
u
u
x
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
u
u
u
u
u
u
u
u
u
u
x
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
u
u
u
u
u
l
u
u
u
x
u
l
u
u
u
u
u
u
u
x
u
x
u
l
u
u
u
u
n
u
u
n
u
u
u
u
u
u
u
L
u
u
u
u
u
u
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
l
u
u
u
u
u
u
n
u
u
n
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
x
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
u
l
u
u
u
u
l
u
u
u
u
l
u
u
u
u
u
u
l
u
u
l
u
u
x
u
u
u
u
u
u
x
x
x
x
x
u
u
u
u
x
u
u
u
u
u
u
u
l
u
u
u
u
u
u
u
x
u
x
x
u
£
u
u
£
x x x x x x x x x
l
u
u
u
u
u
u
u
u
u
£
x x x x x x x x x
x
u
u
u
u
u
u
u
l
u
u
u
u
u
l
u
u
u
u
u
x
u
L
u
u
u
u
u
n
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
u
n
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
p
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
p
u
u
u
u
u
n
l
u
u
u
u
u
x
u
x x x x x x x x
u
n
u
u
u
u
u
u
u
l
u
u
n
u
u
u
u
u
l
u
p
u
u
u
u
u
u
l
u
x x x x x x x x
x
n
u
u
u
u
u
u
u
u
x
u
u
u
u
u
u
u
u
u
u
u
n
x x x x x x x x
u
u
n
u
u
u
u
u
u
u
u
u
x
x
n
u
u
u
u
x
u
u
u
u
n
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
p
u
u
u
u
x x x x x x x x
u
x
u
u
u
u
x
u
u
l
L
u
u
u
u
u
u
u
u
x
u
u
l
u
u
n
x
u
u
u
u
u
L
u
u
u
l
l
n
u
u
u
u
l
u
n
u
u
n
u
n
l
u
u
u
u
u
u
u
L
l
u
u
u
u
u
u
u
u
u
x
u
u
u
x
n
u
u
u
u
x
u
u
u
u
u
x
u
x x x
l
u
u
u
p
u
l
u
u
u
u
l
u
u
u
u
u
u
u
u
l
u
u
u
u
u
x x x x x
u
u
u
u
u
u
n
u
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
x
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
x
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
n
u
n
u
u
l
u
u
l
u
x
u
u
u
l
u
n
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
u
u
u
l
u
u
u
l
u
u
u
u
u
u
n
u
u
n
u
u
u
l
u
u
n
u
u
¦
x
u
u
u
u
u
u
u
u
L
x x x x x
u
u
u
u
u
l
l
u
u
u
u
u
u
u
u
u
u
u
u
x
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
n
u
u
u
u
u
u
l
u
L
u
u
L
L
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
u
l
u
l
u
u
n
u
l
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
n
u
u
u
u
u
u
n
u
u
u
n
u
u
u
u
u
u
u
u
u
u
x
x
x
x
u
u
l
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
x
u
u
u
u
L
n
x
u
u
l
u
x
u
u
u
u
u
x
x x x x x x x x x x
l
u
u
u
u
l
u
u
u
u
u
n
u
u
u
x x x
u
l
u
u
u
u
u
u
n
l
u
u
x x x x x x x x x x x x x x
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
u
l
l
u
u
l
u
u
u
u
x
L
u
x
u
u
u
u
u
u
l
u
£
u
u
u
u
u
u
u
u
x
u
u
u

Fig. S1. Graphic representation of CRISPR1 spacers across a variety of S. thermophilus strains. Repeats are not included, only spacers are represented. Each spacer is represented by a combination of one select character in a particular font color, on a particular background color. The color combination allows unique representation of a particular spacer, whereby squares with similar color schemes (combination of character color and background color) represent identical spacers, whereas different color combinations represent distinguishable spacers. Missing spacers are represented by crossed squares. L (blue): CRISPR leader sequence. In the third column, a letter indicates strain lysotype, whereby the lysotype is defined as the spectrum of sensitivity of the strain to a set of phages; lysotypes that show minor differences for specific phages are distinguished by an additional number. n.d.: not determined. BIM: bacteriophage insensitive mutant.

S1

CAACACATTCAACAGATTAATGAAGAATAC

 

F858

..............................

31381 - 31410 (+)

F2972

....

GAT.GATTTC

.....

T.AC

...

GA ..

30702 - 30731 (+)

S2

TCCACTCACGTACAAATAGTGAGTGTACTC

F858

.......................

  • C 25442 - 25471 (-)

......

F2972

.......................

  • C 25432 - 25461 (-)

......

S3

TTACGTTTGAAAAGAATATCAAATCAATGA

 

F858

..............................

17215 - 17244 (+)

F2972

..............................

17202 - 17231 (+)

S4

CTCAGTCGTTACTGGTGAACCAGTTTCAAT

F858

......

T

..............

T

..

32292 - 32321 (+)

F2972

..............................

31582 - 31611 (+)

S5

AGTTTCTTTGTCAGACTCTAACACAGCCGC

F858

G

T

22124 - 22153 (+)

F2972

..............................

22075 - 22104 (+)

S6

GCCCTTCTAATTGGATTACCTTCCGAGGTG

F858

..............................

35334 - 35363 (-)

F2972

..............................

34492 - 34521 (-)

S7

AAGCAAGTTGATATATTTCTCTTTCTTTAT

F858

..............................

10280 - 10309 (-)

F2972

..............................

10270 - 10299 (-)

S8

CGTTTTCAGTCATTGGTGGTTTGTCAGCG

F858

.T.C

CTCAC.AAA

TTTA T

30680 - 30708 (-)

F2972

.............................

29988 - 30016 (-)

S9

TTACTAGAGCGTGTCGTTAACCACTTTAAA

F858

..............................

7882 -

7911 (+)

F2972

..............................

7874 -

7903 (+)

S10

TTCGTTAAAGTCACCTCGTGCTAGCGTTGC

 

F858

..............................

20670 - 20699 (-)

F2972

..............................

20621 - 20650 (-)

S11

ATAACGGTAGCAAATATAAACCTGTTACTG

F858

..............................

8368 -

8397 (+)

F2972

..............................

8360 -

8389 (+)

S12

GAAGTAGCCATACAAGAAGATGGATCAGCA

 

F858

..............................

19047 - 19076 (+)

F2972

..............................

18998 - 19027 (+)

S13

GATGTCACTGAGTGTCTAAGCATTGCGTAC

F858

..............................

34444 - 34473 (+)

F2972

..............................

33602 - 33631 (+)

S14

TGAATAAGCAGTTCTTGACGACCAACCGAC

F858

..............................

4809 -

4838 (-)

F2972

..............................

4801 -

4830 (-)

Fig. S2. Alignment of the acquired CRISPR spacers with the corresponding genomic region of phage 858 and phage 2972. Identical bases are indicated by a dot, whereas nucleotide polymorphisms are specified. Positions (bp) and DNA strand relative to the phage genomes are indicated on the right.

S1

CAACACATTCAACAGATTAATGAAGAATAC

F858

..............................

F858-A

A

F858-B

C.

Fig. S3. Alignment of CRISPR spacer S1 with the corresponding genomic region of phage 858 and the

two mutant phages that have circumvented the CRISPR resistance of strain WT F858

+S1S2

.

WT WT +S1S2 +S1S2 repeat/spacer region repeat/spacer region F858 F858 cas5 cas5 cas1 cas1 cas6 cas6
WT
WT
+S1S2
+S1S2
repeat/spacer region
repeat/spacer region
F858
F858
cas5
cas5
cas1
cas1
cas6
cas6
cas7
cas7
ORF
ORF
ORF
L
L
T
T
P1
P1
P2
P2
P3
P3
P4
P4
L
L
T
T
P1
P1
P4
P4
S1S2 construct:
S1S2 construct:
L
L
T
T
S1
S1
S2
S2
S1
S1
S1
S1
S2
S2
S2
S2
S2
S2
S2
S2

Fig. S4. Schematic representation of the PCR strategy followed to generate the S1S2 construct. Genomic DNA of strain WT F858 +S1S2 was used as a template in two distinct PCR reactions with primer pairs P1-P2, and P3-P4, respectively. The two PCR products were mixed and subjected to a third PCR reaction in the presence of primers P1 and P4.

WT F858

WT

WT

F858

F858

+S1S2

+S1S2

+S1S2

cas5

cas5

cas5

cas5

cas1

cas1

cas1

cas1

cas6

cas6

cas6

cas6

cas7

cas7

cas7

cas7

repeat/spacer region

repeat/spacer region

repeat/spacer region

repeat/spacer region

ORF

ORF

ORF

ORF

ORF

F 858 WT WT F 858 F 858 +S1S2 +S1S2 +S1S2 cas5 cas5 cas5 cas5
F 858 WT WT F 858 F 858 +S1S2 +S1S2 +S1S2 cas5 cas5 cas5 cas5

Integration of the pR plasmid

Integration of the pR plasmid

Integration of the pR plasmid

Integration of the pR plasmid

via homologous recombination

via homologous recombination

via homologous recombination

via homologous recombination

pORI pORI pORI pORI WT WT +S1S2 +S1S2 ::pR ::pR WT F858 +S1S2 ::pR F858 F858
pORI
pORI
pORI
pORI
WT
WT
+S1S2
+S1S2
::pR
::pR
WT F858 +S1S2 ::pR
F858
F858
repeat/spacer region
repeat/spacer region
repeat/spacer region
repeat/spacer region
cas5
cas5
cas5
cas5
cas1
cas1
cas1
cas1
cas6
cas6
cas6
cas6
cas7
cas7
cas7
cas7
ORF
ORF
ORF
ORF
ORF
pORI
pORI
pORI
pORI
cas5 cas5 cas5 cas1 cas1 cas1 cas6 cas6 cas6 cas7 cas7 cas7 Plasmid excision Plasmid excision
cas5
cas5
cas5
cas1
cas1
cas1
cas6
cas6
cas6
cas7
cas7
cas7
Plasmid excision
Plasmid excision
repeat/spacer region
repeat/spacer region
repeat/spacer region
repeat/spacer region
pORI
pORI
pORI
pORI
with deletion
with deletion
of CRISPR1
of CRISPR1
WT
WT F858 +S1S2 DCRISPR1
WT
+S1S2
+S1S2
DCRISPR1
DCRISPR1
F858
F858
cas5
cas5
cas5
cas5
cas1
cas1
cas1
cas1
cas6
cas6
cas6
cas6
cas7
cas7
cas7
cas7
ORF
ORF
ORF
ORF
F 858 WT WT F 858 F 858 +S1S2 +S1S2 +S1S2 cas5 cas5 cas5 cas5

Fig. S5. Diagram representing the homologous recombination events that led to mutants WT F858 +S1S2 ::pR and WT F858 +S1S2 DCRISPR1. Strain WT F858 +S1S2 ::pR was generated through integration of the pR plasmid into cas7. Subsequently strain WT F858 +S1S2 DCRISPR1 was obtained after plasmid excision via homologous recombination at the 3' end of ORF.

SUPPORTING REFERENCES

  • 1. C. Lévesque et al., Appl. Environ. Microbiol. 71, 4057 (2005).

  • 2. S. Moineau, J. Fortier, H.-W. Ackermann, S. Pandian. Can J. Microbiol. 38, 875 (1992).

  • 3. W. M. Russell, T. R. Klaenhammer, Appl. Environ. Microbiol. 67, 4361 (2001).

Supporting Online Material

www.sciencemag.org Materials and Methods Figs. S1 to S5 References and Notes