Anda di halaman 1dari 3

Molecular Ecology Notes (2004) 4, 608– 610 doi: 10.1111/j.1471-8286.2004.00752.

PRIMER NOTE
Blackwell Publishing, Ltd.

Microsatellite loci for the weaver ant Oecophylla smaragdina


N . A Z U M A ,* J . T A K A H A S H I ,† S . H I G A S H I * and M . S A S A K I †
*Graduate School of Environmental Earth Science, Hokkaido University, Sapporo, 060-0810, Japan, †Laboratory of Entomology,
Graduate School of Agriculture, Tamagawa University, Machida, Tokyo, 194-8610, Japan

Abstract
We developed 13 microsatellite loci in Oecophylla smaragdina from random amplified poly-
morphic DNA (RAPD) fragments. These loci showed two to 14 alleles in O. smaragdina
with expected heterozygosity of each locus from 0.10 to 0.89, and six were also polymorphic
in the related species, O. longinoda. The results suggested that the loci will be useful to
analyse the genetic structure of Oecophylla species at both the colony and population levels.
Keywords: microsatellite DNA, Oecophylla longinoda, Oecophylla smaragdina, random amplified
polymorphic DNA, weaver ant

Received 9 April 2004; revision received7 June 2004; accepted 23 June 2004

The weaver ant Oecophylla (Hymenoptera, Formicidae) is a from random amplified polymorphic DNA (RAPD)
relatively old genus in the subfamily Formicinae, with fragments, according to the method of Takahashi et al. (in
only two extant species, Oecophylla longinoda (Latreille) dis- preparation). The total DNA of O. smaragdina was randomly
tributed in tropical Africa, and O. smaragdina (Fabricius) in amplified using a 10-bp primer of random nucleotide
Southeast Asia and Australia (Wheeler 1922; Bolton 1995). sequence (Operon Technologies Inc.) by polymerase chain
Both are arboreal and make peculiar global or elliptical reaction (PCR). A total of 120 primers (OPA, OPB, OPH,
nests of leaves spun with silk supplied by larvae. They OPI, OPY and OPZ01–20) were used in this study. Each
form exceptionally aggressive and territorial colonies that RAPD reaction (15 µL) contained 15 ng of template DNA,
occasionally dominate a wide range of forest canopies. 1.5 µL of 10 × reaction buffer, 1.5 µL of dNTP mix (1 mm of
Although these characteristics have attracted many researchers, each dNTP), 18 pmol of one of the 120 primers, and 0.6 U
the mating structure and the genetic structures of the of Taq DNA polymerase (TaKaRa Taq, TaKaRa). The
colonies are still controversial in O. smaragdina. Fraser & thermal cycle profile consisted of 45 cycles of 1 min at 94 °C,
Crozier (1999) stated that, on average, O. smaragdina has 1 min at 35 °C, a 0.3 °C/s temperature transition to 72 °C
a monoandrous mating system with rare polyandry. and 2 min at 72 °C. For the first screening, 1 µL of product
However, because their estimation was based on only three from each different primer was dropped separately onto a
microsatellite loci, additional genetic markers should be positively charged nylon membrane (FMC). After drying at
used for a more precise conclusion to be made. Also, the room temperature, DNAs on the membrane were blotted
queen numbers in mature colonies should be tested because by normal alkaline transfer. RAPD products containing
O. smaragdina had been regarded as a monogynous species microsatellite regions were detected using a biotinylated
(Hölldobler & Wilson 1990), but Peng et al. (1998) reported DNA detection kit (Imaging High-Color, Toyobo) and
multiple queens in well-established colonies. Suitable genetic biotin-labelled oligonucleotides [(GA)10, (AT)10, (GC)10,
markers are needed to resolve this conflict. Therefore, as (AGC)7, (AGT)7, (ACG)7, and (ATG)7] as probes for the
a preparation for these investigations, in this study we microsatellites. Here, 22 of the 120 primers’ products were
describe polymorphic microsatellite loci isolated from positive. These were then mixed together and purified
O. smaragdina. using a QIAamp PCR purification kit (Qiagen) in a final
Total genomic DNA was extracted by the cetyltrimethyl volume of 15 µL. Both ends of the purified fragments
ammonium bromide (CTAB) method of Hillis et al. (1990) were blunted, kinased using TaKaRa BKL kit (TaKaRa),
and Navarro et al. (1999). Microsatellite loci were searched and ligated into SmaI-cut pUC19 plasmids using the same
kit, following the manufacturer’s instructions. Recombinant
Correspondence: Noriko Azuma. Fax: +81-11 7366304; plasmids were transformed into competent Escherichia coli
E-mail: anoriko@ees.hokudai.ac.jp cells (Competent High-JM109-, TaKaRa). A total of 550

© 2004 Blackwell Publishing Ltd


P R I M E R N O T E 609

Table 1 Characterization of 13 polymorphic microsatellite loci isolated from Oecophylla smaragdina. The product size and repeat region data
are based on the sequenced allele submitted to the GenBank with expressed Accession no. Number of alleles detected for each species are
shown in parentheses following observed heterozygosity (HO). NP = no scorable product

GenBank
Locus Size Ta Accession O. smaragdina O. longinoda
name Repeat pattern (bp) Primer sequence (5′−3′) (°C) no. (n = 20) (n = 1)

MS2.2.2 (GCA)6 107 F: GTCTTATGTGTGGCCACTGCGA 48 AB174735 HO = 0.45 (4) (2)


R: GTGAAATGAACGTGACTTG HE = 0.61
MS2.3 (GT)5GC(GT)5 134 F: TCCAGGTGACCGTCGTGT 48 AB174736 HO = 0.10 (4) NP
R: CATACACATTCGCGTACG HE = 0.63
MS2.14 (CGA)4CGT(CGA)6CAA–(CGA)10TGA(CGA)3 235 F: TCTACGTGTCTAACCCAAC 52 AB174734 HO = 0.40 (13) (1)
R: GCGAGTCTACTCCATCGTATAG HE = 0.89
MS3.2 (GA)6 93 F: GTGACATTGTCGGCGA 52 AB174737 HO = 0.00 (2) (1)
R: CGAGCGCGAAAATTTCGTC HE = 0.10
MS5.2 (CT)11(CTTT)3GTTT(CTTT)2 129 F: AATTACAGTTCGGTCTCG 48 AB174740 HO =0.60 (7) (2)
R: ATCGAACTTCGCTTCGGTTGTA HE = 0.77
MS5.10 (GA)3AA(GA)5A8(GA)4 103 F: GAGAGGAAGTGCACCACAATG 52 AB174738 HO = 0.05 (3) (1)
R: CGAACCGTGAGGAAATGTCGA HE = 0.52
MS5.13 (GA)9 133 F: AGGCATGCATTAAGCTTC 48 AB174739 HO = 0.4 (6) (2)
R: AGGCATGCATTAAGCTTC HE = 0.67
MS6.29 (GA)3AA(GA)4A(GA)3 176 F: CAATCCAGTTGCACGGCTA 49 AB174741 HO = 0.15 (4) (1)
R: GTAACTTCGAGTTCGC HE = 0.23
MS6.45 (GTT)3GCT(GTT)9(GCT)4(GTT)2(GCT)4 235 F: GGTCGTTGCTGACCGT 49 AB174742 HO = 0.60 (6) (2)
R: CAGATACAGGCAATGCT HE = 0.70
MS6.47 (GA)9 137 F: AGCCCTCTTGTTCATGA 45 AB174743 HO = 0.20 (3) (2)
R: TTAAATTCGGCCGCA HE = 0.66
MS7.1 (GAT)8 95 F: AAAGGACGTTGACGCGAC 52 AB174744 HO = 0.25 (3) (2)
R: ACGTGCAATCCATTCACG HE = 0.52
MS7.1.3 (GAT)9–(GTT)4–(GCC)4 248 F: TGATGATACGATTGCAGA 48 AB174745 HO = 0.15 (4) (1)
R: TGCTGGAGTCGAGCAGT HE = 0.42
MS8.24 (CTT)5TCT(CTT)3–(GA)3AA(GA)11AATA(GA)9 289 F: GCAGACAATGGCTATTTGT 50 AB174746 HO = 0.56 (6)* (1)
R: CGATGTGATTTAGCCGA HE = 0.83

*The primer pair for MS8.24 could not amplify proper PCR products in five individuals from India of O. smargdina.

recombinant colonies were chosen and suspended inde- Proper PCR primer regions could be determined for
pendently in 30 µL of Tris-EDTA (10 mm Tris-HCl pH 7.4, 14 loci from the results of sequencing, and to test the
1 mm EDTA pH 8.0). Each suspended colony was heated effectiveness of these loci, 20 individuals of O. smaragdina
at 98 °C for 5 min and then centrifuged for 1 min at from mainland Asia, Indonesia and Australia, and one of
8000 g. Inserts were amplified by PCR using a primer O. longinoda were used. PCR amplifications were carried
pair for the multicloning site pUC19 (Bca BEST TM Sequenc- out in a total volume of 15 µL, which contained c. 10 ng
ing Primer RV-M and M13-47, TaKaRa) with TaKaRa Taq of template DNA, 3 pmol of each primer [forward was
(TaKaRa) according to the manufacturer’s instructions. labelled with 6-FAM, PET, VIC or NED fluorescent dyes
Temperature cycles were as follows: 30 cycles of 1 min at (Applied Biosystems)], 1.5 µL of 10 × reaction buffer,
95 °C, 1 min at 55 °C and 2 min at 70 °C. After PCR, 1 µL of 1.5 µL of dNTP mix (1 mm of each dNTP), and 0.6 U of Taq
each amplified product was used to detect clones contain- DNA polymerase (AmpliTaq Gold, Applied Biosystems),
ing the microsatellite sequences in the same manner as by thermal cycling parameters of 5 min at 95 °C for hot
the first screening. It was seen that 20 of 550 clones were start, 30 cycles of 45 s at 92 °C, 45 s at 48 or 52 °C (according
positive. For each positive clone, 4 µL of the remaining to the annealing temperature for each primer set, see Ta
PCR product was verified for its length on 1% agarose in Table 1) and 1 min at 72 °C. The PCR products were
gel in Tris-borate-EDTA, and 18 unique insert lengths electrophoresed along with GeneScan 500 LIZ size standard
were found (350–1800 bp). The remaining product of each on Genetic Analyser 3100 (Applied Biosystems), and allele
positive clone was purified using a QIAamp PCR purifica- sizes were assigned using GeneScan analysis software
tion kit (Qiagen) and sequenced using the automated (Applied Biosystems). We found 13 polymorphic loci with
sequencer, Genetic Analyser 3100 (Applied Biosystems). two to 14 alleles in O. smaragdina (expected heterozygosity,

© 2004 Blackwell Publishing Ltd, Molecular Ecology Notes, 4, 608–610


610 P R I M E R N O T E

HE from 0.10 to 0.89), and six heterozygous loci in O. longi- Fraser VS, Crozier RH (1999) The mating structure of Oeco-
noda (Table 1). Although observed HE was remarkably phylla smaragdina ants. In: Proceeding of the XIII International
lower than that in O. smaragdina at some loci, apparently Congress of IUSSI, p. 172. Flinders University Press, Adelaide,
Australia.
due to fragmentated population structure of this species,
Hillis DM, Larson A, Davis SK, Zimmer E (1990) Nucleic acids III:
we totally concluded that these microsatellite markers sequencing. In: Molecular Systematics (eds Hillis DM, Moritz C).
would be useful in genetic analysis on both species at Sinauer Associates, Sunderland, MA.
colony and population levels. Hölldobler B, Wilson EO (1990) The Ants. Harvard University
Press, Cambridge, MA.
Navarro E, Jaffre T, Gauthier D et al. (1999) Distribution
Acknowledgements of Gymnostoma spp. microsymbiotic Frankia strains in New
We express our sincere thanks to Professor K. Ogata, Kyushu Uni- Caledonia is related to soil type and to host-plant species.
versity, Dr A. N. Andersen, CSIRO Tropical Ecosystems Research Molecular Ecology, 8, 1781–1788.
Centre, Australia, Dr K. Tsuji, University of Ryukyus, and Dr Sih Peng PK, Christian K, Gibb K (1998) Locating queen ant nests in
Kahono, The Indonesian Institute of Science, for providing samples. the green ant, Oecophylla smaragdina (Hymenoptera, Formicidae).
Insectes sociaoux, 45, 477–480.
Wheeler WM (1922) Ants of the American Museum Congo
References Expedition. A contribution to the Myrmecology of Africa.
Bolton B (1995) A New General Catalogue of the Ants of the World. Bulletin of the American Museum of Natural History, 45, 224–
Harvard University Press, London. 236.

© 2004 Blackwell Publishing Ltd, Molecular Ecology Notes, 4, 608– 610