xvii
ABSTRACT
Penicillin is an antibiotic that has resistance to Staphylococcus aureus
bacteria. Cases of Penicillin-class antibiotic resistance to Staphylococcus aureus
called MRSA which is a major cause of nosocomial infections in various hospitals
in the world, including Indonesia. This resistance mediated by a gene that
encodes beta lactamase is blaZ gene. ß-lactamase enzyme secretion inactivates
antibiotics by hydrolysis of ß-lactam rings so that bacteria become resistant.
Detection of resistance can be done by PCR method which requires a primer in
the form of a short DNA sequences as target DNA identifiers. In silico testing is
one method that is effective and efficient in designing a primer. The method used
in primary design in silico based bioinformatics is to use the site of NCBI,
Primer3Plus, and OligoAnalyzer. The results primary design of the
Staphylococcus aureus blaZ gene obtained 10 primary candidates from the
optimum melting temperature (Tm) of 55 ° C and 60 ° C. The best primary criteria
for blaZ gene detection Staphylococcus aureus is primary 1 which has a forward
primary base sequence ATTTGCCTATGCTTCGACTT and reverse primary base
sequence GCTTGACCACTTTTATCAGC. The primary design criteria produced
are having a base length of 20 bp, Tm 55.4 ° C and 55 ° C,% GC of 40% and
45%, hairpin with a value of ΔG -0.75 and 1.23 kcal / mol, self dimer with a value
of ΔG -3.14 kcal / mol, and hetero dimer with a value of ΔG -4.74 kcal / mol.
Keyword: Primary design, blaZ gene, resistance, S.aureus, in silico
xviii