New Antibiotic Targets PDF

New Antibiotic Targets

M E T H O D S I N M O L E C U L A R M E D I C I N ETM
John M. Walker, SERIES EDITOR

142. New Antibiotic Targets, edited by W. Scott 120. Breast Cancer Research Protocols, edited by
Champney, 2008 Susan A. Brooks and Adrian Harris, 2006
141. Clinical Bioinformatics, edited by Ronald 119. Human Papillomaviruses: Methods and Protocols,
J. A. Trent, 2008 edited by Clare Davy and John Doorbar, 2005
140. Tissue Engineering, edited by Hansjörg Hauser 118. Antifungal Agents: Methods and Protocols, edited
and Martin Fussenegger, 2008 by Erika J. Ernst and P. David Rogers, 2005
139. Vascular Biology Protocols, edited by Nair 117. Fibrosis Research: Methods and Protocols, edited
Sreejayan and Jun Ren, 2007 by John Varga, David A. Brenner, and Sem H.
138. Allergy Methods and Protocols, edited by Phan, 2005
Meinir G. Jones and Penny Lympany, 2007 116. Inteferon Methods and Protocols, edited by
137. Microtubule Protocols, edited by Jun Zhou, 2007 Daniel J. J. Carr, 2005
136. Arthritis Research: Methods and Protocols, 115. Lymphoma: Methods and Protocols, edited by
Vol. 2, edited by Andrew P. Cope, 2007 Timothy Illidge and Peter W. M. Johnson, 2005
135. Arthritis Research: Methods and Protocols, 114. Microarrays in Clinical Diagnostics, edited by
Vol. 1, edited by Andrew P. Cope, 2007 Thomas O. Joos and Paolo Fortina, 2005
134. Bone Marrow and Stem Cell Transplantation, 113. Multiple Myeloma: Methods and Protocols, edited
edited by Meral Beksac, 2007 by Ross D. Brown and P. Joy Ho, 2005
133. Cancer Radiotherapy, edited by Robert A. 112. Molecular Cardiology: Methods and Protocols,
Huddart and Vedang Murthy, 2007 edited by Zhongjie Sun, 2005
132. Single Cell Diagnostics: Methods and Protocols, 111. Chemosensitivity: Volume 2, In Vivo Models,
edited by Alan Thornhill, 2007 Imaging, and Molecular Regulators, edited by
131. Adenovirus Methods and Protocols, Second Rosalyn D. Blumethal, 2005
Edition, Vol. 2: Ad Proteins, RNA, Lifecycle, Host 110. Chemosensitivity: Volume 1, In Vitro Assays,
Interactions, and Phylogenetics, edited by William edited by Rosalyn D. Blumethal, 2005
S. M. Wold and Ann E. Tollefson, 2007 109. Adoptive Immunotherapy: Methods and
130. Adenovirus Methods and Protocols, Second Protocols, edited by Burkhard Ludewig and
Edition, Vol. 1: Adenoviruses, Ad Vectors, Matthias W. Hoffman, 2005
Quantitation, and Animal Models, edited by 108. Hypertension: Methods and Protocols, edited by
William S. M. Wold and Ann E. Tollefson, 2007 Jérôme P. Fennell and Andrew H. Baker, 2005
129. Cardiovascular Disease: Methods and Protocols, 107. Human Cell Culture Protocols, Second Edition,
Volume 2: Molecular Medicine, edited by Qing K. edited by Joanna Picot, 2005
Wang, 2006 106. Antisense Therapeutics, Second Edition, edited by
128. Cardiovascular Disease: Methods and Protocols, M. Ian Phillips, 2005
Volume 1: Genetics, edited by Qing K. Wang, 2006 105. Developmental Hematopoiesis: Methods and
127. DNA Vaccines: Methods and Protocols, Protocols, edited by Margaret H. Baron, 2005
Second Edition, edited by Mark W. Saltzman, Hong 104. Stroke Genomics: Methods and Reviews, edited by
Shen, and Janet L. Brandsma, 2006 Simon J. Read and David Virley, 2004
126. Congenital Heart Disease: Molecular Diagnostics, 103. Pancreatic Cancer: Methods and Protocols, edited
edited by Mary Kearns-Jonker, 2006 by Gloria H. Su, 2004
125. Myeloid Leukemia: Methods and Protocols, edited 102. Autoimmunity: Methods and Protocols, edited by
by Harry Iland, Mark Hertzberg, and Paula Andras Perl, 2004
Marlton, 2006 101. Cartilage and Osteoarthritis: Volume 2, Structure
124. Magnetic Resonance Imaging: Methods and and In Vivo Analysis, edited by Frédéric De
Biologic Applications, edited by Pottumarthi Ceuninck, Massimo Sabatini, and Philippe
V. Prasad, 2006 Pastoureau, 2004
123. Marijuana and Cannabinoid Research: Methods 100. Cartilage and Osteoarthritis: Volume 1, Cellular
and Protocols, edited by Emmanuel S. Onaivi, 2006 and Molecular Tools, edited by Massimo Sabatini,
122. Placenta Research Methods and Protocols: Philippe Pastoureau, and Frédéric De Ceuninck,
Volume 2, edited by Michael J. Soares and 2004
Joan S. Hunt, 2006 99. Pain Research: Methods and Protocols, edited by
121. Placenta Research Methods and Protocols: David Z. Luo, 2004
Volume 1, edited by Michael J. Soares and Joan S. 98. Tumor Necrosis Factor: Methods and Protocols,
Hunt, 2006 edited by Angelo Corti and Pietro Ghezzi, 2004
M E T H O D S I N M O L E C U L A R M E D I C I N ET M
New Antibiotic Targets
Edited by
W. Scott Champney
Department of Biochemistry and Molecular Biology,
East Tennessee State University,
Johnson, Tennessee
© 2008 Humana Press Inc.
999 Riverview Drive, Suite 208
Totowa, New Jersey 07512
www.humanapress.com
All rights reserved.
No part of this book may be reproduced, stored in a retrieval system, or transmitted in any form or by any means,
electronic, mechanical, photocopying, microfilming, recording, or otherwise without written permission from the Publisher.
Methods in Molecular MedicineTM is a trademark of The Humana Press Inc.
All papers, comments, opinions, conclusions, or recommendations are those of the author(s), and do not necessarily reflect
the views of the publisher.
This publication is printed on acid-free paper.

ANSI Z39.48-1984 (American Standards Institute) Permanence of Paper for Printed Library Materials.
Production Editor: Christina M. Thomas

Cover design by: W. Scott Champney
Cover illustration: The cover shows the chemical structures of a number of antibiotics currently used against some of the
targets described in this book.
Photocopy Authorization Policy:

Authorization to photocopy items for internal or personal use, or the internal or personal use of specific clients, is granted
by Humana Press Inc., provided that the base fee of US $30 per copy is paid directly to the Copyright Clearance Center at
222 Rosewood Drive, Danvers, MA 01923. For those organizations that have been granted a photocopy license from the
CCC, a separate system of payment has been arranged and is acceptable to Humana Press Inc. The fee code for users of
the Transactional Reporting Service is: [978-1-58829-915-4/08 $30 ].
Printed in the United States of America. 10 9 8 7 6 5 4 3 2 1
Library of Congress Cataloging in Publication Data: 2007933473

Preface
A crisis is developing in the treatment of infectious diseases. Resistance of

microorganisms to currently prescribed antibiotics is increasing at a steady rate,
and fewer and fewer antimicrobial agents are available to treat these infec-
tions. Organisms displaying a multiple drug resistance phenotype are becoming
common in both nosocomial and community-acquired infections. In some
instances, there remains only a single antibiotic therapy suitable for treating
the infection.
This situation has stimulated several avenues of research in an effort
to identify new drugs and new drug targets. Advances in combinatorial
chemistry and high-throughput drug screening have provided a large number
of compounds to be tested as new antimicrobial agents. The examination of
microbial genome sequences has provided lists of potential new targets for such
agents. This book is an attempt to bring these two areas together in the form
of specific techniques that can be used to examine new drug targets and the
effectiveness of new antibiotics.
The major areas of vulnerability in microbial cells include cell wall and
membrane synthesis and the processes of DNA replication, RNA transcription,
and protein synthesis. Many of the currently used antibiotics have a specific
inhibitory effect on one of these activities. Both new antimicrobial agents
and modifications of existing drugs are being tested for improved antibac-
terial activity against these targets. In addition, a number of novel cellular
targets are being examined as potential drug sites. These include the process
of fatty acid biosynthesis, the activity of certain aminoacyl tRNA synthetases,
the function of peptide deformylase, and the process of ribosomal subunit
formation. Inhibitors of efflux pumps that lower cellular drug levels are also
currently being sought. Additional potential drug targets include the inacti-
vation of enzymes that modify antibiotics and the inhibition of enzymes that
alter cellular antibiotic targets leading to resistance.
Chapter 1 is a description of biocomputational methods for examining
microbial genome sequences for novel inhibitory targets. Chapters 2 and 3
describe methodologies for examining inhibitors of DNA replication that affect
topoisomerases (Chapter 2) and DNA polymerase III (Chapter 3). New assays
for inhibitors of the bacterial RNA polymerase are discussed in Chapter 4.
v
vi Preface
Protein biosynthesis has been a major target for many different antimicrobial
agents. Methods to target the aminoacyl tRNA synthetases are presented in
Chapter 5. Chapters 6 and 7 present methods to examine inhibitors of bacterial
ribosome biogenesis, a newly described target for antibiotics. Chapters 8
and 9 describe specific assays for inhibitors of ribosomal functions in trans-
lation including initiation (Chapter 8) and peptidyltransferase (Chapter 9). An
additional promising new target is peptide deformylase; assays for inhibitors
of its function are given in Chapter 10.
The bacterial cell wall and membrane remain attractive targets for antibiotics.
Chapter 11 discusses assays for penicillin-binding proteins of the cell wall,
and Chapter 12 presents methods to assay inhibitors of lipopolysaccharide
biosynthesis, an exciting new target. Membrane structure and function are the
topics of Chapters 13 and 14, including measures of cationic antimicrobial
peptide function (Chapter 13) and assays for changes in permeability using
flow cytometry (Chapter 14). Chapter 15 describes several assays for detecting
inhibitors of the ubiquitous efflux pumps in bacterial membranes.
Two novel targets are described in Chapters 16 and 17. Inhibition of fatty
acid synthesis (Chapter 16) is a promising new target, as are compounds
that affect the important two-component signal transduction pathways in cells
(Chapter 17).
The remaining chapters describe assays for measuring target modification
by ribosomal methyltransferases (Chapter 18), a discussion of inhibitors of
-lactamase activity (Chapter 19), and assays for aminoglycoside-modifying
enzymes (Chapter 20).
The chapters in the book describe in detail specific methods that can be
used to identify and assay these targets. As additional new compounds are
identified and new targets in different microorganisms are found, these methods
will aid in testing the antibacterial potential of these products. It is anticipated
that this book will be primarily useful to laboratory investigators in academic,
pharmaceutical, and medical institutions.
W. Scott Champney
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
1 Biocomputational Strategies for Microbial Drug Target Identification

Kishore R. Sakharkar, Meena K. Sakharkar,
and Vincent T. K. Chow . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
2 Methods to Assay Inhibitors of DNA Gyrase and Topoisomerase
IV Activities
L. Mark Fisher and Xiao-Su Pan . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
3 A Method to Assay Inhibitors of DNA Polymerase IIIC Activity
Michelle M. Butler and George E. Wright . . . . . . . . . . . . . . . . . . . . . . . . . 25
4 Methods to Identify and Characterize Inhibitors of Bacterial RNA
Polymerase
A. Simon Lynch and Qun Du . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
5 Methods to Assay Inhibitors of tRNA Synthetase Activity
Dieter Beyer, Hein Peter Kroll, and Heike Brötz-Oesterhelt . . . . . . . 53
6 Three Methods to Assay Inhibitors of Ribosomal Subunit Assembly
W. Scott Champney . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
7 Inhibition of Chaperone-Dependent Bacterial Ribosome Biogenesis
Abdalla Al Refaii and Jean-Hervé Alix . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
8 Assays for the Identification of Inhibitors Targeting Specific
Translational Steps
Letizia Brandi, John Dresios, and Claudio O. Gualerzi . . . . . . . . . . . . . 87
9 SPARK: A New Peptidyl Transferase Activity Assay
Alexander S. Mankin and Norbert Polacek . . . . . . . . . . . . . . . . . . . . . . . . 107
10 High-Throughput Screening of Peptide Deformylase Inhibitors
Kiet T. Nguyen and Dehua Pei . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117
11 A Method to Assay Penicillin-Binding Proteins
Michael J. Pucci and Thomas J. Dougherty . . . . . . . . . . . . . . . . . . . . . . . . 131
12 A Method to Assay Inhibitors of Lipopolysaccharide Synthesis
Marcy Hernick and Carol A. Fierke . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 143
vii
viii Contents
13 Methods for Assessing the Structure and Function of Cationic

Antimicrobial Peptides
Michelle Pate and Jack Blazyk . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 155
14 Flow Cytometry of Bacterial Membrane Potential and Permeability
Howard M. Shapiro . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175
15 Bacterial Efflux Pump Inhibitors
Barbara J. Kamicker, Michael T. Sweeney, Frank Kaczmarek,
Fadia Dib-Hajj, Wenchi Shang, Kim Crimin, Joan Duignan,
and Thomas D. Gootz . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
16 Mycobacterium tuberculosis -Ketoacyl Acyl Carrier Protein
Synthase III (mtFabH) Assay: Principles and Method
Sarbjot Sachdeva and Kevin A. Reynolds . . . . . . . . . . . . . . . . . . . . . . . . . . 205
17 Screening for Compounds That Affect the Interaction Between
Bacterial Two-Component Single Transduction Response
Regulator Protein and Cognate Promoter DNA
Matthew G. Erickson, Andrew T. Ulijasz, and Bernard Weisblum . . 215
18 The Activity of rRNA Resistance Methyltransferases Assessed
by MALDI Mass Spectrometry
Stephen Douthwaite, Rikke Lind Jensen, and Finn Kirpekar . . . . . . . . 223
19 Assays for -Lactamase Activity and Inhibition
Thammaiah Viswanatha, Laura Marrone, Valerie Goodfellow,
and Gary I. Dmitrienko . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 239
20 Studies of Enzymes That Cause Resistance to Aminoglycoside
Antibiotics
Engin H. Serpersu, Can Özen, and Edward Wright . . . . . . . . . . . . . . . . 261
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 273
Contributors
Jean-Hervé Alix • Institute de Biologie Physico-Chimique, UPR 9073 du CNRS,

University Paris 7 – Denis Diderot, Paris, France
Abdulla Al Refaii • Institute de Biologie Physico-Chimique, UPR 9073 du CNRS,
University Paris 7 – Denis Diderot, Paris, France
Dieter Beyer • Bayer HealthCare AG, Wuppertal, Germany
Jack Blazyk • Department of Biomedical Sciences, Ohio University College of Osteo-
pathic Medicine, Athens, OH
Letizia Brandi • Department of Biology MCA, University of Camerino, Camerino
(MC), Italy
Heike Brötz-Oesterhelt • AiCuris GmbH & Co. KG, Wuppertal, Germany
Michelle M. Butler • Microbiotix Inc., Worcester, MA
W. Scott Champney • Department of Biochemistry and Molecular Biology, East
Tennessee State University, Johnson City, TN
Vincent T. K. Chow • Human Genome Laboratory, Department of Microbiology,
Yong Loo Lin School of Medicine, National University of Singapore, Singapore
Kim Crimin • Pfizer Global R & D, MS, Groton, CT
Fadia Dib-Hajj • Pfizer Global R & D, MS, Eastern Point Road, Groton, CT
Gary I. Dmitrienko • Department of Chemistry, University of Waterloo, W. Waterloo,
Ontario, Canada
John Dresios • Department of Neurobiology, Scripps Research Institute, La Jolla, CA
Thomas J. Dougherty • Pfizer Global Research and Development, Pfizer, Inc.,
Groton, CT
Stephen Douthwaite • Department of Biochemistry and Molecular Biology, University
of Southern Denmark, Campusvej, Denmark
Qun Du • Cumbre Pharmaceuticals Inc., Dallas, TX
Joan Duignan • Pfizer Global R & D, MS, Groton, CT
Matthew G. Erickson • Department of Pharmacology, University of Wisconsin Medical
School, Madison, WI
Carol A. Fierke • Department of Chemistry, University of Michigan, Ann Arbor, MI
L. Mark Fisher • Director, Molecular and Metabolic Signalling Centre, Division
of Basic Medical Sciences, St George’s, University of London, Cranmer Terrace,
London, UK
Valerie Goodfellow • Department of Chemistry, University of Waterloo, W., Waterloo,
Ontario, Canada
Thomas D. Gootz • Pfizer Global R & D, MS, Groton, CT
ix
x Contributors
Claudio O. Gualerzi • Department of Biology MCA, University of Camerino, Camerino

(MC), Italy
Marcy Hernick • Department of Biochemistry, Virginia Tech, Blacksburg, VA
Rikke Lind Jensen • Department of Biochemistry and Molecular Biology, University
of Southern Denmark, Campusvej, Denmark
Barbara J. Kamicker • Pfizer Global R & D, MS, Groton, CT
Frank Kaczmarek • Pfizer Global R & D, MS, Groton, CT
Finn Kirpekar • Department of Biochemistry and Molecular Biology, University of
Southern Denmark, Campusvej, Denmark
Hein Peter Kroll • Bayer HealthCare AG, Wuppertal, Germany
A. Simon Lynch • Cumbre Pharmaceuticals Inc., Dallas, TX
Alexander S. Mankin • Center for Pharmaceutical Biotechnology, University of
Illinois, Chicago, IL
Laura Marrone • Department of Chemistry, University of Waterloo, W., Waterloo,
Ontario, Canada
Kiet T. Nguyen • Wadsworth Center, New York State Department of Health, CMS,
Albany, NY
Can Özen • Graduate School of Genome Science and Technology, University of
Tennessee, Knoxville, TN
Michelle Pate • Department of Biomedical Sciences, Ohio University College of
Osteopathic Medicine, Athens, OH
Xiao-Su Pan • Department of Basic Medical Sciences, St George’s, University of
London, Cranmer Terrace, London, UK
Dehua Pei • Department of Chemistry and Ohio State Biochemistry Program, The
Ohio State University, Columbus, OH
Norbert Polacek • Innsbruck Biocenter, Division of Genomics and RNomics, Innsbruck
Medical University, Innsbruck, Austria
Michael J. Pucci • Achillion Pharmaceuticals, New Haven, CT
Kevin A. Reynolds • Portland State University, Portland, OR
Sarbjot Sachdeva • Portland State University, Portland, OR
Kishore R. Sakharkar • Human Genome Laboratory, Department of Microbiology,
Yong Loo Lin School of Medicine, National University of Singapore, Singapore
Meena K. Sakharkar • Nanyang Centre for Supercomputing and Visualization,
Nanyang Technological University, Singapore
Engin H. Serpersu • Department of Biochemistry, Cellular and Molecular Biology,
University of Tennessee, Knoxville, TN
Howard M. Shapiro • The Center for Microbial Cytometry and Howard M. Shapiro,
M.D., P.C., West Newton, MA
Wenchi Shang • Pfizer Global R & D, MS, Eastern Point Road, Groton, CT
Michael T. Sweeney • Pfizer Global R & D, MS, Eastern Point Road Groton, CT
Andrew T. Ulijasz • Department of Pharmacology, University of Wisconsin Medical
School, Madison, WI
Contributors xi
Thammaiah Viswanatha • Department of Chemistry, University of Waterloo, W.,

Waterloo, Ontario, Canada
Bernard Weisblum • Department of Pharmacology, University of Wisconsin Medical
School, Madison, WI
Edward Wright • Department of Biochemistry, Cellular and Molecular Biology,
University of Tennessee, Knoxville, TN
George E. Wright • GL Synthesis Inc., Worcester, MA
1
Biocomputational Strategies for Microbial Drug Target

Identification
Kishore R. Sakharkar, Meena K. Sakharkar, and Vincent T. K. Chow
Summary
The complete genome sequences of about 300 bacteria (mostly pathogenic) have been deter-
mined, and many more such projects are currently in progress. The detection of bacterial genes
that are non-homologous to human genes and are essential for the survival of the pathogen
represent a promising means of identifying novel drug targets. We present a subtractive genomics
approach for the identification of putative drug targets in microbial genomes and demonstrate
its execution using Pseudomonas aeruginosa as an example. The resultant analyses are in good
agreement with the results of systematic gene deletion experiments. This strategy enables rapid
potential drug target identification, thereby greatly facilitating the search for new antibiotics. It
should be recognized that there are limitations to this computational approach for drug target
identification. Distant gene relationships may be missed since the alignment scores are likely
to have low statistical significance. In conclusion, the results of such a strategy underscore
the utility of large genomic databases for in silico systematic drug target identification in the
post-genomic era.
Key Words: bacterial pathogens; comparative microbial genomics; essential genes; drug
targets; antibiotics.
1. Introduction
“Antibiotic” consists of the root words “anti,” meaning “opposed to” or
“preventing,” and “biotic,” which is derived from the Greek word for life. In
nature, various microbes and fungi secrete these compounds to gain an advantage
in their microenvironment, and antibiotics are commonly isolated from such
organisms. Between 1940 and 1960, the search for antibacterial agents relied
From: Methods in Molecular Medicine, Vol. 142: New Antibiotic Targets

Edited by: W. Scott Champney © Humana Press Inc., Totowa, NJ
1
2 K. R. Sakharkar et al.
primarily on antibacterial activity, specifically growth inhibition of a desired

spectrum of bacteria but not eukaryotic cells using in vitro laboratory assays. The
molecular target was often identified only after the compound had reached the
market. This was the “golden age of antibiotics,” during which the precursors
of almost all the antibiotics that are in clinical application today were generated.
Because antibiotics are such important medical compounds, the mechanisms
by which antibiotics inhibit or kill bacteria have been under scrutiny for decades,
with such studies being instrumental in the design of novel and improved
compounds. The general modes of antibiotic activity are as follows:
1. Interference with the cell wall. Among the most well-known of antibiotics that
interfere with peptidoglycan synthesis are the -lactams, exemplified by penicillin.
2. Interference with nucleic acid synthesis. For example, the sulfonamides (commonly
known as sulfa drugs) mimic one of the folate precursors, competing with the
precursor for the enzyme involved in the next step of folate synthesis, thereby
hindering nucleic acid synthesis. Folate is an enzyme required for the synthesis of
amino acids and nucleic acids. Other drugs that prevent nucleic acid synthesis are
quinolones, which target bacterial DNA gyrase. Another class of drugs known as
rifamycins specifically inhibits RNA synthesis by binding to RNA polymerase.
3. Interference with protein synthesis. These antibiotics inhibit the translational activity
of the ribosome at various steps of protein synthesis. For example, puromycin
is a non-selective inhibitor of protein synthesis that mimics tRNA. In addition,
streptomycin causes the incorporation of incorrect amino acids at the “A” site of
the growing polypeptide, whereas tetracyclines completely block protein translation
by binding to a ribosomal subunit.
However, the widespread emergence of antibiotic resistance is of growing

concern as an impediment in the therapy of bacterial diseases. In some instances,
physicians are left with few or no antibiotics for the treatment of infections
(e.g., Staphylococcus aureus), and such problems are likely to increase in
magnitude. Clearly, a strategy of circumventing the threat of antibiotic resis-
tance is to develop new drugs with novel targets and mechanisms of action.
In the past decade, the tremendous progress in genome sequencing and
analysis has complemented classical empirical approaches and has had a
major impact on all biological sciences, including antibacterial research. Since
the genome of Haemophilus influenzae was deciphered in 1995, many other
bacterial genomes have been sequenced in rapid succession. These data pose
a major challenge in the post-genomic era, i.e., to fully exploit this treasure
trove for the identification and characterization of virulence factors in these
pathogens, and to identify novel putative targets for therapeutic intervention
(1). A critical advantage of this post-genomic analysis is the possibility of
Biocomputational Strategies for Microbial Drug Target Identification 3
specifically identifying a target that is present in many or at least several

bacterial genomes and/or one that may be susceptible to a “magic bullet” against
a particular group of pathogens. Such bacterial genome analyses have revealed
a variety of hitherto unexploited targets, with the potential for developing potent
and selective antibiotics against a broad spectrum of bacterial pathogens.
The target identification stage is the first step in the drug discovery process
(Fig. 1) and as such can provide the foundation for years of dedicated research
in the pharmaceutical industry. As with all the other steps in drug discovery,
this stage is complicated by the fact that the identified drug target must satisfy
a range of criteria to permit progression to the next stage. The possibilities
of selecting targets through genomics-related methodologies are increasing,
and several methodologies are currently available. An interesting approach
designated “differential genome display” has been proposed for the prediction
of potential drug targets (2,3). This approach relies on the fact that genomes of
parasitic microorganisms are generally much smaller and encode fewer proteins
than the genomes of free-living organisms. The genes that are present in the
genome of a parasitic bacterium but absent in the genome of a closely related
free-living bacterium are therefore likely to be important for pathogenicity
and may be considered candidate drug targets. A complementary approach
to target identification by bioinformatics has been reported in a concordance
analysis of microbial genomes (4). A simple and efficient computational tool
was developed (4) that can determine concordances of putative gene products
showing sets of proteins conserved across one set of user-specified genomes
but that are not present in another set of user-specified genomes (5). Recently,
the use of fusion genes as putative microbial drug targets in Helicobacter pylori
was suggested (6). Galperin and Koonin (7) proposed searching for drug targets
Fig. 1. Drug discovery pipeline.

among previously characterized proteins that are specific and essential for a
particular pathogen. Genes that are conserved in different genomes often turn
out to be essential (8–11). A gene is considered to be essential if the cell
cannot tolerate its inactivation by mutation, and its status is confirmed using
conditional lethal mutants.
Genomics can be applied to evaluate the suitability of potential targets
using two criteria, i.e., “essentiality” and “selectivity” (4). The target must
be essential for the growth, replication, viability, or survival of the microor-
ganism, i.e., encoded by genes critical for pathogenic life stages. In order to
address cytotoxicity issues, the microbial target for therapy should not have
any well-conserved homolog in the host. This can help to avoid expensive dead
ends when a lead target is identified and investigated in great detail only to
discover at a later stage that all its inhibitors are invariably toxic to the host.
Concurrently, the recent availability of the human genome sequence represents
a major advance in drug discovery (12,13). Since this approach merely short-
lists the putative microbial targets, the subsequent step would be to validate
the prioritized targets, e.g., by constructing knockouts or by using chemical
validation to verify their essentiality.
Mutagenesis data are available for selected pathogenic microbial genomes
and can be used to ascertain the essentiality of putative targets. Recently,
Zhang et al. (14) compiled a list of all the currently available, experimen-
tally determined essential genes into the Database of Essential Genes (DEG),
Fig. 2. Criteria for selection of proteins as drug targets.

which includes the essential genes identified in the genomes of Escherichia

coli, Haemophilus influenzae, Mycoplasma genitalium, Pseudomonas aerug-
inosa, Staphylococcus aureus, Vibrio cholerae, and Saccharomyces cerevisiae.
The generation of a comprehensive gene list that is selective and essential
to the pathogen will facilitate an accelerated genetic dissection of traits such
as metabolic flexibility and inherent drug resistance in multiple pathogens
(Fig. 2). Such a strategy will enable us to locate critical pathways and steps in
pathogenesis; to target these steps by designing new drugs; and to inhibit the
infectious agent of interest with novel antimicrobial agents. Here we discuss a
novel in silico approach that provides a basis for addressing the “complexities
and conundrums” in drug discovery by computational methods.
2. Materials
1. Microbial genome data and human genome data in relevant databases.
2. Computing power to perform comparative genome analyses (e.g., networked high-
end machine with large storage capacity).
3. Basic bioinformatics programs such as CD-HIT and BLASTP installed in the host
machine.
3. Methods
1. Download the protein sequences for Homo sapiens and the bacterium of interest
from the National Center for Biotechnology Information Website ftp://ftp.ncbi.nlm.
nih.gov/genomes/ (15).
2. Download the Database of Essential Genes (DEG) from http://tubic.tju.edu.cn/
deg/ (15).
3. Download the CD-HIT program (16) from http://bioinformatics.ljcrf.edu/cd-hi.
4. Purge the bacterial genome file at 60% using CD-HIT to exclude paralogs from
bacterium for further analyses.
5. Subject the resultant file to BLASTP against the H. sapiens genome to identify
pathogen genes without homologs in humans (an expectation or E-value cutoff of
10−3 or lower is advisable). This will help to identify bacterial genes without human
homologs and ensure that the target is selective for the genome of interest.
6. The non-homologous entries are then subjected to BLASTP against the DEG
database for the identification of homologs to essential genes at a cutoff score
of 10−10 .
7. The genes with hits are then classified into different groups based on gene names
and metabolic pathways. Information on metabolic pathways can be obtained from
the KEGG database available at http://www.genome.jp/kegg/.
Using the completely sequenced Pseudomonas aeruginosa genome as an
example, the results demonstrate the unprecedented potential of the available
complementary data sets (Table 1) and the application of a subtractive genomics

approach (as explained above) for the identification of essential genes that
may be considered as candidates for antibacterial drug discovery (4,17). Not
surprisingly, many of the candidate genes code for the basic survival mecha-
nisms of the bacterium (Fig. 3). The list of potential drug targets encoded
in microbial genomes includes genes involved in translation, transcription,
DNA replication, repair, outer membrane proteins, permeases, enzymes of
intermediary metabolism, host-interaction factors, among many others. For
example, the fatty acid synthesis pathway appears to be attractive for drug
discovery given that a few known antibacterial compounds target enzymes
of this pathway. Our strategy identified 11 genes from this group (18,19).
Previous comparative analyses of complete genomes revealed that most of the
pathogens have drastically diminished biosynthetic capabilities compared to
their free-living relatives (20,21). Instead, these organisms depend on their hosts
to provide essential nutrients such as amino acids, nucleotides, and vitamins.
Thus, transport systems for these nutrients are generally well-conserved and
easily identifiable (22). Analysis of metabolic pathways allows one to predict
which substrates cannot be produced inside the cells and therefore need to be
transported. This renders bacterial transport proteins that do not have human
homologs as attractive drug targets (23). Our approach identified the category
of “transport of small molecules” as a major one for drug target identification
(9%). Protein translation, post-translational modification, and degradation were
next on the list. Thus, these methods represent an efficient means for enriching
potential target genes and for identifying those that are critical for normal cell
functions (see Section 4).
Table 1
Results of the Computational Analyses of Pseudomonas
aeruginosa Proteins
Description Proteins
Number of proteins 5567

Duplicates (>60% identical) 119
Non-paralogs 5448
Number of proteins without hits in Homo sapiens 3841
Number of proteins with matches in DEG 306
Fig. 3. Percentage distribution of 306 essential genes encoding different classes of

proteins in Pseudomonas aeruginosa.
4. Notes
It must be noted that this approach may not identify all the targets.
Nonetheless, since gene disruption data are not available for all the genes in all
the pathogens, this approach makes it possible to hazard a “first-order guess”
for the probability that any untested gene is essential and may be a probable
drug target.
References
1.
1 Miesel, L., Greene, J., and Black, T. A. (2003) Genetic strategies for antibacterial
drug discovery. Nat. Rev. Genet. 4, 442–456.
2.
2 Huynen, M. A., Diaz-Lazcoz, Y., and Bork, P. (1997) Differential genome display.
Trends Genet. 13, 389–390.
3.
3 Huynen, M., Dandekar, T., and Bork, P. (1998) Differential genome analysis
applied to the species-specific features of Helicobacter pylori. FEBS Lett. 426, 1–5.
4.
4 Sakharkar, K. R., Sakharkar, M. K., and Chow, V. T. (2004) A novel genomics
approach for the identification of drug targets in pathogens, with special reference
to Pseudomonas aeruginosa. In Silico Biol. 4, 355–360.
5.
5 Bruccoleri, R. E., Dougherty, T. J., and Davison, D. B. (1998) Concordance
analysis of microbial genomes. Nucleic Acids Res. 26, 4482–4486.
6.
6 Sakharkar K. R., Sakharkar M. K., and Chow, V. T. (2006) Gene fusion
in Helicobacter pylori: Making the ends meet. Antonie van Leeuwenhoek 89,
169–180.
7.
7 Galperin, M. Y., and Koonin, E. V. (1999) Searching for drug targets in microbial
genomes. Curr. Opin. Biotechnol. 10, 571–578.
8.
8 Itaya, M. (1995) An estimation of minimal genome size required for life. FEBS
Lett. 362, 257–260.
9.
9 Tatusov, R. L., Koonin, E. V., and Lipman, D. J. (1997) A genomic perspective
on protein families. Science 278, 631–637.
10.
10 Koonin, E. V., Tatusov, R. L., and Galperin, M. Y. (1998) Beyond complete
genomes: From sequence to structure and function. Curr. Opin. Struct. Biol. 8,
355–363.
11. Kobayashi, K., Ehrlich, S. D., Albertini, A., Amati, G., Andersen, K. K.,
11
Arnaud, M., et al. (2003) Essential Bacillus subtilis genes. Proc. Natl. Acad. Sci.
USA 100, 4678–4683.
12.
12 Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C., Zody, M. C., Baldwin, J.,
et al. (2001) Initial sequencing and analysis of the human genome. Nature 409,
860–921.
13.
13 Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R. J., Sutton, G. G.,
et al. (2001) The sequence of the human genome. Science 291, 1304–1351.
14.
14 Zhang, R., Ou, H. Y., and Zhang, C. T. (2004) DEG: A database of essential
genes. Nucleic Acids Res. 32, D271–D272.
15. Wheeler, D. L., Church, D. M., Edgar, R., Federhen, S., Helmberg, W.,
15
Madden, T. L., et al. (2004) Database resources of the National Center for Biotech-
nology Information: Update. Nucleic Acids Res. 32, D35–D40.
16.
16 Li, W., Jaroszewski, L., and Godzik, A. (2001) Clustering of highly homol-
ogous sequences to reduce the size of large protein databases. Bioinformatics 17,
282–283.
17.
17 Stover, C. K., Pham, X. Q., Erwin, A. L., Mizoguchi, S. D., Warrener, P.,
Hickey, M. J., et al. (2000) Complete genome sequence of Pseudomonas aerug-
inosa PA01, an opportunistic pathogen. Nature 406, 959–964.
18.
18 Payne, D. J., Warren, P. V., Holmes, D. J., Ji, Y., and Lonsdale, J. T. (2001)
Bacterial fatty-acid biosynthesis: A genomics-driven target for antibacterial drug
discovery. Drug Discov. Today 6, 537–544.
19.
19 Heath, R. J., White, S. W., and Rock, C. O. (2002) Inhibitors of fatty acid synthesis
as antimicrobial chemotherapeutics. Appl. Microbiol. Biotech. 58, 695–703.
20.
20 Fraser, C. M., Gocayne, J. D., White, O., Adams, M. D., Clayton, R. A.,
Fleischmann, R. D., et al. (1995) The minimal gene complement of Mycoplasma
genitalium. Science 270, 397–403.
21.
21 Lewis, K. (1999) Multidrug resistance: Versatile drug sensors of bacterial cells.
Curr. Biol. 9, R403–R407.
22.
22 Clayton, R. A., White, O., Ketchum, K. A., and Venter, J. C. (1997) The first
genome from the third domain of life. Nature 387, 459–462.
23.
23 Smith, R. S., Wolfgang, M. C., and Lory, S. (2004). An adenylate cyclase-
controlled signaling network regulates Pseudomonas aeruginosa virulence in a
mouse model of acute pneumonia. Infect. Immun. 72, 1677–1684.
2
Methods to Assay Inhibitors of DNA Gyrase

and Topoisomerase IV Activities
L. Mark Fisher and Xiao-Su Pan
Summary
DNA gyrase and DNA topoisomerase (topo) IV are the bacterial targets of coumarin and
quinolone antimicrobial agents. Widespread resistance to clinically important antibiotics such
as beta-lactams and macrolides has stimulated the development of novel gyrase and topo IV
inhibitors especially against Streptococcus pneumoniae and other Gram-positive pathogens. Here,
we describe how gyrase and topo IV activities are measured and how inhibitors of these enzymes
may be assayed, focusing as a paradigm on DNA supercoiling by S. pneumoniae gyrase, DNA
decatenation by S. pneumoniae topo IV, and DNA cleavage by both enzymes. These approaches
provide mechanistic insight on inhibitor action and allow identification of dual gyrase/topo IV
targeting agents that can minimize the emergence of bacterial resistance.
Key Words: DNA gyrase; DNA topoisomerase IV; DNA supercoiling; DNA decatenation;
cleavage complex; ciprofloxacin; agarose gel electrophoresis; Streptococcus pneumoniae.
1. Introduction
DNA gyrase and topo IV are important antimicrobial drug targets (1).
Gyrase catalyzes the ATP-dependent supercoiling of DNA (2). The enzyme
is present in all eubacteria but not in mammals and is unique among topoiso-
merases in promoting the negative supercoiling of DNA. Gyrase is essential
for bacterial viability with functions in DNA replication, transcription, and
recombination and in the regulation of chromosome supercoiling (1). First
discovered in Escherichia coli, and best characterized from this source, gyrase
has also been obtained in native or recombinant form from a variety of bacterial

11
12 L. M. Fisher and X.-S. Pan
species (3–5). Gyrase is a tetramer comprising two GyrA and two GyrB subunits
encoded by gyrA and gyrB genes, respectively. Its mechanism of DNA super-
coiling proceeds via the passage of one DNA segment (the “transported” or T
segment) through a transient double-stranded break in a second DNA helical
region (the “gate” or G segment) involving a covalent enzyme-DNA complex
called the “cleavage complex” (6–8). Strand passage is achieved through the
concerted opening and closure of protein–protein and protein–DNA gates. It is
believed that the T and G segments lie within a 120–150-bp region of DNA
wrapped on the enzyme such that the T segment is presented in the correct orien-
tation to generate negative supercoiling on strand passage (6–8). Gyrase shares
homology and mechanistic similarity with topo IV (9), a ParC2 ParE2 tetramer
that also acts via a double-stranded DNA break to facilitate ATP-dependent
chromosome decatenation and relaxation. Both enzymes change DNA linking
number in steps of two and are categorized as type II topoisomerases (6–8).
In addition to its biological and mechanistic interest, gyrase is the target
for coumarins, quinolones, and other novel classes of antimicrobials (10–13).
Coumarins, e.g., novobiocin, as well as the cyclothialidines and aminoben-
zimidazoles, inhibit DNA supercoiling by acting as competitive inhibitors
of the GyrB ATPase (10,11,13). By contrast, quinolones and their fluoro-
quinolone analogues such as ciprofloxacin inhibit gyrase activity by stabilizing
the cleavage complex involving the GyrA subunits (1,12). The traditional view
of gyrase as the primary quinolone target holds for Gram-negative bacteria such
as E. coli but not for Gram-positive species such as S. pneumoniae, wherein
the target can be gyrase or topo IV, or both, depending on the drug structure
(14,15); see also (13). Ongoing development of novel agents (13) and the recent
clinical introduction of new quinolones such as levofloxacin, moxifloxacin,
gatifloxacin, and gemifloxacin directed specifically against Gram-positive
pathogens (16) have identified the need to understand how inhibitors interfere
with gyrase and topo IV.
The assay for gyrase activity involves monitoring ATP-dependent super-
coiling of a relaxed circular plasmid DNA (3,4). The reaction products are
separated and displayed by agarose gel electrophoresis. Supercoiled DNA is
more compact than relaxed DNA and therefore migrates more rapidly through
the gel. Though almost any plasmid DNA could be employed as substrate, it is
now customary to use the small (4.3-kb) plasmid pBR322, thereby maximizing
the electrophoretic separation of relaxed and supercoiled DNA. Topo IV activity
is assayed by following its ATP-dependent decatenation of kinetoplast DNA
(kDNA) again using agarose gel electrophoresis. These are the assays of choice
in investigating the effects of catalytic inhibitors such as coumarins. By contrast,
Inhibition of DNA Gyrase and Topo IV 13
a DNA cleavage assay is used for quinolones and other topoisomerase II poisons
that act by stabilizing the topoisomerase cleavage complex on DNA resulting
in double-stranded DNA breaks. Given the recent recognition that either gyrase
or topo IV may be the potential target (14,15), it is now usual to test inhibitor
effects on both enzymes. The following sections describe the gyrase super-
coiling assay, the topoisomerase IV decatenation assay, and a DNA cleavage
assay applicable to both gyrase and topo IV.
2. Materials
2.1. DNA Supercoiling Assay
1. 3X Gyrase assay solution: 105 mM Tris-HCl, pH 7.5, 18 mM MgCl2 , 5.4 mM
spermidine, 72 mM KCl, 15 mM DTT, 1.08 mg/mL BSA, 19.5% glycerol (w/v),
and (optional) 90 μg/mL E. coli tRNA (Calbiochem).
2. Gyrase dilution buffer: 50 mM Tris-HCl, pH 7.5, 0.2 M KCl, 5 mM DTT, 1 mM
EDTA, 3 mg/mL BSA, 50% glycerol. (3X assay solution and dilution buffer can
be made up and stored in aliquots at –20 °C).
3. 50-mM ATP solution: 27.5 mg ATP (disodium salt) dissolved in 1 mL 100 mM
NaOH (see Note 1).
4. Relaxed pBR322 DNA (see Note 2).
5. 5X dye mix: 5% SDS, 25 % glycerol, 0.25 mg/ml bromophenol blue.
6. Agarose gel: 1% agarose in TBE (90 mM Tris base, 90 mM boric acid, 2.5 mM
EDTA).
7. 10 mg/mL ethidium bromide (EtBr) (see Note 3).
8. Gyrase preparation or the individual purified GyrA and GyrB subunits.
9. Prospective gyrase inhibitor and known control inhibitor.
10. Gel documentation system, e.g., Alpha Innotech digital camera and associated
software. Such instrumentation allows quantification of DNA bands and conse-
quently has largely superseded image capture on Polaroid film using a Land
camera and uv transilluminator.
2.2. Decatenation Assay for Topo IV

1. 4X Decatenation buffer: 160 mM Tris-HCl, pH 7.5, 24 mM MgCl2 , 40 mM DTT,
40 mM NaCl, 800 mM potassium glutamate, and 0.2 mg/mL BSA.
2. 1X Decatenation buffer.
3. 50 mM ATP.
4. Kinetoplast DNA: supplied by Topogen, Inc.
5. 5X Dye mix, as in previous section.
6. Topo IV or individual ParC and ParE subunits.
7. Agarose gel: 1% in TBE (90 mM Tris base, 90 mM boric acid, 2.5 mM EDTA).
8. 10 mg/mL EtBr (see Note 3).
9. Gel documentation system, as in previous section.
2.3. Drug-Promoted DNA Cleavage by Gyrase or Topo IV

1. 3X DNA gyrase buffer (or 4X topo IV buffer).
2. Supercoiled pBR322 supplied by New England Biolabs.
3. Linear pBR322 DNA.
4. Sodium dodecyl sulfate.
5. Proteinase K.
6. 5X Dye mix.
7. Gyrase (GyrA and GyrB subunits) or topo IV (ParC and ParE subunits).
8. Agarose gel: 1% in TBE.
9. 10 mg/mL EtBr (see Note 3).
10. Gel documentation system, as in previous section.
3. Methods
3.1. DNA Supercoiling Assay
This section describes how to measure and titrate the ATP-dependent DNA
supercoiling activity of gyrase prior to testing the effect of inhibitors on
the enzyme reaction. The assay uses relaxed pBR322 DNA as substrate and
in principle may employ gyrase activity present in bacterial extracts, native
enzyme purified from bacteria, or individual GyrA and GyrB proteins obtained
from bacterial extracts by affinity chromatography on novobiocin-Sepharose
(17). Crude extracts from bacteria should be avoided as they contain large
amounts of nucleases that lead to nicking of plasmid DNA and thereby abrogate
the assay. It is better to purify the enzyme by ammonium sulfate and Polymin
P fractionation, plus column chromatography, including tRNA when assaying
to suppress any nuclease activity. Highly purified DNA gyrases from E. coli
and Micrococcus luteus are available from John Innes Enterprises and from
Gibco BRL. Increasingly, recombinant His-tagged GyrA and GyrB proteins are
being prepared for a variety of bacterial species using E. coli strains bearing
the appropriate gyrA or gyrB genes cloned in inducible vectors such as pET
(3–5). Although construction of expression plasmids is time-consuming, it
has the advantage that the tagged GyrA and GyrB proteins can be recovered
in high purity (>95% homogeneity) from E. coli extracts in a single step
by nickel chelate chromatography (4,5). Neither subunit alone is active, but
gyrase activity can be reconstituted by mixing GyrA and GyrB. Each subunit
is assayed in the presence of an excess of the complementing protein so
that the specific activity of each subunit can be measured individually. This
approach, based on Ref. 4, is described using S. pneumoniae GyrA and GyrB
proteins.
1. Gyrase assays are performed in 35 mM Tris-HCl, pH 7.5, 24 mM KCl, 6 mM

MgCl2 , 1.8 mM spermidine, 0.36 mg/mL bovine serum albumin (BSA), 1.4 mM
ATP, 0.4 μg relaxed pBR322, and various dilutions of the gyrase activity to be
measured (final volume 35 μL). When using individually purified GyrA and GyrB
proteins, the subunit to be assayed is diluted into gyrase dilution buffer (see Note 4)
(on ice) and added to gyrase assay buffer on ice containing an excess (>10U) of
the complementing subunit.
2. Make up a cocktail on ice containing 11.7 μL 3X gyrase assay mix, 2 μL of relaxed
DNA (i.e., 0.4 μg), ATP, complementing subunit (where needed), and sterile water
to 33 μL. These quantities should be increased according to the number of assays
to be run. The final mix is distributed to 1.5-mL Eppendorf tubes on ice, and the
complementing gyrase subunit (2 μL) is added. To mix the reactants, gently tap
the tube or withdraw and eject the solution several times into the tip of a Gilson
pippetor. Transfer the tubes to a circulating water bath at 25 °C and incubate for 1 h.
3. Stop the reaction by adding 8 μL of 5X dye mix and separate the DNA products by
electrophoresis on a 1% agarose gel run overnight at 2 V/cm (see Note 5). The gel
should be stained in TBE containing 0.5 μg/mL EtBr for 30 min to 1 h, destained
for 1 h in TBE, and photographed under UV irradiation using a gel documentation
system, e.g., the Alpha Innotec digital camera and associated software.
4. One unit of gyrase activity is defined as the amount of enzyme that supercoils
50% of the relaxed pBR322 substrate under these reaction conditions.
5. Figure 1 shows an assay for gyrase activity wherein an appropriately diluted
S. pneumoniae GyrA subunit is assayed in the presence of excess GyrB, and vice
versa. The amount of GyrA and GyrB that converts 50% of the input DNA to the
supercoiled form is in each case 15 ng, corresponding to specific activities of 6.7
× 104 U/mg for both subunits (see Note 6). Similar conditions can be used to assay
gyrase subunits from other bacterial species.
6. Figure 2 illustrates the use of the assay to investigate the effects of ciprofloxacin
(see Note 7) on supercoiling activity. No more than 2 U of gyrase activity
are used per assay (sufficient to just supercoil all the input DNA) so that the
reaction is optimally sensitive to any inhibitory effects. For ciprofloxacin, the drug
concentration that inhibits DNA supercoiling by 50% (the IC50 ) is 40 μM (Fig. 2).
3.2. kDNA Decatenation Assay for Topoisomerase IV

Topo IV is conveniently assayed by its ability to decatenate kDNA, a
network of topologically linked DNA circles made up of several thousand 2-kb
minicircles and a few larger maxicircles (4). Reaction products are analyzed by
agarose gel electrophoresis, exploiting the fact that released minicircles migrate
into the gel, whereas the kDNA network is too large to move into the agarose
and is retained in the wells. kDNA from Crithidia fasciculata is available
commercially from Topogen. Topo IV from E. coli can be obtained from
1 2 3 4 5 6 7 8 9 10 11 12 13
N
R
Fig. 1. Reconstitution and titration of DNA supercoiling activity using

S. pneumoniae GyrA and GyrB subunits. Relaxed pBR322 substrate was mixed with
either 300 ng GyrB (lanes 2 to 7) or 100 ng GyrA (lanes 8 to 13). To titrate GyrA
activity, the reaction mix containing 1 mM ATP was incubated with 60, 30, 15, 7.5,
3.75, and 1.87 ng GyrA protein (lanes 2–7), respectively. Similarly, to assay GyrB,
120, 60, 30, 15, 7.5, and 3.75 ng GyrB was added to lanes 8 to 13, respectively.
After incubation, products were resolved by electrophoresis on a 1% agarose gel.
Lane 1, relaxed pBR322 control, which contains a small amount of nicked DNA. N, R,
and S denote the nicked, relaxed, and supercoiled pBR322, respectively. DNA bands
migrating between N and S are partially supercoiled DNA products.
1 2 3 4 5 6 7 8
N
R
Fig. 2. Inhibition of DNA supercoiling by ciprofloxacin. Relaxed pBR322 DNA

was incubated with S. pneumoniae gyrase (2U) in the absence (lane 3) or presence
of ciprofloxacin at 10, 20, 40, 80, and 160 μM (lanes 4 to 8). Increasing drug levels
lead to dose-dependent inhibition of DNA supercoiling. Lane 1, supercoiled pBR322
control; lane 2, relaxed pBR322 control.
John Innes Enterprises. Recombinant topo IV from a number of Gram-positive

pathogens has been reconstituted from subunits purified from overexpressing
parC and parE strains. Prior to inhibitor studies, it is necessary to titrate topo
IV activity to ascertain the correct amount of enzyme to use. Where individual
ParC and ParE subunits are available, each protein is assayed in the presence
of an excess of the other, allowing its specific activity to be assessed. Topo IV
subunits are combined accordingly for inhibitor studies.
1. Topo IV assays are carried out in a decatenation buffer [40 mM Tris-HCl, pH 7.5,
6 mM MgCl2 , 10 mM NaCl, 10 mM DTT, 50 μg/mL BSA, and 200 mM potassium
glutamate, to which are added 1 mM ATP, 450 ng of kDNA, and various amounts
of the topo IV, ParC, or ParE subunit (diluted into 1X decatenation buffer) (final
volume 20 μL)].
2. A cocktail is made up on ice using 4X topo IV assay mix, ATP, kDNA (2 μL,
i.e., 450 ng), ParE or ParC subunit (where appropriate), and sterile water to 18
μL. These quantities are multiplied according to the number of assays to be run.
The solution is distributed in 18-μL aliquots to 1.5-mL Eppendorf tubes on ice and
complementing the topo IV subunit added (2 μL). Reaction mixtures are incubated
in a circulating water bath at 37 °C for 1 h.
3. The reaction is terminated by addition of 5X dye mix (4 μL). DNA products are
separated by electrophoresis on a 1% agarose gel run at 2 V/cm overnight. After
staining with EtBr, the gel is photographed under UV light on a gel documentation
system (for details, see Sections 2.1 and 3.1).
4. One unit of topo IV activity can be defined as the amount of enzyme that decatenates
50% of the input kDNA under these reaction conditions.
5. Figure 3 shows a representative assay for decatenation activity in which various
amounts of an S. pneumoniae ParC and ParE are assayed in the presence of excess
complementing subunit (see Note 8). Under these conditions, 0.45 ng of ParC and
6.25 ng of ParE were sufficient to give 50% decatenation, corresponding to specific
decatenation activities of 2 × 106 U/mg and 1.5 × 105 U/mg, respectively.
6. Figure 4 demonstrates the inhibition of topo IV decatenation activity by
ciprofloxacin. The amount of topo IV is sufficient to just decatenate 0.45 μg of
kDNA. For ciprofloxacin, the IC50 (the amount of drug that gives 50% inhibition
of decatenation) is 10 μM (Fig. 4, lane 6).
3.3. DNA Cleavage Assays for Gyrase and Topo IV

Some topoisomerase inhibitors such as quinolones exert their bactericidal
effects by stabilizing the cleavage complex of gyrase or topo IV on DNA
(1,4,12). Cellular processes in vivo or protein denaturation in vitro can convert
the complex into a frank double-stranded DNA break that is thought to be the
lethal lesion. The assay for cleavage complex stabilization involves measuring
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
kDNA
monomer
Fig. 3. Titration of DNA decatenation activity of S. pneumoniae topo IV. Kinetoplast

DNA was incubated with ATP and either excess ParE (100 ng) and ParC at 30, 15,
7.5, 3.75, 1.8, 0.9, 0.45 ng, respectively (lanes 2–8), or excess ParC (30 ng) and ParE
at 100, 50, 25, 12.5, 6.25, 3.1, and 1.5 ng, respectively (lanes 9–15). Reactions were
stopped and products were resolved by electrophoresis in 1% agarose gel. Lane 1,
kDNA control. Bands with electrophoretic mobility between that of kDNA and released
minicircles (monomer) are partially decatenated DNA intermediates.
the ability of the inhibitor to promote linearization of pBR322 DNA mediated by

gyrase or by topo IV (4). Supercoiled pBR322 DNA is incubated with enzyme
in the presence or absence of inhibitor. The detergent sodium dodecyl sulfate
(SDS) is added to denature the cleavage complex and thereby release broken
1 2 3 4 5 6 7 8
kDNA
monomer
Fig. 4. Inhibition of S. pneumoniae topo IV decatenation activity by ciprofloxacin.

Kinetoplast DNA was incubated with S. pneumoniae topo IV (2U) in the presence of
ciprofloxacin at 0, 1, 2.5, 5, 10, 20, and 40 μM, respectively (lanes 2–8). Lane 1, kDNA
control.
DNA, and following proteinase K digestion (to remove GyrA or ParC subunit
linked to DNA), the DNA products are examined by agarose gel electrophoresis.
Trapping of the cleavage complex is revealed by the generation of linear
pBR322 DNA. It should be noted that detection of DNA cleavage requires
the use of stoichiometric amounts of DNA substrate and gyrase or topo IV,
i.e., typically 50–100 times more enzyme than employed in assays of catalytic
function. The following protocol has been developed for S. pneumoniae gyrase
and topo IV but is widely applicable to the enzymes from other bacteria.
1. DNA cleavage assays for gyrase are performed in the absence and presence of
inhibitor in 35 mM Tris-HCl, pH 7.5, 24 mM KCl, 6 mM MgCl2 , 1.8 mM
spermidine, 0.36 mg/mL bovine serum albumin (BSA), supercoiled pBR322, and
DNA gyrase (final volume 20 μL). Except for the higher enzyme levels, these condi-
tions are similar to those used in the gyrase supercoiling assay (see Sections 2.1 and
3.1), except ATP is omitted (see Note 9). Cleavage of supercoiled pBR322 by topo
IV is also observed under these gyrase conditions (allowing direct comparison) but
is more efficient using a buffer containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2 ,
10 mM NaCl, 10 mM DTT, 50 μg/mL BSA, and 200 mM potassium glutamate,
i.e., similar to the decatenation assay conditions.
2. Make a reaction mix on ice containing 6.7 μL 3X gyrase cleavage buffer or 5 μL of
4X topo IV cleavage buffer, supercoiled pBR322 DNA (0.4 μg), and sterile water
to 16 μL. A multiple of these quantities can be made up depending on the number
of assays to be run. The mix is distributed into 1.5-mL Eppendorf tubes on ice
containing various concentrations of the inhibitor (in 2 μL) to be assayed. Reaction
is initiated by adding 0.45 μg GyrA (or ParC) and 1.7 μg GyrB (or ParE) (in 2 μL)
that had been mixed and pre-incubated on ice for 10 min. After mixing, the tubes
are incubated in a circulating water bath at 25 °C for 1 h.
3. Induce DNA cleavage by adding 3 μL of 2% (w/v) SDS to each tube taken directly
from the water bath and vortex. Add 3 μL of 1 mg/mL proteinase K (see Note 10),
vortex, and incubate for 30 min at 37 °C.
4. Reactions are stopped by adding 7 μL of 5X dye mix, and the DNA products
are separated by electrophoresis in 1% agarose. The gel is stained with EtBr and
photographed as described in earlier sections.
5. Figure 5 shows a representative DNA cleavage experiment for gyrase and topo
IV. DNA cleavage can be quantified in terms of the CC25 , the drug concentration
that converts 25% of the input DNA to the linear form (see Notes 11 and 12).
The ciprofloxacin CC25 values for gyrase and topo IV are 80 μM and 5–10 μM,
respectively (see Note 13). Quinolone CC25 values (and indeed the IC50 values) are
elevated at least 8- to 16-fold for S. pneumoniae gyrase and topo IV complexes
reconstituted with GyrA and ParC subunits bearing quinolone resistance mutations
of Ser79Phe and Ser81Phe, respectively (18).
A B
12 3 4 5 6 7 8 1 2 3 4 5 6 7 8
N
L
S
Fig. 5. DNA cleavage induced by S. pneumoniae gyrase (A) and topo IV (B) in the
presence of ciprofloxacin. Supercoiled pBR322 was incubated (A) with gyrase (0.45 μg
GyrA and 1.7 μg GyrB) and ciprofloxacin at 0, 20, 40, 80, 160, and 320 μM (lanes 3–8,
respectively) or (B) topo IV (0.45 μg ParC and 1.7 μg ParE) and ciprofloxacin at 0, 2.5,
5, 10, 20, and 40 μM (lanes 3–8, respectively). DNA cleavage was induced with SDS,
and after proteinase K digestion, DNA products were displayed by 1% agarose gel
electrophoresis. Lane 1, supercoiled pBR322 control; lane 2, linear pBR322 control.
N, L, and S denote nicked, linear, and supercoiled pBR322, respectively.
4. Notes
1. ATP solutions should be stored as aliquots at –20 °C and discarded after use.
2. Relaxed pBR322 may be purchased from John Innes Enterprises. Alternatively,
it can be readily prepared by relaxation of supercoiled pBR322 (New England
Biolabs) using either human topoisomerase I (from Topogen) or the calf thymus
topo I from New England Biolabs according to the protocol detailed in Ref 19.
3. A note of caution: EtBr is a mutagen. Gloves should be worn when handling EtBr
solutions, and both should be disposed of using proper procedures.
4. Do not add more than 2 μL of gyrase diluent to the assay: It contains a high
concentration of salt and can inhibit the reaction.
5. For optimal separation of relaxed and supercoiled DNA, gels should be run slowly
overnight. EtBr should not be included in the agarose gel as it intercalates into
DNA, changing the mobility of relaxed DNA to that of supercoiled DNA.
6. Relaxed DNA prepared by treatment of supercoiled DNA with a eukaryotic topoi-
somerase I is made up of a Gaussian distribution of topoisomers bearing differing
linking numbers, which are resolved in the gel as a discrete ladder of bands (see
Fig. 1, lane 1). Preparations of supercoiled DNA normally contain a small amount
of nicked DNA. Any nuclease contamination in the gyrase preparation converts
the relaxed DNA ladder to nicked DNA that migrates as a single band and cannot
be supercoiled by gyrase.
7. Ciprofloxacin is a quinolone inhibitor of gyrase/topo IV. It exerts its inhibitory
action by interfering with DNA resealing in the cleavage complex.
8. Topo IV has both decatenation and DNA relaxation activities. Therefore, the
released minicircles migrate as relaxed DNA species.
9. Inclusion of ATP has no significant effect on the level of quinolone-induced DNA

cleavage mediated by the pneumococcal gyrase and topo IV. However, ATP does
enhance the efficiency of DNA cleavage by other type II topoisomerases, e.g.,
E. coli gyrase.
10. The solution of proteinase K in sterile water can be stored frozen as aliquots at –20
°C for several months.
11. Linear pBR322 DNA used as the control in Fig. 5 is made by digestion of
supercoiled pBR322 with the restriction enzyme EcoRI.
12. In the absence of quinolone, the DNA breakage-resealing equilibrium for gyrase
and topo IV is over to the side of sealed DNA, presumably as a safeguard against
inadvertent DNA breakage in vivo. Consequently, little or no linear DNA is
detectable for gyrase in the absence of quinolone (Fig. 5A, lane 3). However, for
topo IV, more cleavage complex appears to be present at equilibrium, and we
consistently observe that topo IV produces some linear DNA, albeit at a low level,
in the absence of drug (Fig. 5B, lane 3).
13. DNA cleavage is a stoichiometric reaction, i.e., the more enzyme that is added,
the greater the amount of cleavage at any given drug concentration. The levels of
gyrase/topo IV used in the assay have been chosen so that enzyme is in excess
of DNA substrate, producing a proper dose response as drug concentrations are
increased. Full-length linear pBR322 product arises from DNA cleavage by a single
enzyme cleavage complex per DNA molecule. At higher drug levels, multiple
enzyme complexes are trapped on each DNA molecule, generating substantial
DNA fragmentation, seen as a smear of DNA products below the linear band
(Fig. 5B, lanes 7 and 8).
Acknowledgments
X.-S. Pan and this work were supported by Project Grant BBD01882X1 from
the Biotechnology and Biological Sciences Council of the United Kingdom.
References
1.
1 Drlica, K., and Zhao, X. (1997) DNA gyrase, topoisomerase IV, and the 4-
quinolones. Microbiol. Mol. Biol. Rev. 61, 377–392.
2.
2 Gellert, M., Mizuuchi, K., O’Dea, M. H., and Nash, H. A. (1976) DNA gyrase:An
enzyme that introduces superhelical turns into DNA. Proc. Natl. Acad. Sci.USA
73, 3872–3876.
3.
3 Mizuuchi, K., Mizuuchi, M., O’Dea, M. H., and Gellert, M. (1984) Cloning and
simplified purification of Escherichia coli DNA gyrase A and B proteins. J. Biol.
Chem. 259, 9199–9201.
4.
4 Pan, X.-S., and Fisher, L. M. (1999) Streptococcus pneumoniae DNA gyrase
and topoisomerase IV: Overexpression, purification, and differential inhibition by
fluoroquinolones. Antimicrob. Agents Chemother. 43, 1129–1136.
5.
5 Aubry, A., Veziris, N., Cambau, E., Truffot-Pernot, C., Jarlier, V., and Fisher, L. M.
(2006) Novel gyrase mutations in quinolone-resistant and -hypersusceptible clinical
isolates of Mycobacterium tuberculosis: Functional analysis of mutant enzymes.
Antimicrob. Agents Chemother. 50, 104–112.
6.
6 Mizuuchi, M., Fisher, L. M., O’Dea, M. H., and Gellert, M. (1980) DNA gyrase
action involves the introduction of transient double strand breaks into DNA. Proc.
Natl. Acad. Sci. USA. 77, 1847–1851.
7.
7 Corbett, K. D., and Berger, J. M. (2004) Structure, molecular mechanisms, and
evolutionary relationships in DNA topoisomerases. Ann. Rev. Biophys. Biomol.
Struct. 33, 95–118.
8.
8 Corbett, K. D., Schoeffler A. J., Thomsen, N. D., and Berger, J. M. (2005) The
structural basis for substrate specificity in DNA topoisomerase IV. J. Mol. Biol.
351, 545–561.
9.
9 Kato, J., Nishimura, Y., Imamura, R., Niki, H., Higara, S., and Suzuki, S. (1990)
New topoisomerase essential for chromosome segregation in E. coli. Cell 63,
393–404.
10.
10 Maxwell, A., and Lawson, D. M. (2003) The ATP binding site of type II topoiso-
merases as a target of antibacterial drugs. Curr. Top. Med. Chem. 3, 283– 303.
11.
11 Oram, M., Dosanjh, B., Gormley, N. A., Smith, C. V., Fisher, L. M., Maxwell,
A., and Duncan, K. (1996) The mode of action of GR122222X, a novel inhibitor
of DNA gyrase. Antimicrob. Agents Chemother. 40, 473–476.
12.
12 Drlica, K., and Malik, M. (2003) Fluoroquinolones: Action and resistance. Curr.
Top. Med. Chem. 3, 249–282.
13.
13 Grossman, T. H., Bartels, D. J., Mullin, S., Gross, C. H., Parsons, J. D., Liao, Y.,
Grillot, A.L., Stamos, D., Olson, E. R., Charifson, P. S., and Mani, N. (2007) Dual
targeting of GyrB and ParE by a novel aminobenzimidazole class of antibacterial
compounds. Antimicrob. Agents Chemother. 51, 657–666.
14.
14 Pan, X.-S., and Fisher, L. M. (1997) Targeting of DNA gyrase in Streptococcus
pneumoniae by sparfloxacin: Selective targeting of gyrase or topoisomerase IV by
quinolones. Antimicrob. Agents Chemother. 41, 471–474.
15.
15 Pan, X.-S., and Fisher, L. M. (1998) DNA gyrase and topoisomerase IV are dual
targets of clinafloxacin action in Streptococcus pneumoniae. Antimicrob. Agents
Chemother. 42, 2810–2816.
16.
16 Zhanel, G. G., Fontaine, S., Adam, H., Schurek, K., Mayer, M., Noreddin, A. M.,
Gin, A. S., Rubinstein, E., and Hoban, D. J. (2006) A review of new fluoro-
quinolones: Focus on their use in respiratory tract infections. Treatment Respir.
Med. 5, 437–465.
17.
17 Staudenbauer, W. L., and Orr, E. (1982) DNA gyrase: Affinity chromatog-
raphy on novobiocin-Sepharose and catalytic properties. Nucleic Acids Res. 9,
3589–3603.
18.
18 Pan, X.-S., Yague, G., and Fisher, L. M. (2001) Quinolone resistance mutations
in Streptococcus pneumoniae GyrA and ParC proteins: Mechanistic insights into
quinolone action from enzymatic analysis, intracellular levels, and phenotypes of

wild-type and mutant proteins. Antimicrob. Agents Chemother. 45, 3140–3147.
19.
19 Sayer, P. J., Goble, M. L., Oram, M., and Fisher, L. M. (2001) Plasmid supercoiling
by DNA gyrase. In Methods in Molecular Biology, Vol. 95: DNA Topoisomerase
Protocols, Part II: Enzymology and Drugs (N. Osheroff and M. A. Bjornsti, eds.),
Humana Press Inc, Totowa, NJ, pp. 25–33.
3
A Method to Assay Inhibitors of DNA Polymerase IIIC

Activity
Michelle M. Butler and George E. Wright
Summary
The need for new drugs to treat infections caused by antibiotic-resistant bacterial strains
has prompted many studies to identify novel targets in pathogenic bacteria. Among the three
DNA polymerases expressed by bacteria, one of these, designated pol III, is responsible for
DNA replication and growth of bacteria and, therefore, warrants consideration as a drug target.
However, the pol III enzymes of Gram-positive and Gram-negative species are quite different,
and the Gram-positive enzyme pol IIIC has been more extensively studied as a drug target than
the Gram-negative enzyme pol IIIE.
DNA polymerases are unique enzymes with respect to the five substrates (four dNTPs, one
of which is radiolabeled, and primer:template DNA) that they typically utilize. Variations of the
assay, e.g., by leaving out one dNTP but allowing measurable incorporation of the remaining
substrates, or use of homopolymer primer:templates, may be used to simplify the assay or to
obtain mechanistic information about inhibitors. Use of gel analysis of primer extension assays
can also be applied to study alternate substrates of DNA polymerases. Methods to isolate pol IIIC
from Gram-positive bacterial cells and to clone and express the polC gene are described in this
chapter. In addition, the assay conditions commonly used to identify and study the mechanism
of inhibitors of pol IIIC are emphasized.
Key Words: DNA polymerase; pol IIIC; pol IIIE; isolation; cloning; DNA polymerase
assay.
1. Introduction
Bacteria contain three distinct DNA polymerases, designated pol I, pol II,
and pol III (1). Pol III has been found to be responsible for DNA replication
and growth of bacteria and is, therefore, the most relevant enzyme as a drug

25
26 M. M. Butler and G. E. Wright
target. However, the pol III enzymes of Gram-positive and Gram-negative

species differ considerably. The Gram-positive enzyme, now designated pol
IIIC, is a high-molecular-weight (MW) protein with polymerase and 3’,5’- and
5’,3’-exonuclease activities and has been exploited by several groups as a drug
target (2–5). The Gram-negative enzyme, designated pol IIIE, is smaller and
contains only polymerase activity. Recently, the pol II species from Gram-
positive bacteria has been renamed pol IIIE (because of its similarity to the
corresponding enzyme from Gram-negatives), and it too has been shown to
have an essential role in DNA replication (6).
Competitive inhibitors of Gram-positive pol IIIC have been studied for some
time and were, in fact, instrumental in defining the role of pol IIIC in bacterial
DNA replication. In addition, study of the mechanism, potency, and selectivity
of pol IIIC inhibitors has resulted in compounds currently under investigation
as antibacterial agents (2,5).
DNA polymerases are unique enzymes with respect to the five substrates
(four dNTPs and primer:template DNA) that they typically utilize. The finding
that one dNTP can be removed from the assay (“truncated assay”), but
measurable incorporation of the remaining substrates is permitted, forms the
basis of a powerful, direct measure of the Ki of an inhibitor competitive with the
removed dNTP (7). Alternately, homopolymer primer:templates utilizing one
dNTP can be used to great effect in defining both the potency and competitive
nature of inhibition by novel compounds.
The assay conditions commonly used to identify and study the mechanism
of inhibitors of pol IIIC are emphasized in this article, and both isolation of
pol IIIC from bacterial cells and its cloning and expression are described.
2. Materials
2.1. Preparation of B. subtilis Pol IIIC
2.1.1. Isolation of Native B. subtilis Pol IIIC
1. B. subtilis NB841, obtained from Dr. Neal Brown.
2. 20 mM Tris-acetate, pH 8.2, 10 mM magnesium acetate, 0.5 mM EDTA.
3. 15 mM potassium phosphate, pH 7.4, 300 mM ammonium sulfate.
4. 10 mM potassium phosphate, pH 7.4, 200 mM ammonium sulfate.
5. 10 mM potassium phosphate, pH 6.5.
6. Hydroxylapatite (Clarkson Chemical Co.).
7. DEAE cellulose DE 52 (Whatman).
8. Sephadex G25, G200 (Pharmacia).
9. Agarose (Bio-Rad).
A Method to Assay Inhibitors of DNA Polymerase IIIC Activity 27
10. Denatured DNA cellulose, prepared as described by Alberts et al. (8).

11. Triton X-100 (Sigma).
2.1.2. Isolation of Recombinant B. subtilis Pol IIIC

1. Plasmid pSGA04, obtained from Dr. John Lowenstein.
2. Restriction enzymes, HpaI, XhoI, BamHI, and EcoRI as well as E. coli. Klenow pol
I can be purchased from New England Biolabs and is stored at –20 °C.
3. LB; Luria broth, Lennox (Difco).
4. PBS: 150 mM NaCl, 50 mM potassium phosphate, pH 7.5.
5. Column buffer: 50 mM potassium phosphate, pH 7.5, 20% glycerol, 1 mM PMSF,
2 mM -mercaptoethanol.
6. IMAC agarose affinity gel (Sigma-Aldrich) is stored at 4 °C.
7. MacroPrep High Q (Bio-Rad) is stored at 4 °C.
8. MacroPrep column buffer: 50 mM potassium phosphate, pH 7.5, 10% glycerol,
5 mM PMSF, 2 mM -mercaptoethanol, stored at 4 °C.
2.2. DNA Substrates

2.2.1. Activated Calf Thymus DNA
1. Calf thymus DNA (Worthington Biochemical Corporation) is stored at 4 °C.
2. 50 mM Tris-HCl, pH 7.5, sterile-filtered into a sterile flask.
3. Deoxyribonuclease I (DNAse, Sigma), dissolved in dH2 O at 5 mg/mL and stored
at –20 °C.
4. Deoxyribonucleotides: dATP, dCTP, dGTP, dTTP (100 mM stock solutions,
Fermentas).
5. [Methyl-3 H]-thymidine 5’-triphosphate, ammonium salt (Amersham/GE
Healthcare).
6. DNA-free assay mix: 50 mM Tris-HCl, pH 7.5 (30 mM final), 16.67 mM magnesium
acetate (10 mM final), 6.67 mM dithiothreitol (4 mM final), 26.67% (v/v) glycerol
(16% final), 41.6 μM dATP, dCTP, dGTP (25 μM final), 16.67 μM [3 H] TTP,
2 μCi/nmole (10μM, 1.2 μCi/nmole final). This mixture can be stored at –20 °C for
several years.
2.2.2. Synthetic Primer:Templates

1. Oligodeoxythymidylate, (dT)12−18 (Midland Certified Reagent Company).
2. Polydeoxyadenylic acid, poly(dA) (Midland Certified Reagent Company).
3. Oligodeoxyguanylate (dG)12−18 (Midland Certified Reagent Company).
4. Polydeoxycytidylic acid, poly(dC) (Midland Certified Reagent Company).
5. Powders and solutions of polymers and oligonucleotides should be stored at –20 °C.
2.3. Pol IIIC Assays

2.3.1. Standard Pol IIIC Assay
1. 96-well assay plate (U-bottom polypropylene, AbGene).
2. Chemicals such as Tris-HCl, magnesium acetate, glycerol, dithiothreitol (DTT),
trichloroacetic acid (TCA), hydrochloric acid (HCl), sodium pyrophosphate, and
ethanol can be purchased from Sigma-Aldrich or VWR Scientific.
3. Deoxyribonucleotides: dATP, dCTP, dGTP, dTTP (100 mM stock solutions,
Fermentas).
4. [Methyl-3 H]-thymidine 5’-triphosphate, ammonium salt (Amersham/GE
Healthcare).
5. Assay glass fiber filter plates (96-well, Multiscreen-HTS FC Barex, Millipore).
6. Liquid scintillation cocktail (OptiPhase Supermix, Perkin Elmer).
2.3.2. Pol IIIC Assay Using Synthetic Template:Primers

1. [Methyl-3 H]-thymidine 5’-triphosphate, ammonium salt, and Deoxy-[8-3 H]-
guanosine 5’-triphosphate, ammonium salt (Amersham/GE Healthcare).
2.3.3. Primer Extension Assay

1. The primer is a 17mer, 5’-GTAAAACGACGGCCAGT-3’ (M13/pUC-20
sequencing primer, New England Biolabs).
2. The template is a custom-synthesized 29mer 3‘CATTTTGCTGCC-
GGTCACATGCCGATCCC-5’ (Operon).
3. T4 polynucleotide kinase (New England Biolabs).
4. [32 P]-ATP, triethylammonium salt (Amersham/GE Healthcare).
5. Calf thymus terminal deoxyribonucleotidyl transferase (New England Biolabs).
6. Spermidine, Sephadex G-25 (Sigma-Aldrich).
7. Deoxyribonucleotide dGTP (100 mM stock solution, Fermentas).
8. Extension buffer: 20 mM potassium phosphate, pH 7.5, 8 mM MgCl2 , 4 mM DTT,
0.1 mM EDTA.
9. Stop buffer: 95% formamide, 20 mM EDTA, 0.05% bromphenol blue, and 0.05%
xylene cyanol FF.
3. Methods
3.1. Preparation of B. subtilis Pol IIIC
3.1.1. Isolation of Native B. subtilis Pol IIIC
Purification of native pol III from B. subtilis has been described, starting
with a strain that is deficient in pol I (9,10).
1. All buffers contain 20% (v/v) glycerol and 5 mM -mercaptoethanol, and purifi-
cation procedures are done at 0–4 °C. Protein concentration is estimated by the
method of Lowry et al. (11). Five g of packed B. subtilis NB841 are suspended in
10 mL of a buffer consisting of 20 mM Tris-acetate, pH 8.2, 10 mM magnesium
acetate, and 0.5 mM EDTA, and ruptured in a French pressure cell. The lysate
is freed of debris by centrifugation at 17,000X g for 30 min, and the super-
natant is further centrifuged for 3 h in a Spinco 50.1 rotor at 42,000 rpm
(200,000X g).
2. The high-speed supernatant (10 mL; 20 mg of protein per mL) is diluted with 20
mL of 16 mM potassium phosphate buffer, pH 7, containing 300 mM ammonium
sulfate, and passed at a rate of 0.5 mL/min through a 13 × 1.65-cm column of
DEAE-cellulose equilibrated with 10 mM potassium phosphate buffer (pH 7.4)
containing 200 mM ammonium sulfate. The first 15 mL of eluant is discarded; the
subsequent 45 mL, containing 85% of input protein, is mixed with 22 g of ground
ammonium sulfate and stirred for 90 min. The precipitated protein is harvested
by centrifugation, dissolved in 6 mL of 10 mM potassium phosphate, pH 6.5, and
freed of ammonium sulfate by passage through Sephadex G-25 in the same buffer
(Fraction IV).
3. All of the solutions contain 20% glycerol, 10 mM magnesium acetate, 25 mM
-mercaptoethanol, 0.5% Triton X-100, and potassium phosphate, pH 6.5 (referred
to as phosphate) at a specified concentration. Fraction IV is diluted to 2 mg per mL
in 10 mM phosphate and applied to a 100 mL column (2 × 32 cm) of denatured
DNA-cellulose equilibrated with the same buffer. The column is eluted with a
linear gradient (0.1 to 0.4 M; volume 1000 mL; 3.3 mL per min) of phosphate.
The polymerase activity, which emerges as a single peak between 0.22 and 0.29 M
phosphate, is pooled in a volume of 190 mL, diluted 4-fold with 10 mM phosphate,
and applied to a 5 mL column (1.1 × 5 cm) of DEAE-cellulose washed with 10
mM phosphate. The enzyme, which is retained on the column, is eluted with 0.5 M
phosphate in a volume of 6.5 mL (Fraction V).
4. Fraction V is diluted 7-fold with 10 mM phosphate and applied to a 25 mL
column (1.5 × 15 cm) of hydroxylapatite equilibrated with 10 mM phosphate, and
eluted with a linear gradient (0.05 to 0.3 M; volume, 600 mL; 2 mL per min) of
phosphate. Enzyme activity, which emerges as a single peak between 0.15 and 0.19
M phosphate, is pooled in a volume of 96 mL and diluted 3-fold with 10 mM
phosphate. The pool is applied to a l mL column (0.56 × 4 cm) of DEAE-cellulose
washed with 10 mM phosphate, and the enzyme is eluted in a volume of 0.8 mL
of 0.5 M phosphate (Fraction VI).
5. Fraction VI is applied to a column (1.1 × 54 cm) of Sephadex G-200 equili-
brated with 0.5 M phosphate and eluted at a rate of 0.9 mL per hour. The
enzyme emerges as a symmetrical peak approximately 5 mL after the void volume
(15 mL, blue dextran 2000); 80% of the activity is pooled in a volume of 5
mL, diluted 7-fold with 10 mM phosphate, and concentrated into 0.25 mL of
0.5 M phosphate with a 0.25 mL column (0.56 × 1 cm) of DEAE-cellulose
(Fraction VII).
3.1.2. Cloning, Overexpression, and Isolation of Recombinant

B. subtilis Pol IIIC
1. Engineering of B. subtilis polC into expression plasmid pSGA04 (12) requires
the following five steps that have been described elsewhere (13): (i) introduction,
with PCR, of a new HpaI restriction site at nucleotide 16 of a form of Bs polC
that has been engineered previously to contain an XhoI site at position 1246 (14);
(ii) excision of the resulting 1228-bp HpaI-XhoI fragment; (iii) recloning of the
corresponding DNA into a fully wild-type Bs polC in the vector pKC30(15); (iv)
excision of the polC gene lacking the first 15 bases from pKC30 as an HpaI-BamHI
fragment; and (v) inserting the fragment into pSGA04, which has been digested
with EcoRI, filled in by treatment with Klenow pol I, and subsequently digested
with BamH1to create expression vector pSGA04-polC (see Note 1).
2. Plasmid pSGAO4-polC is introduced into E. coli SG101 by transformation, and
transformant colonies are grown at 30 °C to an A600 of approximately 1 in LB
expression medium containing 15 μg/mL kanamycin as described (13). The culture
is then chilled on ice to a temperature of 15 °C, IPTG is added to a concentration of
1 mM to induce expression of pSGAO4-polC, and incubation at 15 °C is continued,
with shaking, for 18 h.
3. The cells are harvested by centrifugation at 6,000X g for 30 min, washed with PBS
containing 1 mM PMSF using 30 mL/L of culture, and resuspended in column
buffer (30 mL/L of culture), then frozen at -80 °C and thawed.
4. The following scheme summarizes purification from cells derived from 1 L of
induced culture with all steps being performed at 4 °C. Steps 5 and 6 have been
described previously (1,16), and step 7 is an unpublished method.
5. Resuspended cells are fractured in a French press and centrifuged at 27,000X g for
2 h (see Note 2).
6. The cleared supernatant is loaded onto a 12.5 mL column of Ni2+ -charged IMAC
agarose that has been equilibrated with column buffer, washed with two volumes of
column buffer, and eluted with a linear 0–200 mM imidazole gradient based on the
same buffer but with only 10% glycerol (total gradient volume: 250 mL). Fractions
are collected and assayed for pol III activity and the peak fractions pooled.
7. The IMAC pool is loaded onto a 10 mL MacroPrep High Q anion exchange
column that has been equilibrated with MacroPrep column buffer, washed with three
volumes of the same buffer, and eluted with a linear gradient of 0.1–0.6 M NaCl in
the same column buffer (total gradient volume: 75 mL) (see Note 3). Fractions are
collected and assayed for pol III activity, and the peak fractions pooled, aliquotted,
and stored at -80 °C (see Note 4).
3.2. Preparation of DNA Substrates

3.2.1. Activated Calf Thymus DNA
1. Rinse two pairs of forceps with 90% ethanol, and use a flame to sterilize. Using
the forceps, shred 800 mg of dry calf thymus DNA into small pieces and place into
45000
40000
35000
30000 0.075 ug/mL
Counts
25000 0.15 ug/mL

20000 0.3 ug/mL
15000 0.6 ug/mL
10000
5000
0
0.00 5.00 10.00 15.00
Minutes
Fig. 1. Pilot-scale preparation of activated calf thymus DNA, described in Section

3.2.1.
a sterile flask. Add 400 mL sterile 50 mM Tris-HCl, pH 7.5 (to yield a 2 mg/mL
solution), and shake at 125 rpm for 48 h at 4 °C.
2. Perform a pilot run of DNAse digestion to determine the proper DNAse concen-
tration and digestion time. Set up four glass tubes containing 2 mg/mL DNA, 5 mM
MgCl2 , and DNAse at the following concentrations: 0.6, 0.3, 0.15, and 0.075 μg/mL.
Incubate the tubes at 37 °C, remove 200 μL aliquots at 2.5, 5, 10, and 15 min,
and inactivate DNAse by heating to 65 °C for 10 min and cooling samples on ice.
3. Add 5 μL of each DNA sample to 15 μL DNA-free assay mix (see Section 2.2.1)
and 5 μL pol IIIC at a 1:200 dilution in a 96-well assay plate and incubate for 10
min at 30 °C. Process samples as described in Section 3.3.
4. Plot the results as counts vs. time for each DNAse concentration (e.g., see Fig. 1) and
select the optimal DNAse concentration and digestion time. Scale up the reaction by
placing 200 mL of the DNA solution into each of two 2 L flasks (see Note 5) and adding
MgCl2 to a final concentration of 5 mM and DNAse to the concentration chosen in
the pilot study (see Note 6). Incubate in a 37°C water bath with occasional swirling
for the amount of time chosen in the pilot study, inactivate the DNAse by heating
the flask in a 65°C water bath with constant swirling, and place flasks on ice to cool.
5. Aliquot the activated DNA into 15 mL tubes and store at –20 °C for up to 10 years.
3.2.2. Synthetic Primer:Templates

A number of combinations of synthetic template:primers can be used;
however, we have found two combinations that produce good results with B.
subtilis pol III: poly(dA):oligo(dT) and poly(dC):oligo(dG).
In order to prepare these DNA substrates, a ratio of 5 A260 units of polymer

[poly(dA) or poly(dC)] and 0.25 OD units of oligomer [dT12−18 or dG12−18 ]
should be heated in the presence of 10 mM Tris-HCl, pH 7.6, at 50 °C for 10
min and allowed to cool to 25 °C over 10 min.
3.3. Assays Using Pol III

3.3.1. Standard Pol III Assay Using Activated DNA and Four dNTPs
(One Labeled)
Assays on both native and recombinant, purified B. subtilis pol IIIC are
performed as previously described (13,14), with the exception of using a 96-
well plate format.
1. Each 25 μL assay contains 30 mM Tris, pH 7.5, 10 mM magnesium acetate, 4

mM dithiothreitol, 20% glycerol, with 25 μM dATP, dCTP, dGTP and 10 μM
dTTP (3 H-labeled at 1.2 μCi/nmole) and 0.4 mg/mL activated calf thymus DNA as
substrates in a polypropylene 96-well assay plate.
2. Assays are initiated by the addition of 0.025 to 0.06 units of pol III enzyme (1 unit is
the amount required to incorporate 250 pmoles of [3 H]-dTMP in a standard assay),
incubated for 10 min at 30 ºC, and terminated by the addition of 100 μL of cold
10% TCA, 10 mM sodium pyrophosphate (see Note 7).
3. Precipitated labeled DNA is collected on glass fiber filter plates that have been
prewet with 50 μL ice-cold 1 M HCl, 100 mM sodium pyrophosphate. The plates
are washed with 100 μL of the HCl solution followed by 100 μL of ice-cold 90%
ethanol and then dried for 30 min under a heat lamp.
4. Liquid scintillation cocktail (30 μL OptiPhase Supermix) is added and the plate
counted in a liquid scintillation counter (MicroBeta Trilux, Perkin Elmer) set to
read the tritium signal for 15 s in a 96-well plate.
3.3.2. Assays Using Synthetic Primer:Templates

Assay conditions using synthetic primer:templates are essentially the same
as the assay described above for use with activated DNA. The differences are
as follows:
1. A final template (polymer) concentration of 0.5 OD/mL is used in a 25 μL assay

volume.
2. A single dNTP is present in each assay type: [3 H]-dTTP or [3 H]-dGTP (10 μM,
1.2 μCi/nmole) for use with poly(dA):oligo(dT) or poly(dC):oligo(dG), respectively
(see Note 8).
3. The reaction must be incubated at 37 °C for 60 min to get optimal incorporation.
3.3.3. Primer Extension Assays

The primer extension assay is performed to assess the potential for incorpo-
ration into DNA of a dNTP mimic type of inhibitor and has been described in
the literature (17–19).
1. Primer is labeled by incubating 0.125 A260 units with 500 μCi [32 P]-ATP (3000
Ci/mmol) and 5 units T4 polynucleotide kinase in 50 mM Tris-HCl, pH 7.6, 10
mM MgCl2 , 5 mM DTT, and 1 mM spermidine in a total volume of 50 μL for 60
min at 35 °C, followed by boiling for 2 min and desalting on a 250 μL Sephadex
G-25 column equilibrated with 50 mM Tris-HCl, pH 7.6.
2. The desalted primer is annealed with an equal amount of template in labeling buffer
minus spermidine, and the solution is heated to 50 °C for 5 min followed by slow
cooling to room temperature over 60 min and quenching on ice.
3. Primer extension is performed by incubating 0.1–0.2 units of pol IIIC in the presence
or absence of dGTP or a dGTP-like inhibitor at 35 °C for 30 min in 12.5 μL of
a solution containing 20 mM potassium phosphate, pH 7.5, 8 mM MgCl2 , 4 mM
DTT, 0.1 mM EDTA, and 50 μg/mL of labeled template:primer. The reaction is
terminated by adding 4 μL of stop buffer, boiling for 2 min, and quenching on ice.
4. To visualize primer extension, a 5 μL sample is applied to a 12% polyacrylamide
DNA sequencing gel and electrophoresed for 4 h at 1500 volts at constant power.
The gel is then dried and exposed to a 14 × 17-in. sheet of Fuji X-ray film for
1–6 h and developed.
5. A sequencing ladder is run alongside the samples to identify the length of the
primer. To create the ladder, 0.25 units of calf thymus terminal deoxynucleotidyl
transferase is incubated with 1 μg of labeled primer in the presence of 10 μM
BuPdGTP (20) or another dGTP-like inhibitor that is known to be incorporated.
4. Notes
1. The cloning and expression of B. subtilis polC can be performed using a number
of different kits/protocols that are now available from companies such as Novagen
(i.e., pET vectors).
2. Lysis of E. coli cells can also be achieved by sonication, although use of the French
press is preferable. For example, we have used a Virsonic 475 Ultrasonic Cell
Disrupter (Virtis Company) with a ½-in. probe, setting 5 (of a maximum of 10),
using 3 × 10 s pulses to lyse cells. Always immerse the tube containing cells in a
beaker of ice, and avoid foaming of the suspension to prevent protein denaturation.
3. A Mono-Q anion exchange column with an FPLC system (Pharmacia) has been used
as the second column purification step in published versions of the pol III purifi-
cation, but we have found the MacroPrep column to give an equivalent purification
without requiring the purchase of an FPLC system.
4. Pol III is stably stored at -80 °C for many years but is susceptible to loss of activity
upon multiple freeze/thaw cycles. The best way to store this enzyme is, after the
initial storage in a large volume, e.g., 1 mL, upon thawing a tube for the first time,
aliquot that volume into smaller units, e.g., 50 μL, for more frequent use.
5. Perform DNAse treatment using a large flask and volume:liquid ratio to obtain the
fastest possible heat inactivation. If the DNAse treatment lasts too long, activity
begins to decrease rapidly.
6. An example of a typical DNAse treatment pilot run is illustrated in Fig. 1. The
scale-up conditions that were chosen in this particular experiment were to treat with
0.15 μg/mL of DNAse for 10 min.
7. The standard 4-dNTP assay should be used to analyze inhibitors of an unknown
mechanism. However, to identify inhibitors that compete with any of the dNTPs, a
truncated assay should be used. This assay type requires the omission of one dNTP
at a time, the use of activated DNA, and the inclusion of the [3 H]-labeled dNTP
that is not the dNTP that has been omitted. This so-called truncated assay has been
used to assay the anilinouracils, pol IIIC inhibitors whose activities compete with
dGTP (7).
8. Further characterization of inhibitors with a competitive mechanism of action
(MOA) may be performed using synthetic primer:templates, such as in the assay
described in Section 3.3.2. Detailed analysis of the MOA of pol IIIC inhibitors,
i.e., the 6-(phenylhydrazino)uracils, has been accomplished using synthetic DNAs
(9,21).
References
1.
1 Kornberg, A., and Baker, T. (1992) DNA Replication, 2nd ed. W.H. Freeman and
Co., New York.
2.
2 Wright, G. E., and Brown, N. C. (1999) DNA polymerase III: A new target for
antibiotic development. Curr. Opin. Anti-Infective Investig. Drugs 1, 45–48.
3.
3 Tarantino, P. M., Zhi, C. G., Wright, E., and Brown, N. C. (1999) Inhibitors of DNA
polymerase III as novel antimicrobial agents against Gram-positive eubacteria.
4.
4 Ali, A., Aster, S. D., Graham, D. W., Patel, G. F., Taylor, G. E., Tolman, R. L.,
Painter, R. E., Silver, L. L., Young, K., Ellsworth, K., Geissler, W., and Harris,
G. S. (2001) Design and synthesis of novel antibacterial agents with inhibitory
activity against DNA polymerase III. Bioorg. Med. Chem. Lett. 11, 2185–2188.
5.
5 Yang, F., Dicker, I. B., Kurilla, M. G., and Pompliano, D. L. (2002) PolC-type
polymerase III of Streptococcus pyogenes and its use in screening for chemical
inhibitors. Anal. Biochem. 304, 110–116.
6.
6 Dervyn, E., Suski, C., Daniel, R., Bruand, C., Chapuis, J., Errington, J., Janniere, L.,
and Ehrlich, S. D. (2001) Two essential DNA polymerases at the bacterial repli-
cation fork. Science 294, 1716–1719.
7.
7 Wright, G. E., and Brown, N.C. (1976) Inhibition of Bacillus subtilis DNA
polymerase III by arylhydrazinopyrimidines. Novel properties of 2-thiouracil
derivatives. Biochim. Biophys. Acta 432, 37–48.
8.
8 Alberts, B. M., Amodio, F. J., Jenkins, M., Gutmann, E. D., and
Ferris, F. L. (1968) Studies with DNA-cellulose chromatography. I. DNA-binding
proteins from Escherichia coli. Cold Spring Harb. Symp. Quant. Biol. 33,
289–305.
9.
9 Clements, J. E., D’Ambrosio, J., and Brown, N. C. (1975) Inhibition of Bacillus
subtilis deoxyribonucleic acid polymerase III by phenylhydrazinopyrimidines.
Demonstration of a drug-induced deoxyribonucleic acid-enzyme complex. J. Biol.
Chem. 250, 522–526.
10.
10 Mackenzie, J. M., Neville, M. M., Wright, G. E., and Brown, N. C. (1973) Hydrox-
yphenylazopyrimidines: Characterization of the active forms and their inhibitory
action on a DNA polymerase from Bacillus subtilis. Proc. Natl. Acad. Sci. USA
70, 512–516.
11.
11 Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) Protein
measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275.
12.
12 Ghosh, S., and Lowenstein, J. M. (1996) A multifunctional vector system for
heterologous expression of proteins in Escherichia coli. Expression of native and
hexahistidyl fusion proteins, rapid purification of the fusion proteins, and removal
of fusion peptide by Kex2 protease. Gene 176, 249–255.
13.
13 Barnes, M. H., Leo, C. J., and Brown, N. C. (1998) DNA polymerase III of Gram-
positive eubacteria is a zinc metalloprotein conserving an essential finger-like
domain. Biochem. 37, 15254–15260.
14.
14 Barnes, M. H., and Brown., N. C. (1995) Purification of DNA polymerase III of
Gram-positive bacteria. Methods Enzymol. 262, 35–42.
15.
15 Hammond, R. A., and Brown, N. C. (1992) Overproduction and purification of
Bacillus subtilis DNA polymerase III. Protein Expr. Purif. 3, 65–70.
16.
16 Foster, K. A., Barnes, M. H., Stephenson, R. O., Butler, M. M., Skow, D. J.,
LaMarr, W. A., and Brown, N. C. (2003) DNA polymerase III of Enterococcus
faecalis: Expression and characterization of recombinant enzymes encoded by the
polC and dnaE genes. Protein Expr. Purif. 27, 90–97.
17.
17 Butler, M. M., Dudycz, L. W., Khan, N. N., Wright, G. E., and Brown, N. C.
(1990) Development of novel inhibitor probes of DNA polymerase III based on
dGTP analogs of the HPUra type: Base, nucleoside and nucleotide derivatives of
N2-(3,4-dichlorobenzyl)guanine. Nucleic Acids Res. 18, 7381–7387.
18.
18 Khan, N. N., Wright, G. E., and Brown, N. C. (1991) The molecular mechanism
of inhibition of alpha-type DNA polymerases by N2-(butylphenyl)dGTP and 2-
(butylanilino)dATP: Variation in susceptibility to polymerization. Nucleic Acids
Res. 19, 1627–1632.
19. Townsend, A. J., and Cheng, Y. C. (1987) Sequence-specific effects of ara-5-aza-
19
CTP and ara-CTP on DNA synthesis by purified human DNA polymerases in
vitro: Visualization of chain elongation on a defined template. Mol. Pharmacol.
32, 330–339.
20.
20 Wright, G. E., and Dudycz, L. W. (1984) Synthesis and characterization of N2-(p-
n-butylphenyl)-2’-deoxyguanosine and its 5’-triphosphate and their inhibition of
HeLa DNA polymerase alpha. J. Med. Chem. 27, 175–181.
21.
21 Gass, K. B., Low, R. L., and Cozzarelli, N. R. (1973) Inhibition of a DNA
polymerase from Bacillus subtilis by hydroxyphenylazopyrimidines. Proc. Natl.
Acad. Sci. USA 70, 103–107.
4
Methods to Identify and Characterize Inhibitors

of Bacterial RNA Polymerase
A. Simon Lynch and Qun Du
Summary
RNA polymerase is essential to the viability of bacteria in all phases of growth and devel-
opment and is a proven chemotherapeutic target as the cellular target of the rifamycin class of
antibiotics. However, despite the characterization of multiple different classes of natural products
that selectively target bacterial RNA polymerase, and the identification of a limited number
of synthetic compound inhibitors, only agents of the rifamycin class have been developed and
approved for human clinical use as antibiotics. Herein we describe a scintillation proximity assay
(SPA) for identifying and characterizing inhibitors of bacterial RNA polymerases and that is
applicable to de novo drug discovery programs through application of automated high-throughput
screening methods. In addition, we describe gel electrophoresis-based methods that are appli-
cable to the detailed characterization of inhibitors of transcriptional initiation or elongation by
bacterial RNA polymerases.
Key Words: RNA polymerase; transcription; rifampin; Sigma factor; inhibitor; antibiotic;
high-throughput screen.
1. Introduction
Bacteria possess a single RNA polymerase (RNAP) enzyme that is respon-
sible for the synthesis of all structural RNA (tRNA and rRNA) and messenger
RNA (mRNA) species. RNAP is a complex macromolecular machine
comprised of a multi-subunit catalytic “core” enzyme (2 ) of ∼400 kDa
that combines with an additional subunit, Sigma (), to form a “holoenzyme”
capable of site-specific transcriptional initiation at cognate promoter elements
(1). RNAP is essential for the propagation and maintenance of bacteria

37
38 A. S. Lynch and Q. Du
in multiple different phases of growth and development, including disease

pathogenesis and the adaptation to environmental stresses. Regulation of the
levels or activity of alternate factors, and other classes of transcriptional
regulatory proteins, governs the temporal modulation of the transcriptome
produced by RNAP and therein affects the gene expression changes necessary
for transitions between different growth states.
The essentiality of RNA polymerase in the growth and propagation of
bacteria is reflected in the number of antibiotic molecules that have been
identified that selectively target the enzyme. These include bacteriophage-
encoded proteins that act as anti-Sigma factors, exported polypeptide antibiotics
like microcin J25 (2,3), and a structurally diverse group of secondary metabolite
compounds including the rifamycins (4), myxopyronins (5), tiacumicins (6),
streptolydigin (7), sorangicin (8), and GE23077 (9) identified from natural
product sources in cell-based antimicrobial screens. To date, however, only
members of the rifamycin class of antibiotics have been developed and approved
for clinical use in humans.
Biochemical high-throughput screening (HTS) methods have more recently
been applied toward the identification of specific mechanistic classes of
inhibitors of bacterial RNAP enzymes. Such efforts have yielded three struc-
turally distinct classes of synthetic, small-molecule inhibitors that perturb
RNAP function via effects on either holoenzyme assembly (10), initiation (11),
or elongation (12,13). However, it remains to be determined whether these
(or other) novel classes of RNAP inhibitors will yield antimicrobial agents of
clinical utility. Herein we report methods that have been successfully employed
in the identification and characterization of novel structural classes of inhibitors
of the RNA polymerases of Escherichia coli and Staphylococcus aureus.
2. Materials
2.1. Bacterial Strains and Growth Media
1. S. aureus CB0842 is a derivative of strain RN4220 that bears an rpoC::His8
allele linked to a tetracycline-resistant determinant and was engineered by standard
methods (A. S. Lynch, unpublished).
2. E. coli CU0311 is a derivative of BL21 (DE3)/pLysS (Novagen, EMD Biosciences)
bearing a plasmid (pET24- A ) that expresses the S. aureus A (PlaC, RpoD) protein
in an isopropyl -D-1-thiogalactopyranoside (IPTG) inducible fashion (A. S. Lynch,
unpublished).
3. Cation-adjusted Mueller Hinton (MH II) broth and agar medium.
4. Terrific Broth (TB) medium.
5. Luria Bertani (LB) medium.
RNA Polymerase assays 39
2.2. Protein Purification

1. Lysis buffer: 50 mM Tris-HCl (pH 7.9), 10 mM MgCl2 , 300 mM NaCl, 5% glycerol.
See Note 1 regarding the preparation of buffers and solutions.
2. Complete Protease Inhibitor Tablets—EDTA-free (Roche Applied Science)
3. Lysostaphin.
4. 5 mL HiTrap HPLC Chelating Column (Amersham product # 17-0409-01 from GE
Healthcare, Life Sciences).
5. Buffer A: 80 mM Tris-HCl, pH 7.9, 300 mM NaCl, 10% glycerol, 0.2 mM PMSF.
6. Buffer B: 80 mM Tris-HCl, pH 7.9, 300 mM NaCl, 10% glycerol, 0.2 mM PMSF,
and 100 mM Imidazole.
7. RNAP storage buffer: 50 mM Tris-HCl, pH 7.9, 0.1 mM EDTA, 0.2 mM PMSF,
1.0 mM DTT, 50% glycerol.
8. TGED buffer: 50 mM Tris-HCl, pH 7.9, 5% glycerol, 0.1 mM EDTA, 0.5 mM
DTT.
2.3. Scintillation Proximity Assays for Identifying RNAP Inhibitors

1. Yyttrium Silicate (YSi) RNA binding SPA beads (Amersham product #
RPNQ0013, GE Healthcare, Life Sciences); see Note 2 for details regarding the
storage and use of YSi SPA beads.
2. 96-well flat bottom, opaque, white polystyrene plates (Corning, VWR Cat #
29444-016); equivalent 384- or 1536-well Corning plates are recommended for
screening in higher-density formats using automated high-throughput screening
(HTS) platforms.
3. RNAP SPA buffer (5X): 200 mM Tris-HCl, pH 7.9, 500 mM KCl, 0.4% (v/v)
PEG-8000, 50 mM MgCl2 , 25 mM DTT, 12.5% (v/v) glycerol.
4. Purified plasmid DNA template: pGL2B-T7A1 (see Fig. 2 and Note 3).
5. Ribonucleotide (NTP) mix (10X): 1 mM ATP, 1 mM CTP, 1 mM GTP, and
1 μM UTP. Prepared from 100 mM stocks (Promega), aliquotted, and stored
at –20 ºC.
6. [5,6-3 H] Uridine 5’-triphosphate, ammonium salt; specific activity 1.1-2.2
TBq/mmol, 30–60 Ci/mmol (Amersham Radiochemicals product # TRK412, GE
Healthcare, Life Sciences).
7. Nuclease-free water.
8. Dimethyl sulfoxide—99.9% ACS grade.
9. E. coli RNA Polymerase 70 -Saturated Holoenzyme (Product # S90250, Epicentre
Biotechnologies). See Note 4.
10. S. aureus RNA Polymerase A -Saturated Holoenzyme(prepared fresh as described
in Section 3.1).
11. Test compounds and rifampin: Stocks should be prepared in 100% dimethylsul-
foxide (DMSO), aliquotted, and stored at –20 ºC.
(kDa) MW EC PA SA SP MW
203 203
120 120
90 90
52 52
20 20
4 4
Fig. 1. SDS-PAGE analysis of recombinant RNAP enzymes. RNAP enzymes were

purified from strains engineered to express RpoC (’) subunits that bear a carboxyl-
terminal oligo-histidine tag (RpoC-His6−10 ) by immobilized metal affinity chromatog-
raphy (IMAC): E. coli (EC), P. aeruginosa (PA), S. aureus (SA), and S. pneumoniae
(SP). For each preparation, the two large catalytic subunits of the RNAP enzyme (RpoB
and RpoC) are readily apparent. The molecular weight (MW) markers employed have
the indicated sizes in kiloDaltons (kDa).
2.4. Gel-Based Assays for Characterizing RNAP Inhibitors

1. [-32P]-Cytidine 5’-triphosphate with specific activity of 10 μCi/μl (product #
BLU508X from PerkinElmer Life and Analytical Sciences).
2. Polyacrylamide gel reagents: SequaGel Concentrate (product # EC-830), Diluent
(EC-840) and Buffer (EC-835) from National Diagnostics Inc.
3. Recombinant RNasin Ribonuclease Inhibitor (product # N2515 from Promega
Corp.).
4. Gel Loading Buffer II for Denaturing PAGE (Ambion product # 8547, Applied
Biosystems).
5. Purified plasmid DNA template: pGL2B-T7A1 (see Fig. 2 and Note 3).
6. RNAP gel assay buffer (5X): 200 mM Tris-HCl, pH 7.9, 500 mM KCl, 0.4% (v/v)
PEG-8000, 50 mM MgCl2 , 25 mM DTT, 12.5% (v/v) glycerol.
7. S. aureus gel assay ribonucleotide (NTP) mix (10X): 6 mM ATP, 6 mM UTP, 0.01
mM CTP. Prepared from 100 mM stocks (Promega), aliquotted, and stored at –20 ºC.
8. E. coli gel assay ribonucleotide (NTP) mix (10X): 6 mM ATP, 6 mM UTP, 0.001
mM CTP. Prepared from 100 mM stocks (Promega), aliquotted, and stored at –20 ºC.
3. Methods
The identification and characterization of RNAP inhibitors require access to
highly purified enzyme preparations that exhibit high-specific activity in vitro.
Despite the availability of E. coli RNAP from a number of commercial sources,
-35 -10 +1
PT7A1 GAGTATTGACTTAAAGTCTAACCTATAGGATACTTACAGCCATA
Psea TATTATAGACAAGTATAAAAAAGGTATAGTAATATATGTATATA
PTAC18 CGCTATTGACATTATAGTGGTACCGCTTATATAATCTCAATTAT
Bgl II Hind III BamH I

Promoter G-less Luciferase
Nco I Sal I
Fig. 2. Diagrammatic representations of transcription templates used for the identifi-

cation and characterization of bacterial RNAP inhibitors. The promoter elements shown
were combined by PCR methods with a 272 nucleotide G-less cassette element derived
from the vector p(C2AT)19 (24) and cloned between the Bgl II and Hind III sites of
the pGL2-Basic plasmid (Promega Corp.; Genbank Accession Number X65323). In
pGL2B-T7A1-Gless, the bacteriophage T7 derived PT 7A1 promoter is utilized by RNAP
enzymes from both Gram-positive and Gram-negative species. In pGL2B-sea-Gless,
the Psea promoter is derived from the transcriptional regulatory region of the Staphy-
lococcus enterotoxin-A (sea) gene promoter and is efficiently utilized by S. aureus
A RNAP enzyme. In pGL2B-TAC18-Gless, the PTAC18 promoter is a synthetic trp-
lacUV5 element that is efficiently utilized by E. coli 70 RNAP enzyme and other
Gram-negative RNAP enzymes (A. S. Lynch et al., unpublished). Using negatively
supercoiled DNA as a substrate, and optimal transcription conditions, initiation from
the promoter elements in the presence of ATP, CTP, and UTP (but no GTP) yields a
single RNA species that can be readily separated by gel electrophoresis and quantified.
Alternately, linear DNA substrates may be generated by restriction enzyme cleavage
and transcription undertaken in the presence of GTP.
only the 70 -saturated holoenzyme preparation from Epicentre (Madison, WI)

has proven suitable for detailed mechanistic studies. However, to facilitate the
relatively inexpensive purification of large quantities of high-specific-activity
RNAP enzymes for use in HTS, we have adopted a strategy wherein recom-
binant strains of target bacteria are engineered that express an RpoC (’) subunit
that bears a carboxyl-terminal oligo-histidine tag (RpoC-His6−10 ). Purification
of oligo-histidine tagged core RNAP preparations via immobilized metal
affinity chromatography (IMAC) followed by reconstitution with recombinant
factor yields RNAP holoenzyme forms that exhibit high-specific activity
in vitro. Similar methods have been reported for Streptococcus pneumoniae
(14), Bacillus subtilis (15,16), Streptomyces coelicolor and S. lividans (6), and
have also proven applicable to studies of RNA polymerases from Pseudomonas
aeruginosa, Escherichia coli, Haemophilus influenzae, and Mycobacterium
smegmatis (A. S Lynch et al., unpublished). Herein we describe in detail
the purification and reconstitution of S. aureus A RNAP holoenzyme by
methods that are readily adaptable for the preparation of similar recombinant
enzymes from other bacteria.
A number of biochemical HTS assay methods have been reported that
are broadly applicable to the identification of novel inhibitors of RNAP
enzymes including both (1) non-homogenous methods involving RNA product
capture (17,18) and (2) homogenous methods that utilize either the scintil-
lation proximity assay (SPA) (19,20) or fluorescence-based molecular beacon
(21,22) technologies for RNA product detection. Herein we describe in detail
the use of a 96-well SPA-based HTS assay employing either commercially
supplied E. coli 70 or purified S. aureus A RNAP holoenzymes that can be
run manually or in an automated fashion. This assay is readily adaptable for
implementation in 384- or 1536-well automated formats.
A variety of assays have been reported that are applicable to the detailed
characterization of different mechanistic classes of inhibitors of bacterial RNAP
enzymes (23). Herein we describe methods for the characterization of inhibitors
of transcriptional initiation or elongation and that are based on direct quantifi-
cation of either a single (or multiple) radiolabeled RNA product(s) following
resolution by gel electrophoresis. The transcription template employed in the
assays described in detail bears the bacteriophage T7A1 promoter, which is
efficiently utilized by bacterial RNAP holoenzymes of both Gram-negative and
Gram-positive origin; however, alternate transcription templates can be readily
substituted that are applicable to studies of specific RNAP enzymes. Hence,
while the methods described are focused on characterization of inhibitors of
either E. coli 70 or S. aureus A RNAP holoenzymes, they are readily adaptable
for similar studies of RNAP enzymes from other bacterial sources. Finally,
DNA templates that incorporate a “G-less” cassette element (24) allow for
detailed kinetic studies of RNAP inhibitors through analysis of the yield of
synthesis of a unique RNA product formed by a single round of transcription.
3.1. Purification of Recombinant RNA Polymerase

1. A fresh culture of S. aureus CB0842 (rpoC::His8 ::TetR ) is prepared from frozen
glycerol stocks by recovery onto an MHII agar plate (containing 2.5 μg/mL
tetracycline) and incubation at 37 ºC overnight.
2. 400 mL of Terrific Broth (TB) medium containing 1 μg/mL tetracycline is inocu-
lated with a single colony of CB0842, and the culture is grown overnight at 37 ºC
with aeration.
3. Aliquots of the fresh overnight culture of CB0842 are used to inoculate 8 L of TB
at a starting OD600 of ˜0.1, and the cultures are grown at 37 ºC with aeration for
6–8 hours until mid-exponential phase (corresponding to an OD600 of 3 to 4).
4. The bacterial cells are then harvested by centrifugation at 5000 RPM (4000X g)
for 20 min in a Sorvall H6000A rotor. This step and all subsequent steps are
carried out at 4 ºC or on ice unless stated otherwise.
5. Cell pellets are resuspended, washed in Lysis buffer, and consolidated into a
single pellet by centrifugation at 12,000 RPM (12,000X g) for 20 min in a Sorvall
SLA-1500 rotor. The cell pellet is then either immediately processed as described
below or flash frozen in liquid nitrogen and stored at –80 ºC.
6. If previously frozen, the cell pellet (typically ∼50 g) is gradually thawed and
suspended in 170 mL of Lysis buffer. Four complete protease inhibitor tablets
(EDTA free) and 20 mg of lysostaphin (as a dry powder) are then added, and the
bacterial cell suspension is incubated at 37 ºC for 1 h, with occasional mixing,
and then placed on ice.
7. The viscosity of the bacterial cell solution is then reduced by sonication: 5–10
cycles for 30 s on the maximum power setting with a Branson Digital Sonifier (or
equivalent) with intermittent cooling on ice. Cell lysis is then completed by 4–6
cycles of treatment with a microfluidizer (Microfuidics Corp.) at 80–100 pounds
per square inch (psi) of pressure at 4 ºC.
8. Insoluble cell debris is then removed by centrifugation at 12,000 RPM (12,000X
g) for 20 min in a Sorvall SLA-1500 rotor.
9. RNAP enzyme is purified by IMAC using two 5 mL HiTrap HP columns (in
series) that are charged with CoCl2 and equilibrated in lysis buffer. The supernatant
from Step 8 is loaded onto the HiTrap HP columns using an ÄKTA FPLC system
(Amersham, or equivalent) and washed with 20 column volumes of Buffer A, and
the protein is then eluted with a 20 column volume linear 0–100 mM imidazole
gradient that is produced by mixing Buffer A and Buffer B.
10. Peak column fractions are identified by SDS-PAGE analysis, pooled, and dialyzed
against RNAP storage buffer containing 0.2 mM PMSF.
11. Following dialysis, the concentration of the purified protein preparation is deter-
mined and aliquots flash frozen in liquid N2 and stored at –80 ºC. The final protein
yield is typically 20 mg; see Fig. 1 for SDS-PAGE analysis of a representative
preparation.
3.2. Purification of Recombinant Sigma Factor

1. A fresh culture of E. coli CU0311 is prepared from frozen glycerol stocks by
recovery onto an LB agar plate containing kanamycin (50 μg/mL) and chloram-
phenicol (35 μg/mL) and by incubation at 37 ºC overnight.
2. 400 mL of TB medium containing kanamycin (50 μg/mL) and chloramphenicol
(35 μg/mL) is inoculated and grown overnight at 37 ºC with aeration.
3. 1 L of antibiotic supplemented TB medium is then inoculated with the overnight
culture at a starting OD600 of 0.05, and the culture is grown at 37 ºC with aeration
to an OD600 of 0.4. Expression of the recombinant S. aureus A (RpoD) protein
is then induced by the addition of IPTG to 0.5 mM.
4. After 3 h at 37 ºC with vigorous aeration, the bacterial cells are harvested by

centrifugation for 10 min at 5000 RPM (5000X g) at 4 ºC.
5. Recovered cells are then washed in 50 mL of cold TGED buffer containing 200
mM NaCl and pelleted by centrifugation at 5000 RPM (5,000X g) at 4 ºC, and
the resulting cell pellet weighed and then flash frozen in liquid N2 and stored
at –80 ºC. A typical yield is 4 g of cells (wet weight) per liter of induced cell
culture.
6. The cell pellet is slowly thawed and suspended in 16 mL of cold TGED buffer
containing 200 mM NaCl per 4 g of cells, and the following are then added:
dithiothreitol (DTT) to 1 mM, PMSF to 0.2 mM, and one complete (-EDTA)
protease inhibitor cocktail tablet (per 50 mL of volume).
7. The cells are lysed by incubation on ice for 30 min followed by sonication. The
majority of the S. aureus A protein is present in inclusion bodies, which are
harvested by centrifugation of the lysate at 12,000 RPM (12,000X g) at 4 ºC for
30 min in a Sorvall SS-34 rotor.
8. The resulting inclusion body pellet is suspended in 20 mL TGED buffer containing
6 M guanidine-HCl and the solution mixed for 30 min at 4 ºC. Insoluble material
is then removed by centrifugation for 20 min at 4 ºC at 12,000 RPM (12000X g)
in a Sorvall SS-34 rotor.
9. To re-nature the A protein, the supernatant is dialyzed extensively against TGED
buffer containing 100 mM NaCl, 0.5 mM DTT, and 0.2 mM PMSF.
10. Following dialysis, insoluble material is removed by centrifugation at 12,000 RPM
(17,000X g) in a Sorvall SS-34 rotor for 30 min at 4 ºC. The re-natured A protein
is then precipitated with ammonium sulfate, and the protein pellet recovered by
centrifugation at 14,000 RPM (23,000X g) in an SS-34 rotor. The protein pellet is
suspended in 1–2 mL of TGED buffer containing 1 mM DTT and 0.2 mM PMSF
and further purified by size-exclusion chromatography on a Sephacryl S-200 HR
FPLC column (Amersham) equilibrated with TGED buffer containing 200 mM
NaCl and 0.2 mM PMSF.
11. Column fractions containing peak fractions of the A protein are identified by
SDS-PAGE analysis, pooled, and dialyzed against TGED buffer containing 100
mM NaCl and 50% glycerol.
12. Following dialysis, the concentration of the purified protein preparation is deter-
mined and aliquots flash frozen in liquid N2 and stored at –80 ºC. The final protein
yield is typically 30 mg per liter of induced cells.
3.3. Reconstitution of RNA Polymerase Holoenzyme

1. Aliquots of the purified recombinant S. aureus RNAP enzyme and A protein
are thawed on ice from –80 ºC stocks and then combined at the time of use in
transcription reactions. In standard assays, A protein is included in a 5-fold molar
(stoichiometric) excess over the core RNAP enzyme to yield a “Sigma-saturated”
holoenzyme form that exhibits high specific activity in vitro. See Note 5 for details
of methods used to estimate the relative stoichiometry of RNAP subunits.
2. If reconstitution of an alternate S. aureus RNAP holoenzyme form is desired, the
recombinant RNAP enzyme must be further purified by repeated passage through
a phosphocellulose column to yield a core RNAP enzyme preparation devoid of
contaminating Sigma factors (see Note 6).
3. Prior to use in mechanistic studies of RNAP inhibitors, reconstituted S. aureus
RNAP holoenzymes should be characterized to ensure that they exhibit site-specific
initiation of transcription from DNA templates bearing a cognate S. aureus promoter
element (see Section 3.5).
3.4. High-Throughput Method to Identify RNA Polymerase Inhibitors

1. Prepare a test compound plate at 5X concentration in a clear 96-well polypropylene
plate with rifampin included in a 6- to 12-well titration covering the final concen-
tration range of 0.25–250 ng/mL.
2. On ice, prepare mix 1 with 25 μL per assay well: 10 μL of RNAP SPA buffer (5X),
100–300 ng of S. aureus A -saturated RNAP holoenzyme and nuclease-free water
(to 25 μL).
3. On ice, prepare mix 2 with 15 μL per assay well: 5 μL NTP stock (10X), 250 ng
pGL2B-sea DNA, and 0.2 μL [3 H] UTP, and nuclease-free water (to 15 μL). Use
of a plastic assay trough is recommended if more than 20 assay wells are to be
used.
4. Aliquot 25 μL of mix 1 to appropriate test assay wells of a 96-well flat bottom,
white polystyrene plate. Use a multi-channel pipette if pipetting from an enzyme
trough.
5. Add 10 μL of each test compound (pre-diluted as in 1) to the appropriate test wells
and then 15 μL of mix 2 to each assay well. Gently shake the plate by hand and
incubate at 25 ºC for 40 min (see Note 7).
6. Freshly prepare SPA bead binding buffer with 100 μL per assay well: 99.5 μL 166
mM NaCitrate (pH 2.4) plus 0.5 μL YSi RNA binding SPA beads (suspended by
vortex immediately before use).
7. Add 100 μL of SPA bead mixture (from step 6) to each well and seal the plate with
a clear adhesive seal (Packard). Allow the plates to stand undisturbed for at least
30 min (to allow the beads to settle) prior to reading the plates (as below). Note
that plates are stable at room temperature for at least 24 h.
8. Quantify the RNA synthesis products by reading the plate in a microplate scintil-
lation counter (see Note 8). Figure 3a shows enzyme inhibition curves obtained for
rifampin with either E. coli 70 or S. aureus A RNAP holoenzymes. Note that
50% inhibition concentration (IC50 ) values determined for rifampin in this assay
for these enzymes typically fall in the 5–20 nM range and, as such, are consistent
with literature precedents and data from gel-based assays (see below).
SPA Assay Data
120
S. aureus σA Rif-S
100
E. coli σ70 RpoC::His6
% Remaining
80
Activity
60
40
20
0
0.1 1 10 100 1000
Rifampin Concentration
(Log nM)
Gel Assay Data
120
100 S. aureus σA Rif-R

% Remaining
80 S. aureus σA Rif-S
Activity
60 E. coli σ70 (Epicentre)

40
E. coli σ70 RpoC::His6
20
0
0.1 1 10 100 1000
Rifampin Concentration
(Log nM)
Fig. 3. Analysis of data from the SPA and gel format assays. Figure 3a shows
titrations of rifampin in the SPA format assay obtained for reconstituted forms of
the RpoC::oligo-histidine tagged variants of the S. aureus A and E. coli 70 RNA
polymerase holoenzymes. Analysis of the data using Prism version 3.03 (GraphPad
Software Inc.) yielded apparent 50% inhibition concentration (IC50 ) values of 6 and
9 nM for the S. aureus and E. coli enzymes, respectively. Figure 3b shows titrations of
rifampin in the gel format assay obtained for the indicated RNA polymerase holoen-
zymes using the pGL2B-T7A1-Gless template in reactions conducted in the absence
of GTP. Analysis of the data using Prism yielded apparent IC50 values of 5.5, 9.9, and
10.5 nM for the E. coli 70 (RpoC::His6 ), E. coli 70 (Epicentre), and S. aureus A
(rifampin-sensitive, RpoC::His8 ) enzymes, respectively. Also shown is a titration of
rifampin against a rifampin-resistant variant of the S. aureus A RpoC::His8 enzyme that
3.5. Gel-Based Method to Characterize RNA Polymerase Inhibitors

1. Prepare a test compound plate at 10X concentration in a clear 96-well polypropylene
plate (or 8-well PCR strip plates) with rifampin included in a 6- to 12-well titration
covering the final concentration range of 0.25–250 ng/mL.
2. Transcription reactions are generally carried out in 96-well trays in a final volume
of 50 μL. On ice, combine the following per 50 μL assay well: nuclease-free water
(as necessary to achieve a volume of 50 μL), 10 μL of RNAP gel assay buffer (5X),
1.5 μg (E. coli) or 1.5 μg (S. aureus) of freshly re-constituted -saturated RNAP
holoenzyme, 500 ng of pGL2B-T7A1 DNA, 2 μCi of [-32P]-CTP, and 5 μL of
test compounds (or DMSO). The plate is then incubated at 37 °C for 5 min. See
Note 9 regarding the order of addition of reagents, and see Note 10 regarding the
choice of DNA template.
3. Transcription is then initiated by the addition of 5 μL of the appropriate 10X NTP
mix (per 50 μL assay reaction) and the plate incubated at 37 °C for 15 min (E. coli)
or 30 min (S. aureus).
4. Reactions are terminated by the addition of 50 μL of gel loading solution, and the
reaction products maintained on ice until just prior to gel electrophoresis analysis.
For long-term storage, reaction products are stored frozen at −20 °C.
5. Reaction products are heated in a 120 °C sand block for 2 min and then placed
on ice. Five to 30 μL aliquots of each are then loaded and separated on preheated
4% polyacrylamide/urea/TBE denaturing PAGE gels. Dried electrophoresis gels
are exposed to phosphorimager cassettes and analyzed by quantitative phospho-
rimaging. Figure 3b shows enzyme inhibition curves obtained for rifampin with
various E. coli 70 and S. aureus A RNAP holoenzyme preparations. Note that
IC50 values determined for rifampin in this assay for these enzymes typically fall
in the 5–20 nM range and, as such, are consistent with literature precedents.
4. Notes
1. Unless otherwise stated, all solutions and buffers should be prepared using high-
quality de-ionized water that is free (<5 ppm) of organic contaminants. Where
indicated, commercially supplied “RNAse-free” water (Ambion Inc.) is employed.
2. Yttrium silicate (Ysi) RNA binding SPA beads are supplied at 100 mg/mL in
water and are stable at 2–8 °C for at least 6 months if protected from light. Once
opened, the beads should be aliquotted and similarly stored at 2–8 °C and then
used within 2–4 weeks.

Fig. 3. (Continued) bears a Ser464Pro mutation in the canonical rifampin-resistance-
determining region of the RpoB subunit. As expected, and in contrast to the wild-
type rifampin-sensitive enzyme, rifampin has little or no effect on the S. aureus
RpoBSer464Pro , RpoC::His8 enzyme in the concentration range tested.
3. The transcription template (substrate) employed in these assays is a highly purified,

negatively supercoiled preparation of a plasmid that bears the bacteriophage T7A1
promoter upstream of a 272 nucleotide “G-less” cassette element (22); see Fig. 2
for further details. pGL2B-T7A1-Gless was constructed by standard recombinant
DNA (PCR) methods involving combination of a 272 nucleotide “G-less” cassette
derived from p(C2AT)19 (Genbank U83866) with a synthetic T7A1 promoter
element in the pGL2-Basic plasmid (Promega) vector (Q. Du and A. S. Lynch,
unpublished). Under optimal transcription initiation and elongation conditions,
initiation from the T7A1 promoter in the presence of ATP, CTP, and UTP (but no
GTP) yields a single RNA species of 272 nucleotides that can be readily separated
and quantified.
4. The specific activity of this product (as provided by the supplier) needs to be
in range of 1–3 × 103 units/mg wherein one unit catalyzes the incorporation of
one nanomole of ribonucleoside triphosphate into RNA in 10 min at 37 °C in a
standard reaction. Commercial or in-house prepared lots of RNAP holoenzymes
with specific activity of <1 × 103 units/mg are not recommended for use in these
assays.
5. Quantitative scanning densitometry of appropriately stained SDS-PAGE gels can
be used to estimate the relative abundance of individual subunits of recombinant
RNAP enzyme preparations. Thereafter, purified A protein is added to achieve
the desired 5-fold molar (stoichiometric) excess.
6. Core RNAP protein devoid of contaminating Sigma factors is most efficiently
prepared by repeated passage of the recombinant enzyme preparation through a
phosphocellulose column (25), with up to three passages necessary to remove
trace levels of minor subunits.
7. Assay plates can be incubated at higher temperatures if desired. However, appro-
priate controls should be performed to determine the appropriate length of the
assay to ensure that the incorporation of the [3 H] UTP substrate is not saturated.
8. Use of a TopCount NXT microplate scintillation and luminescence counter
(Packard Instruments) is recommended. In tritium CPM mode, a read time of 30 s
per well is routinely sufficient. If the color of test compounds interferes with the
assay read-out, then the appropriate Color Quench protocol from the instrument
supplier should be applied.
9. The order of addition of reagents can be varied to enable the appropriate charac-
terization of inhibitors of different mechanistic classes. For instance, in the charac-
terization of inhibitors of promoter binding and/or initiation, the DNA template
may be omitted from reactions prior to addition of the transcription initiation mix.
10. Negatively supercoiled DNA templates that incorporate a “G-less” cassette element
(see Fig. 2) downstream of a promoter element allow for detailed kinetic studies
of RNAP inhibitors. In these reactions, transcription is undertaken in the absence
of GTP such that elongating RNAP enzymes are paused at the first G residue in
any transcript resulting from the DNA template. As only the engineered G-less
tract yields an RNA product of any significant length, it can be readily separated
by electrophoresis from other short aborted transcripts and quantified. Further,
analysis of the yield of synthesis of the unique (G-less) RNA product formed
by a single round of transcription allows for detailed kinetic studies of RNAP
inhibitors.
Acknowledgments
The authors wish to thank both present and past colleagues at Tularik
Inc. and Cumbre Pharmaceuticals Inc. who have contributed to programs
focused on the identification and characterization of inhibitors of bacterial RNA
polymerases; in particular, Kelly LaMarco, Pengguang Wu, Mohan Sivaraja,
Gary H. Dallmann, Daniel Roche, and Len Duncan.
References
1.
1 Mooney, R. A., Darst, S. A., and Landick, R. (2005) Sigma and RNA polymerase:
An on-again, off-again relationship? Mol. Cell 20, 335–345.
2.
2 Adelman, K., Yuzenkova, J., La Porta, A., Zenkin, N., Lee, J., Lis, J. T.,
Borukhov, S., Wang, M. D., and Severinov, K. (2004) Molecular mechanism of
transcription inhibition by peptide antibiotic Microcin J25. Mol. Cell 14, 753–762.
3.
3 Mukhopadhyay, J., Sineva, E., Knight, J., Levy, R. M., and Ebright, R. H. (2004)
Antibacterial peptide microcin J25 inhibits transcription by binding within and
obstructing the RNA polymerase secondary channel. Mol. Cell 14, 739–751.
4.
4 Campbell, E. A., Korzheva, N., Mustaev, A., Murakami, K., Nair, S., Goldfarb, A.,
and Darst, S. A. (2001) Structural mechanism for rifampicin inhibition of bacterial
RNA polymerase. Cell Microbiol, 104, 901–912.
5.
5 Doundoulakis, T., Xiang, A. X., Lira, R., Agrios, K. A., Webber, S. E., Sisson, W.,
Aust, R. M., Shah, A. M., Showalter, R. E., Appleman, J. R., and Simonsen, K. B.
(2004) Myxopyronin B analogs as inhibitors of RNA polymerase, synthesis and
biological evaluation. Bioorg. Med. Chem. Lett. 14, 5667–5672.
6.
6 Babcock, M. J., Buttner, M. J., Keler, C. H., Clarke, B. R., Morris, R. A.,
Lewis, C. G., and Brawner, M. E. (1997) Characterization of the rpoC gene of
Streptomyces coelicolor A3(2) and its use to develop a simple and rapid method
for the purification of RNA polymerase. Gene 196, 31–42.
7.
7 Tuske, S., Sarafianos, S. G., Wang, X., Hudson, B., Sineva, E., Mukhopadhyay, J.,
Birktoft, J. J., Leroy, O., Ismail, S., Clark, A. D. J., Dharia, C., Napoli, A.,
Laptenko, O., Lee, J., Borukhov, S., Ebright, R. H., and Arnold, E. (2005)
Inhibition of bacterial RNA polymerase by streptolydigin: Stabilization of a
straight-bridge-helix active-center conformation. Cell 122, 541–552.
8.
8 Campbell, E. A., Pavlova, O., Zenkin, N., Leon, F., Irschik, H., Jansen, R.,
Severinov, K., and Darst, S. A. (2005) Structural, functional, and genetic analysis
of sorangicin inhibition of bacterial RNA polymerase. EMBO J. 24, 674–682.
9.
9 Sarubbi, E., Monti, F., Corti, E., Miele, A., and Selva, V. (2004) Mode of action
of the microbial metabolite GE23077, a novel potent and selective inhibitor of
bacterial RNA polymerase. Eur. J. Biochem. 271, 3146–3154.
10.
10 Andre, E., Bastide, L., Michaux-Charachon, S., Gouby, A., Villain-Guillot, P.,
Latouche, J., Bouchet, A., Gualtieri, M., and Leonetti, J. P. (2006) Novel synthetic
molecules targeting the bacterial RNA polymerase assembly. J. Antimicrob.
Chemother. 57, 245–251.
11. Arhin, F., Belanger, O., Ciblat, S., Dehbi, M., Delorme, D., Dietrich, E., Dixit, D.,
11
Lafontaine, Y., Lehoux, D., Liu, J., McKay, G. A., Moeck, G., Reddy, R., Rose, Y.,
Srikumar, R., Tanaka, K. S., Williams, D. M., Gros, P., Pelletier, J. , Parr, T. R. J.,
and Far, A. R. (2006) A new class of small molecule RNA polymerase inhibitors
with activity against Rifampicin-resistant Staphylococcus aureus. Bioorg. Med.
Chem. 14, 5812–5832.
12.
12 Artsimovitch, I., Chu, C., Lynch, A. S., and Landick, R. (2003) A new class
of bacterial RNA polymerase inhibitor affects nucleotide addition. Science 302,
650–654.
13.
13 Darst, S. A. (2004) New inhibitors targeting bacterial RNA polymerase. Trends
Biochem. Sci. 29, 159–160.
14.
14 Lee, M. S., and Morrison, D. A. (1999) Identification of a new regulator in
Streptococcus pneumoniae linking quorum sensing to competence for genetic
transformation. J. Bacteriol. 181, 5004–5016.
15.
15 Qi, Y., and Hulett, F. M. (1998) PhoP-P and RNA polymerase sigmaA holoenzyme
are sufficient for transcription of Pho regulon promoters in Bacillus subtilis:
PhoP-P activator sites within the coding region stimulate transcription in vitro.
Mol. Microbiol. 28, 1187–1197.
16.
16 Gualtieri, M., Villain-Guillot, P., Latouche, J., Leonetti, J. P., and Bastide, L.
(2006) Mutation in the Bacillus subtilis RNA polymerase beta’ subunit confers
resistance to lipiarmycin. Antimicrob. Agents Chemother. 50, 401–402.
17.
17 Garcia-Martinez, L. F., Bilter, G. K., Wu, J., O’Neill, J., Barbosa, M. S., and
Kovelman, R. (2002) In vitro high-throughput screening assay for modulators of
transcription. Anal. Biochem. 301, 103–110.
18.
18 Wu, P., Daniel-Issakani, S., LaMarco, K., and Strulovici, B. (1997) An automated
high throughput filtration assay: Application to polymerase inhibitor identification.
Anal. Biochem. 245, 226–230.
19.
19 Liu, J., Feldman, P. A., Lippy, J. S., Bobkova, E., Kurilla, M. G., and Chung, T. D.
(2001) A scintillation proximity assay for RNA detection. Anal. Biochem. 289,
239–245.
20.
20 Zheng, W., Carroll, S. S., Inglese, J., Graves, R., Howells, L., and Strulovici,
B. (2001) Miniaturization of a hepatitis C virus RNA polymerase assay using a
-102 degrees C cooled CCD camera-based imaging system. Anal. Biochem. 290,
214–220.
21.
21 Liu, J., Feldman, P., and Chung, T. D. (2002) Real-time monitoring in vitro
transcription using molecular beacons. Anal. Biochem. 300, 40–45.
22.
22 Marras, S. A., Gold, B., Kramer, F. R., Smith, I., and Tyagi, S. (2004) Real-time
measurement of in vitro transcription. Nucleic Acids Res. 32, e72.
23.
23 Adhya, S. (1996) RNA polymerase and associated factors: Parts A and B; Methods
in Enzymology 273 & 274, Academic Press, San Diego.
24.
24 Sawadogo, M., and Roeder, R. G. (1985) Factors involved in specific transcription
by human RNA polymerase II: Analysis by a rapid and quantitative in vitro assay.
Proc. Natl. Acad. Sci. USA 82, 4394–4398.
25.
25 Maeda, H., Fujita, N., and Ishihama, A. (2000) Competition among seven
Escherichia coli subunits: Relative binding affinities to the core RNA polymerase
Nucleic Acids Res. 28, 3497–3503.
5
Methods to Assay Inhibitors of tRNA Synthetase Activity
Dieter Beyer, Hein Peter Kroll, and Heike Brötz-Oesterhelt
Summary
Aminoacyl-tRNA synthetases (aa-RS) attracted interest as potential targets for new antibac-
terial compounds. Most organisms express 20 aa-RSs: one for each amino acid. Aa-RSs are
essential proteins in all living organisms. When one aa-RS is inhibited, the corresponding tRNA is
not charged and is therefore unavailable for translation. This leads to protein synthesis inhibition,
which in turn causes cell growth arrest. Consequently, each compound that inhibits any of the
aa-RS could be a potential antibacterial agent. Only one aa-RS inhibitor, the Ile-RS inhibitor
mupirocin, is currently marketed as an antibacterial agent. We focused on phenylalanyl (Phe)-
tRNA synthetase (Phe-RS), but the described methods are not restricted to Phe-RS and might be
adapted to other aa-RS.
Key Words: antibacterial; antibiotic; competitive mechanism of action; aminoacyl-tRNA

synthetases; aa-RS; Phe-RS.
1. Introduction
Protein fractions containing aa-RSs can be isolated from different bacteria,
and inhibition of aa-RS by chemical compounds can be measured in
biochemical experiments. In one of our research programs, compounds were
tested and optimized for inhibition of Phe-RS derived from different Gram-
negative pathogens (Escherichia coli and Haemophilus influenzae) as well
as from Gram-positive pathogens (Staphylococcus aureus and Streptococcus
pneumoniae) (1).
For inhibitors of bacterial aa-RS, which are competitive for the amino acid
binding to their target, difficulties in demonstrating in vitro efficacy on bacteria

53
54 D. Beyer et al.
growing in complex growth media can be overcome by using defined media or

minimal media. Complex cultivation media containing high levels of peptides
and proteins are degraded by bacteria, thus supplying the microorganisms with
high amounts of amino acids that compete for the binding of the inhibitors
to their target. The use of defined media with reduced amounts of pheny-
lalanine (Phe) increases the sensitivity of the inhibitors during determination
of the minimal inhibitory concentration (MIC, concentration needed to inhibit
the growth of the bacteria). Inhibitors acting competitively with Phe reduced
the bacterial growth in a Phe concentration-dependent manner. The effect of
the Phe-RS inhibitors is bacteriostatic, i.e., inhibiting growth as most other
protein biosynthesis inhibitors do. The MIC determination methods described
can be utilized equally well for other aa-RS inhibitors with minimal adaptations,
e.g., by exchange of the amino acid under consideration.
If the binding mode of the aa-RS inhibitor is competitive with the amino
acid, it can also be difficult to demonstrate in vivo efficacy in an animal model,
especially for investigational inhibitors with suboptimal potency. The reason
is that amino acids occur in the blood at considerable concentrations, and they
compete in vivo with the binding of such inhibitors to their targets. Mice that
are fed on a diet that lacks or is reduced in the amino acid of interest may
allow investigation of the in vivo efficacy of such competitive inhibitors with
increased sensitivity. The usefulness of such a model was shown for inhibitors
of Phe-RS during the treatment of an S. aureus sepsis in mice (1). In this case
the inhibitor, which acted competitively with Phe, reduced the bacterial load
in various organs by one to two log units in mice on a phenylalanine-free diet
(Phe blood levels of 15 μM), whereas only marginal effects were observed in
mice on a normal diet (Phe blood levels of 70 μM). The model is described
here on the basis of the Phe-free diet, but this approach will probably work for
other amino acids as well.
2. Materials
2.1. Bacterial Strains
S. aureus 133 (deposited with the number DSM11832 at the Deutsche
Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany),
S. pneumoniae G9A, S. pneumoniae 1707/4, H. influenzae Spain 7, and
Moraxella catarrhalis 489 are clinical isolates (purified and identified according
to standard procedures) from infected clinical patients.
Methods to Assay Inhibitors of tRNA Synthetase Activity 55
2.2. Chemicals
1. Mupirocin was kindly provided by Glaxo-Smith-Kline. All other antibiotics and
chemicals used were obtained from Sigma-Aldrich (best quality available) unless
otherwise indicated (see Note 1).
2.3. Isolation of S-100 and aa-RS Inhibition Studies

2.3.1. Buffers (can be stored at 4°C for up to 4 months):
1. T10 M6 N30 SH4 buffer: 10 mM Tris-HCl, pH 7.5, 6 mM MgCl2 , 30 mM NH4 Cl,
4 mM 2-mercaptoethanol.
2. T10 M6 N30 SH4 PF05 : T10 M6 N30 SH4 + 0.5 mM phenylmethanesulfonyl fluoride.
3. H900 M100 G50 buffer: 900 mM HEPES, pH 7.6 adjusted with KOH, 100 mM MgCl2 ,
50 mM glutathione.
2.3.2. Chemicals
1. Radiolabeled amino acids, e.g., [14 C] Phe or [14 C] Ile (GE Healthcare, England,
product code CFB70 or CFB68, respectively).
2. ATP, solubilized with water to 100 mM.
3. CTP, solubilized with water to 5 mM.
4. tRNAEcoli (Sigma; ribonucleic acid, transfer from E. coli), solubilized with water
to 0.02 A260 /mg.
2.3.3. Further Equipment

1. Glass-fiber 96-well filter plates GF/C and corresponding vacuum filtration apparatus
(Packard).
2. French Press (Sim Aminco SLM Instruments Inc.).
3. Liquid Scintillation Counter (TopCount Microplate Scintillation and Luminescence
Counter).
4. Liquid nitrogen and cold-trap device to shock-freeze 1.5 mL reaction tubes.
2.4. Growth Media for in vitro Bacterial Growth (MIC)

1. The bacterial growth media were prepared by weighing out all ingredients except
the vitamins, mixing and solving them in the appropriate amount of de-ionized
water, and autoclaving them for 15 min at 121 °C. The vitamins were weighed
out and sterilized by filtration (0.22 μm pore size; Millipore). From the vitamin
stock solutions, the appropriate amounts were added to the sterilized medium under
aseptical conditions.
2. Minimal media (medium without Phe or with reduced Phe content). For the culti-
vation of S. pneumoniae, H. influenzae, and M. catarrhalis, C-DEN medium was
used, which is similar to the streptococcal medium described previously (2) lacking
any complex ingredient to adjust the Phe concentration. One liter of C-DEN medium
56 D. Beyer et al.
was prepared with the following ingredients: 6.3 g K2 HPO4 , 0.28 g KH2 PO4 , 1.2 g
sodium acetate, 2.05 g NaCl, 0.22 g MgCl2 , 2.3 mg CaCl2 , 0.014 mg MnSO4 , 1.9 g
glucose, 0.23 g sucrose, 0.25 g pyruvate, 0.09 g alanine, 0.1 g of arginine, 0.05 g of
asparagine, 0.19 g of aspartic acid, 0.04 g of cysteine, 0.57 g of glutamic acid, 0.03
g of glutamine, 0.05 g of glycine, 0.08 g of histidine, 0.2 g of isoleucine, 0.25 g of
leucine, 0.23 g of lysine, 0.08 g of methionine, 0.3 g of proline, 0.15 g of serine,
0.12 g of threonine, 0.04 g of tryptophan, 0.02 g of tyrosine, 0.19 g of valine, 19
mg of adenosine, 19 mg of uridine, 5 mg of choline, 0.02 mg of biotin, 0.6 mg of
nicotinic acid, 0.7 mg of pyridoxine HCl, 2.5 mg of calcium pantothenate, 0.7 mg
of thiamine HCl, and 0.3 mg of riboflavin.
3. For S. pneumoniae, the C-DEN medium was supplemented with 10 g of choline/L
and 20 mg of yeast extract (Becton-Dickinson)/L; for H. influenzae, the medium
was supplemented with 10 g IsoVitale × (Becton-Dickinson)/L and 10 g of hemin
(Oxoid)/L.
4. A simpler minimal medium with the following components (per liter) was used
to cultivate S. aureus and E. coli: 3.3 g Na2 HPO4 , 1 g KH2 PO4 , 1 g NaCl, 0.5 g
NH4 Cl, 0.34 g MgSO4 , 10 g glucose, 1.2 mg nicotinic acid, 0.03 mg of thiamine,
0.003 mg of biotin. All amino acids with the exception of phenylalanine were added
to the minimal medium, resulting in a concentration of 25 μg/mL each.
5. Full-medium (medium with complex ingredients without Phe restriction). Luria
broth medium supplemented with 0.2% (wt/vol) glucose was used for S100 protein
isolation to support optimal bacterial growth.
2.5. Murine Bacterial Infection and Treatment with Aminoacyl-tRNA

Synthetase Inhibitors
1. Female CFW1 mice, HSD::CFW1, 18–20 g (Harlan Winkelmann GmbH, Borchen,
Germany). Animals can be kept under conventional housing conditions. Feed one
group of mice on a diet with reduced Phe content for 5 days prior to infection. A
second group can be kept on a diet with full amino acid supplement for the same
period.
2. Custom-made fodder for rodents, SM M-H 10 mm, reduced in phenylalanine and
tyrosine, order number S 0602-S190 (Ssniff, Soest, Germany); analogous fodder
with full content of all 20 amino acids, SM MZ 10 mm, order number S 0602-S004
(Ssniff, Soest, Germany). (See Notes 2 and 3.) Solution of 10% mucin (mucin
from porcine stomach, Sigma-Aldrich) in phosphate buffered saline pH 7.4 (PBS),
prepared fresh on the day of the experiment (see Notes 4 and 5).
4. Brain-heart-infusion broth (e.g., from Becton-Dickinson), two test tubes with
5 mL each.
5. Agar plates for counting of colony-forming units. Columbia blood agar (e.g., from
Becton-Dickinson) is a suitable growth medium, but other media such as brain-
heart-infusion or Mueller-Hinton work equally well.
6. Phe-RS inhibitor in appropriate solvent (see Note 6).
3. Methods
3.1. Enzymatic aa-tRNA Activity and Enzyme-Inhibition Tests
Protein fraction (S-100), containing soluble proteins including aa-RS, was
isolated according to Nierhaus and Dohme (3). The protocol was initially
optimized for E. coli and subsequently adapted to isolate S-100 fractions from
different bacteria (1).
1. Bacteria were grown in 2 L of appropriate liquid medium (see Note 7) at 37 °C.
Cultures were grown up to an optical density at 578 nm of approximately 0.5 (see
Note 8), cooled to 0 °C in a water/ice bath, and maintained at low temperature for
the whole protein-isolation procedure.
2. Cells were harvested by centrifugation (5,000× g, 7 min, 4 °C), washed three times in
50 mL ice-cold T10 M6 N30 SH4 buffer, and centrifuged again (8,000× g, 10 min, 4 °C).
3. The cell pellet was weighted (wet weight) and resuspended in 1 mL T10 M6 N30 SH4
PF05 buffer per gram of cells.
4. Cells were disrupted by four subsequent French Press Cell passages at 14,000 lb/in.2
(see Note 9).
5. The cell lysate was precipitated by centrifugation (8,000× g, 10 min, 4 °C). The
pellet was discarded and the supernatant was subjected to another centrifugation
(9,000× g, 30 min, 4 °C) followed by a final centrifugation for 18 h at 3,000× g.
6. The supernatant was decanted and dialyzed three times for 1 h against 1 L of
T10 M6 N30 SH4 PF05 at 4 ° C. S-100 enzyme fractions were shock-frozen in liquid
nitrogen in aliquots of 250–500 μL and stored at -80 °C (see Note 10).
3.2. Phe-RS Inhibition Studies
1. Phe-tRNA aminoacylation reaction was performed as follows: 5 μL test compound
(see Note 11), 5 μL [14 C] Phe (approximately 0.05 μCi), up to 10 μL S-100 enzyme
fraction (see Note 12), 15 μL H900 M100 G50 buffer, 5 μL ATP (100 mM), 5 μL CTP,
and 0.1 U of tRNAEcoli (see Note 13) were added in a total volume of 75 μL per aliquot.
2. The reaction was incubated for 20 min at room temperature.
3. The reaction product ([14 C] animoacyl-tRNA) was separated from the [14 C] amino
acid by precipitation with 200 μL of ethanol followed by 30 min of incubation at
4 °C and subsequent filtration through a GF/C 96-well plate.
4. Filter-bound radioactivity was detected with a scintillation counter.
5. IC50 values (concentration at which half of the enzyme activity is inhibited by the
compound) were calculated (see Note 14).
3.3. Antibacterial Activity in vitro

3.3.1. Minimal Inhibitory Concentrations (MIC)
1. Bacterial cultures were grown to the exponential growth phase in an appropriate
medium containing 8.3 mg of Phe/L and then diluted into fresh medium with the
desired Phe concentration.
58 D. Beyer et al.
2. MICs were determined by broth microdilution in the media with the appropriate
additives as indicated above for the different bacterial strains with an inoculum of
105 CFU/mL.
3. After incubation for 18 h at 37 °C, MICs were read as the lowest concentrations of
compounds that prevented visible bacterial growth. Streptococci and Haemophilus
strains were incubated in the presence of 10% CO2 (using a jar GasPak 150®
Systems and CampyPak® Hydrogen + CO2 gas generator envelopes of Beckton-
Dickinson); all other strains were incubated in ambient air.
3.3.2. Time-Kill Studies

The C-DEN medium supplemented with 10 g of choline/L and 20 mg of
yeast extract/L was used to grow S. pneumoniae G9A at 37 °C for 10 to 12 h
in the presence of 10% CO2 . This culture served to inoculate fresh medium
with 3 × 106 CFU (colony-forming units)/mL to which the test compound was
added at different concentrations. The number of CFU in the test compound
treated samples and the untreated controls was monitored once per hour for 6 h
by colony count. The colonies were determined after plating serially diluted
culture aliquots on compound-free Columbia blood agar (Beckton-Dickinson)
and incubating at 37 °C until visible colonies were seen.
3.4. In vivo Potency Determination

1. When the mice arrive from the breeder, randomize them into two groups and provide
one with the Phe-reduced fodder and the second with the conventional fodder. Keep
the animals for five days under conventional housing conditions.
2. On the evening prior to the experiment, inoculate a small volume of brain-heart
infusion broth (e.g., 5 mL in a test tube) with several single colonies of S. aureus
133 and incubate this pre-culture for 16 h at 37 °C and ambient air. On the next
morning, dilute this overnight culture 1:100 with fresh medium and incubate the
culture until the exponential growth phase is reached (approximately 2 h). Adjust
the culture by dilution in PBS to an optical density of 0.1 at 600 nm. Dilute the
culture further until a concentration of 107 colony-forming units per mL is reached.
(The required dilution factor has to be determined in a preceding experiment.)
Dilute the culture further 1:2 with 10% mucin in PBS. Confirm for each experiment
that the culture was adjusted to the correct cell density by plating a culture aliquot
on agar plates.
3. On the day of the experiment, arrange the animals into groups of five. Use five
animals for each concentration of each antibacterial agent under investigation plus
5 animals for an untreated control group (see Note 15).
4. Inject 0.2 mL of the bacterial suspension into the peritoneal cavity of each animal
in the infection groups. This corresponds to an infective dose of 106 colony-forming
units per mouse. Apply the same amount of sterile 0.9% NaCl to the control animals.
5. Apply the intended antibiotic treatment to the infected animals 30 min after infection
(see Note 16).
6. Sacrifice the animals 3 h after infection by placing them into a tank that is flooded
with CO2 .
7. For determination of the viable bacterial load, remove the organs of interest asepti-
cally and homogenize them in a POTTER S homogenizer (B. Braun, Melsungen,
Germany) in 1 mL sterile 0.9% NaCl. Spread the diluted samples on Columbia
blood agar plates and count the colony-forming units after overnight incubation.
For each sample a dilution series is recommended that covers the concentration
range from 109 to 102 .
4. Notes
1. Antibiotics were weighed on an analytical scale dissolved in the appropriate
amount of solvent and filtered through a sterile filter (0.22 μm pore size; Millipore).
2. Not only was the phenylalanine concentration of the fodder reduced. but the
tyrosine concentration was reduced also. Omitting tyrosine was not required for
the experiment but was recommended by the producer (Ssniff, Soest, Germany),
because during their production process both amino acids were usually added to
the fodder preparation as a mixture. Omitting both phenylalanine and tyrosine
facilitated the production process and reduced production costs.
3. While establishing the animal model, we monitored the content of all amino acids
in the mouse plasma on the 5th, 10th, and 15th day after onset of the diet (see
Fig. 1). The phenylalanine concentration had already dropped from 70 μM to
15 μM on the 5th day and was maintained at that level until the 15th day. Animals
were also weighted daily, and their behavior and motility were investigated over
the whole period. No discrepancies were observed between the group on Phe-
reduced diet and the group on normal diet. As a result, the Phe/Tyr-reduced fodder
was fed for five days prior to starting the bacterial infection.
4. When bacteria are applied in 5% mucin, the lethal infective dose for this strain is
two orders of magnitude lower than when the culture is applied in NaCl alone. This
allows the use of a lower infective dose, which makes the model more responsive
to antibiotic therapy and, thus, more sensitive.
5. The bacterial concentration of 106 colony-forming units per mL corresponds to
the lethal infective dose for this bacterial strain, when applied in 5% mucin to
this mouse strain at this age. Without antibiotic treatment, the animals die within
18 h from a systemic infection. If another bacterial strain is used, a different
mouse strain, or mice at a different age, the lethal dose has to be determined in a
preceding experiment.
6. The solvent that is used for application of the test substance should be selected with
care. It should be ensured that the compound is completely dissolved, especially
when intravenous application is intended, and that the solvent is compatible with
60 D. Beyer et al.
1000
800
600
µM
400
200
0
GLY
ALA
LEU
ILE
VAL
SER
THR
ASP
GLU
ASN
GLN
HIS
ARG
ORN
LYS
PHE
TYR
TRP
MET
day 0 day 5 day 10 day 15
Fig. 1. Amino acid concentrations in plasma of mice on Phe/Tyr-reduced diet. Five

animals were analyzed on day 5, 10, and 15 after onset of the diet. Mean values are
indicated. Amino acid analysis was performed according to the method of Liu (4).
animal health. For the Phe-RS inhibitors, the phenyl-thiazolyurea-sulfonamides

(1), 10% DMSO, 30% solutol/ethanol, and 60% PBS were used for intraperitoneal
application.
7. S. aureus 133 were grown in Luria broth supplemented with 0.2% (wt/vol) glucose.
S. pneumoniae G9A and H. influenzae Spain 7 were cultured in C-DEN medium
and incubated in the presence of 10% CO2 .
8. Bacteria have to be grown into the exponential growth phase in which aa-RS
expression is high. Growth to higher optical densities (> 0.8) will lead to growth
into the stationary phase in which significant protease expression is observed, and,
consequently, a less active S-100 protein fraction results.
9. Our experience is that more French Pressure Cell passages and/or higher pressure
will lead to an inactive S-100 fraction.
10. S-100 protein faction has to be shock-frozen to retain its aa-RS activity. Other
freezing methods will result in lower aa-RS activity in subsequent experiments.
11. Test compound might be solubilized in appropriate solvent and subsequently
diluted with water; if DMSO is used, the final concentration of DMSO in the
reaction should not exceed 1.5%.
12. The optimal S-100 amount per reaction has to be determined in a separate exper-
iment; in our experience, 0.3–10 μl of S-100 per reaction were optimal.
13. E. coli tRNA is commercially available. Since aa-RS tRNAs are evolutionarily
conserved, tRNAEcoli was used for all experiments.
14. To determine IC50 values, at least five different test compound concentrations
should be tested in one experiment. In any case, control experiments (similar
experiment without S-100) should be included in the assay, and the corresponding
background radioactivity should be subtracted. Sensitivity of the test system might
be established in experiments with the Ile-RS inhibitor mupirocin; in our experi-
ments, IC50 values of 0.001–0.004 μM were observed for mupirocin.
15. The groups should contain the minimal number of animals required to obtain
statistically significant results. A group size of 5 is sufficient if the antibacterial
treatment leads to at least a 2 log reduction and if the variations between the
individuals within each group are moderate.
16. Use an application route that is appropriate for your compound and the experi-
mental question under investigation. For per os application, sufficient oral bioavail-
ability is required and good solubility of the compound is a prerequisite for
intravenous injection. 0.2 mL is a suitable volume for intraperitoneal and oral
application and 0.1 mL for intravenous and subcutaneous injection.
Acknowledgments
We thank Rainer Endermann (Bayer Healthcare AG) for performing the
animal experiment and Werner Schroeder (Bayer Healthcare AG) for determi-
nation of the amino acid concentration in mouse plasma.
References
1.
1 Beyer, D., Kroll, H. P., Endermann, R., Schiffer, G., Siegel, S., Bauser, M.,
Pohlmann, J., Brands, M., Ziegelbauer, K., Haebich, D., Eymann, C., and
Brotz-Oesterhelt, H. (2004) New class of bacterial phenylalanyl-tRNA synthetase
inhibitors with high potency and broad-spectrum activity. Antimicrob. Agents
Chemother. 48, 525–532.
2.
2 Lacks, S., and Hotchkiss, R. D. (1960). A study of the genetic material determining
an enzyme activity in Pneumococcus. Biochim. Biophys. Acta 39, 508–518.
3.
3 Nierhaus, K. H., and Dohme, F. (1979). Total reconstitution of 50S subunits from
Escherichia coli ribosomes. Methods in Enzymology LIX, 443–449.
4.
4 Liu, H. (2000). Measurement of blood plasma amino acids in ultrafiltrates by high-
performance liquid chromatography with automatic precolumn O-phthaldialdehyde
derivatization. Methods Mol. Biol. 159, 123–140.
6
Three Methods to Assay Inhibitors of Ribosomal

Subunit Assembly
W. Scott Champney
Summary
The inhibition of bacterial ribosomal subunit formation is a novel target for translational
inhibitors. Inhibition of subunit biogenesis has been shown to be equivalent to the inhibition of
protein biosynthesis for many antibiotics. This chapter describes three methods for examining
the inhibition of subunit formation in growing bacterial cells. The first method permits the
determination of the IC50 value for inhibition of assembly and protein synthesis. The second is
a pulse and chase labeling procedure to measure the kinetics of subunit formation. The third
procedure allows an examination of ribosome reformation after antibiotic removal as a part of
the post-antibiotic effect. Together these procedures give a description of the relative inhibitory
effects of an antibiotic on translation and subunit formation.
Key Words: ribosome; assembly inhibition; translation; ribosomal subunits; ribosomal

antibiotics; S. aureus.
1. Introduction
The bacterial ribosome is an important target for antimicrobial agents. A large
number of natural products and their derivatives are known that bind to this
essential structure and prevent some aspect of its function (1). A variety of small
inhibitors target the 30S subunit and affect its role in the initiation of translation.
Another collection of compounds interact with the larger 50S subunit and inhibit
its functions in protein synthesis. A recent comprehensive review of these
inhibitors is included in the book by Bryskier (2). In addition to effects on the
functional activities of ribosomes in translation, many of the known ribosomal

63
64 W. S. Champney
antibiotics have a secondary inhibitory activity. The biogenesis of both 30S

and 50S subunits can be prevented by translational inhibitors (3). Features of
this second target for these antimicrobial agents have been explored, and an
understanding of this process is becoming clearer (4–6). This chapter describes
three important methods for examining the inhibitory effects of ribosomal
antibiotics on subunit formation. The first method examines the antibiotic
concentration-dependent inhibition of cellular growth rates, viability, protein
synthesis, and subunit formation. An IC50 value for each process can be calcu-
lated from the results of a single assay. The second method describes a pulse and
chase labeling procedure to specifically examine the relative rates of subunit
formation in the absence and presence of an inhibitor. In the third procedure, a
method is described to examine the post-antibiotic effects of inhibitor removal.
Recovery of cell viability, protein synthesis capability, and subunit amounts
can be followed in this procedure. Together these three methods permit a
clear description of the relative inhibitory effects of an antibiotic on protein
biosynthesis and subunit formation.
This methodology has been used to examine the effect of various ribosomal
antibiotics on subunit synthesis in Staphylococcus aureus (7–20), Streptococcus
pneumoniae (20–23), Streptococcus pyogenes (23), and Bacillus subtilis (8).
It has also been used to look at the process in the Gram-negative organisms
E. coli (5,24,25) and Haemophilus influenzae (20,26,27). Over 40 antibiotics
affecting translational activities of the 50S subunit have been examined, and
3 aminoglycoside compounds binding to the 30S subunit have also been tested
recently.
2. Materials
1. 3 H-uridine (39.5 Ci/mmol) was from Perkin-Elmer, and Tran-35 S-Label methionine
(1175 Ci/mmol) was from MP Biomedicals.
2. 5X A salts: 52.5 g K2 HPO4 , 22.5 g KH2 PO4 , 5 g (NH4 )2 SO4 , and 2.5 g Na citrate
2H2 O in 1 L of H2 O (28). It is diluted to 1X and sterilized before use.
3. SAS buffer: 10 mM Tris-HCl, pH 8.0, 0.1 mM MgCl2 , 50 mM NH4 Cl, which are
filtered and autoclaved for 10 min.
4. Gradient solutions are made by adding 5 g or 20 g of sucrose to SAS buffer and
brought to 100 mL to give 5% and 20% sucrose solutions.
5. Tryptic soy broth (TSB) and square TSB agar plates containing 1.5% agar.
6. DNase I, 1 mg/ml (Sigma).
7. Bovine serum albumin (BSA), 1 mg/ml (Sigma).
8. 10% trichloroacetic acid (TCA).
9. Uridine, 1 mg/ml.
10. Phenylmethanesulfonyl fluoride (PMSF), 0.1 M in isopropanol, made fresh.
Ribosome Assembly Assays 65
11. Lysostaphin or lysozyme, 1 mg/ml in SAS buffer.

12. Klett-Summerson colorimeter or spectrophotometer set to A600 .
3. Methods
3.1. Four-Part Assay Procedure
The advantage of this methodology is that four measures of the effect of
an antibiotic on cell processes can be determined simultaneously in a single
bacterial culture. The inhibition of the growth rate is followed directly by
using side-arm flasks to look at cell density. The viability measurements are
made by simple serial dilution and plating of six samples on the same agar
plate. Protein synthesis rates are measured by 35 S amino acid incorporation
into acid-precipitable material from the culture. Ribosomal subunit amounts are
measured by sucrose gradient centrifugation of 3 H-uridine-labeled cell lysates
in a buffer designed to allow separation of the 30S and 50S particles. The
relative amounts of radioactivity in each region of the gradient indicate the
effect of the antibiotic on subunit formation. The procedure is designed to use
six cultures at once, a control, and five antibiotic-containing samples over a
range of drug concentrations. An analysis of the data permits the calculation
and comparison of an IC50 value for each process (29).
1. Using a fresh overnight culture, inoculate 125 mL side-arm flasks with 30 mL

Tryptic soy broth to a Klett of about 10 (see Notes 1 and 2). Incubate at 37
°C, shaking at 200 rpm in water bath. Monitor growth with Klett readings every
30 min (see Note 3).
2. At a Klett of 20, divide the total culture to 5 mL per flask and add the antibiotic to
the appropriate final concentration. Stock drug solutions of 1 mg/mL or 10 mg/mL
are usual.
3. At 15 minutes post-drug, add uridine (as carrier) and 3 H-uridine as follows: uridine:
2 μg/mL = 10 μL of 1 mg/mL stock; 3 H-uridine: 1 μCi/mL = 5 μL of 1 mCi/mL
stock. Incubate at 37 °C, 200 rpm, and monitor the growth with Klett readings.
4. After two cell doublings, at a Klett = 80, add 35 S-methionine (Trans label) to
1 μCi/mL.
5. At 5, 10, and 15 min, remove 0.2 mL of the culture to 1.0 mL of 10% TCA.
To each time sample, add 0.1 mL of 1 mg/mL BSA. Collect the precipitate onto
GF/A filters, wash with 2 mL 10% TCA and 95% ethanol, and allow to dry under
a heat lamp. Count each filter in 3 mL Scintisafe cocktail. Figure 1A illustrates a
typical kinetic result.
6. After the third sample, add 0.25 mL uridine (1 mg/mL) to give a final concentration
of 50 μg/mL. Chase 3 H-uridine for 15 min before harvesting the cells.
66 W. S. Champney
15000
A B
100
% Control protein synthesis

35 S-methionine (cpm)
10000
75
50
5000
25
0 0
0 5 10 15 0 0.1 0.2 0.3 0.4 0.5 0.6
Time (min) Linezolid (µg/ml)
C D
100 100
% Control growth rate
% Control cell number
75 75
50 50
25 25
0 0
0 0.1 0.2 0.3 0.4 0.5 0.6 0 0.1 0.2 0.3 0.4 0.5 0.6
Linezolid (µg/ml) Linezolid (µg/ml)
Fig. 1. Protein synthesis rates in S. aureus cells at different concentrations of

linezolid. (A) Cells were labeled with 35 S-methionine in the absence of linezolid ( )
and in the presence of the drug at 0.1 μg/ml ( u ), 0.2 μg/ml ( ), 0.3 μg/ml ( s ), 0.4
μg/ml ( ) and 0.5 μg/ml ( G ). (B) Concentration dependence of linezolid inhibition
of protein synthesis. (C) Effect of linezolid on growth rate. (D) Effect of linezolid on
viable cell numbers. The arrows indicate the IC50 values.
7. Before cell collection, remove 10 μL of cells to 1.0 mL 1X A salts. Vortex well

and repeat dilution to give a 10−4 dilution. Then add 0.1 mL to 0.9 mL A salts
(= 10−5 dilution). Plate 10 μL of each 10−5 dilution in duplicate on square TSB
plates, incubate at 37 °C overnight, and count colonies. (See Note 4.)
8. Collect the remainder of the culture to sterile, labeled, 15 mL conical Falcon tubes.
Add chipped ice to the tube to chill the sample quickly. Centrifuge 10 min at
6000 rpm (4000X g) at 4 °C. Discard the radioactive supernatant. Resuspend the
pellet in 3.0 mL SAS buffer. Centrifuge again for 5 min at 6000 rpm. Discard the
supernatant and store the cell pellet at –70 °C.
9. Resuspend the pellets in 0.2 mL SAS buffer. Add 20 μg lysostaphin (= 20 μL of 1
mg/mL stock) and 15 μL of 0.1 M PMSF in isopropanol. Incubate the samples at
room temperature until lysate becomes viscous and debris is apparent. Freeze and
thaw the samples 3 times at –70 °C, then add 5 μL DNAse I (1 mg/mL). Incubate
at room temperature for 5 min. Pellet cell debris by centrifuging 10 min at 6000
rpm at 4 °C. (See Note 5.)
10. Prepare SAS buffer with 5% and 20% sucrose. Make SW40 gradients with 6
mL 5% sucrose and 6 mL 20% sucrose in SAS buffer. Hold the gradients in
refrigerator until the lysate is prepared.
11. Load the supernatant onto the gradients using a sterile Pasteur pipette. Centrifuge
for 5 hours at 39,000 rpm (200,000X g) at 4 °C. Fractionate each gradient through
an ISCO Model UA-5 density gradient fractionator using 40% sucrose with 0.005%
bromophenol blue as a density lift. The full-scale setting is usually 1.0 with a
chart speed of 60 cm/h. Collect fractions of 6 drops each (36 fractions) into 4 mL
plastic scintillation vials. Add 3 mL Scintisafe gel solution, mix well, and count
for 3 H and 35 S radioactivity (dual label setting). (See Notes 6 and 7.)
3.2. Uridine Pulse and Chase Labeling

This is a classical method for examining the kinetics of ribosome formation
in cells and was used to examine this process in E. coli over 30 years ago
(30). We have looked at subunit synthesis rates in the presence of 50S subunit
inhibitors in S. aureus (17–19), S. pneumoniae (21,22), H. influenzae (26,27,31),
and E. coli (5). We have also examined the inhibition of 30S formation by
paromomycin and neomycin in both E. coli (25) and S. aureus cells (32).
1. Two 12 mL cultures of cells in TSB, one control and one with the antibiotic at the
IC50 concentration are grown to a Klett of 40 at 27 °C (see Note 8).
2. The cells are pulse labeled with 3 H-uridine (1 μCi/mL) for 90 s and are then chased
with uridine at 25 μg/mL.
3. At intervals, 2 mL samples are removed, collected by centrifugation, washed and
stored frozen before lysis for sucrose gradient centrifugation as described above.
3.3. Post-Antibiotic Effect

This procedure has been used to examine the events occurring during the
recovery of cells after removal of an antibiotic (33). Specifically, the rates of
increase in cell viability, protein synthesis, and 50S subunit formation have
been examined in S. aureus after removal of erythromycin and clarithromycin
(13), TAN1057A (18), and linezolid (19).
68 W. S. Champney
1. To examine the post-antibiotic effect, 5 mL of a control and 5 mL of cells treated

with an antibiotic at the IC50 concentration are grown to a Klett of 80.
2. The cells are collected by centrifugation at 6000 rpm (4000X g) for 10 min, washed
with 5 mL TSB at room temperature, and resuspended in 20 mL of TSB. 3 H-uridine
(1 μCi/mL; 2 μg/mL) is added to the culture, and the increase in cell density is
followed with Klett readings.
3. At intervals, 4 mL of cells are removed to a second flask and are labeled with 35 S-
methionine (1 μCi/mL) for 10 min to measure protein synthesis rates. Two samples
of 0.2 mL are removed at this time to 1 mL of 10% TCA. A 10 μL sample is also
removed for viable count determination by serial dilution. A 10 min chase with 200
μg/mL of uridine is carried out before the cells are collected by centrifugation and
then washed and stored frozen for ribosomal subunit analysis.
4. Notes
1. Instead of an overnight culture, growth can be initiated from freezer stocks of cells
kept at –70 °C in 12% glycerol.
2. Tryptic soy broth is the best overall growth media to use because of its ability
to support the growth of most bacterial species and its relatively low amino acid
and nucleoside content. Other richer media have more of these metabolites and
will significantly reduce the incorporation of 3 H-uridine and 35 S-methionine. For
the growth of Haemophilus, TSB was supplemented with NAD and hemin at
10 μg/mL. The growth of Streptococci was improved by the addition of bovine
lipoprotein to 0.7%.
3. Side-arm flasks are convenient for following the growth of Staphylococcus,
Haemophilus, and E. coli strains using a Klett-Summerson colorimeter with a red
filter. Streptococci were grown without shaking in a 37 °C incubator in 13X 100
mm screw cap tubes containing 9 mL of TSB. These tubes can also be read in the
Klett colorimeter after mixing the settled cells.
4. It is convenient and efficient to use the method of Jett et al. (34) for plating
cells. One square TSB plate will hold six diluted samples, and two plates allow
duplicates to be made. Accurate colony counts can be made by this method. Serial
dilution of the cells in A salts permits samples to be stored overnight at 4 °C
without growth. Replating of these dilutions can then be performed if desired.
5. Lysis was always accomplished with enzymes and a threefold freeze thaw
procedure. Lysostaphin was used with S. aureus, and lysozyme at 50 μg/mL was
used for the other organisms. With small volumes of radioactive samples, this was
the safest and gentlest method to use. Lysis can be facilitated with the addition of
Triton-X 100 to 0.1% if desired. PMSF is important to prevent protease activity in
the Staph. lysis procedure.
6. Centrifugation can also be performed at 18,000 rpm (45,000X g) for 18 h overnight.
A Beckman SW 41 rotor can also be employed. Fractionation through the ISCO
monitor is not critical, but it allows a printed record of the quality and quantity of
the material in the gradient to be kept. It is important to use a scintillation counter
set for dual label samples so that the 3 H activity from uridine in RNA and the 35 S
activity from protein labels can be distinguished.
7. In the four-part assay, data analysis is performed to measure the IC50 value over
the range of antibiotic concentrations used. For the growth rates, cell counts, and
protein synthesis, this is simply a comparison of the inhibited value relative to
the control set as 100%. Figures 1B–D illustrate typical results obtained with the
oxazolidinone antibiotic linezolid. For the sucrose gradient samples, the areas of
200000 100000
A 50S B
150000 75000
H-Uridine (cpm)
H-Uridine (cpm)
30S
100000 50000
3
50000 25000
0 0
0 10 20 30 40 0 10 20 30 40
Fraction number Fraction number
40 60
C D
50
% Total Gradient CPM
% Total Gradient CPM
30
40
20 30
20
10
10
0 0
0 0.1 0.2 0.3 0.4 0.5 0.6 0 0.1 0.2 0.3 0.4 0.5 0.6
Linezolid (µg/ml) Linezolid (µg/ml)
Fig. 2. Sucrose gradient profiles of cells labeled with 3 H-uridine with and without
linezolid. (A) Gradient profile of cells grown and labeled without linezolid. (B) Gradient
profile of cells grown and labeled with linezolid at 0.5 μg/ml. (C) Concentration depen-
dence of linezolid effects on 50S amounts ( O ) and 30S amounts ( ). (D) Relative
percentage of total gradient cpm in 50S subunit region ( O ) and the top gradient
fractions (1-10) ( s ) as a function of linezolid concentration. Results are the mean
of duplicate experiments. The arrow indicates the IC50 value. From (19) with kind
permission of Springer Science and Business Media.
70 W. S. Champney
the top, the 30S and 50S regions, are summed and expressed as a percentage
of the total cpm in the gradient. The total radioactivity in the gradient will be
diminished with increasing antibiotic inhibition of growth, representing a good
way to normalize the data. Figures 2A–D are illustrations.
8. The cultures for the pulse-chase analysis are grown at 27 °C in order to slow down
the rate of subunit assembly, which is proportional to the growth rate (35). Typical
results are shown in Fig. 3A–D.
30000 5000
A B
25000
50S 4000
H -uridine (cpm)
H -uridine (cpm)
20000
3000
30S
15000
2000
10000
3
5000 1000
0 0
0 10 20 30 40 0 10 20 30 40
Fraction number Fraction number
30 30
C D
% Total gradient cpm
% Total gradient cpm
20 20
10 10
0 0
0 10 20 30 0 10 20 30
Time (min) Time (min)
Fig. 3. Pulse and chase labeling kinetics of 30S and 50S subunit formation in cells
grown with and without linezolid. (A) Gradient profile of cells grown and labeled
without linezolid after 5 min ( O ) and 30 min ( ) of a chase. (B) Gradient profile
of cells grown and labeled with linezolid at 0.5 μg/ml after 5 min ( O ) and 30 min
( ) of a chase. (C) Relative rates of 50S ( O ) and 30S ( ) subunit synthesis in
cells growing without linezolid. (D) Relative rates of 50S ( O ) and 30S ( ) subunit
synthesis in cells growing with linezolid at 0.5 μg/ml.
Acknowledgments
I appreciate the technical assistance of Mindy Miller and Craig Tober for
their help in developing these methods.
References
1.
1 Vazquez, D. (1979) Inhibitors of Protein Biosynthesis. Springer-Verlag, Berlin.
2.
2 Bryskier, A. (2005) Antimicrobial Agents. Antibacterials and Antifungals.
American Society for Microbiology, Washington, DC.
3.
3 Champney, W. S. (2003) Bacterial ribosomal subunit assembly is an antibiotic
target. Curr. Top. Medicinal Chem. 3, 929–947.
4.
4 Champney, W. S., Chittum, H., and Tober, C. L. (2003) A 50S ribosomal subunit
precursor particle is a substrate for the ermC methyltransferase in Staphylococcus
aureus cells. Curr. Microbiol. 46, 453–460.
5.
5 Usary, J., and Champney, W. S. (2001) Erythromycin inhibition of 50S ribosomal
subunit formation in Escherichia coli cells. Molec. Microbiol. 40, 951–962.
6.
6 Silvers, J. A., and Champney, W. S. (2005) Turnover and degradation of 23S
ribosomal RNA in azithromycin-inhibited ribonuclease mutants of Escherichia
coli. Arch. Microbiol. 187, 66–77.
7. Champney, W. S., and Burdine, R. (1996) 50S Ribosomal subunit synthesis and
7
translation are equivalent targets for erythromycin inhibition in Staphylococcus
aureus. Antimicrob. Agents Chemother. 40, 1301–1303.
8.
8 Champney, W. S., and Burdine, R. (1995) Macrolide antibiotics inhibit 50S
ribosomal subunit assembly in Bacillus subtilis and Staphylococcus aureus.
9.
9 Champney, W. S., Tober, C. L., and Burdine, R. (1998) A comparison of the
inhibition of translation and 50S ribosomal subunit formation in Staphylococcus
aureus cells by nine different macrolide antibiotics. Curr. Microbiol. 37, 412–417.
10.
10 Champney, W. S., and Burdine, R. (1998) Azithromycin and clarithromycin
inhibition of 50S ribosomal subunit formation in Staphylococcus aureus cells.
Curr. Microbiol. 36, 119–123.
11.
11 Champney, W. S., and Burdine, R. (1998) Macrolide antibiotic inhibition of trans-
lation and 50S ribosomal subunit assembly in methicillin-resistant Staphylococcus
aureus cells. Microbial Drug Resistance 4, 169–174.
12. Champney, W. S., and Tober, C. L. (1998) Inhibition of translation and 50S
12
ribosomal subunit formation in Staphylococcus aureus cells by eleven different
ketolide antibiotics. Curr. Microbiol. 37, 418–425.
13.
13 Champney, W. S., and Tober, C. L. (1998) A molecular investigation of the post-
antibiotic effect of clarithromycin and erythromycin on Staphylococcus aureus
cells. Antimicrob. Agents Chemother. 43, 1324–1328.
72 W. S. Champney
14.
14 Champney, W. S. (1999) Macrolide antibiotic inhibition of 50S ribosomal subunit
formation in bacterial cells. Recent Res. Devel. Antimicrob. Agents Chemother. 3,
39–58.
15.
15 Champney, W. S., and Tober, C. L. (1999) Superiority of 11,12 carbonate
macrolide antibiotics as inhibitors of translation and 50S subunit formation in
Staphylococcus aureus cells. Curr. Microbiol. 38, 342–348.
16.
16 Champney, W. S., and Tober, C. L. (2000) Specific inhibition of 50S ribosomal
subunit formation in Staphylococcus aureus cells by 16-membered macrolide,
lincosamide and streptogramin B antibiotics. Curr. Microbiol. 41, 126–135.
17.
17 Champney, W. S., and Tober, C. L. (2000) Evernimicin (SCH27899) inhibits both
translation and 50S ribosomal subunit formation in Staphylococcus aureus cells.
18.
18 Champney, W. S., Pelt, J., and Tober, C. L. (2001) TAN-1057A: A translational
inhibitor of 50S ribosomal subunit activity and formation. Curr. Microbiol. 43,
340–345.
19.
19 Champney, W. S., and Miller, M. (2002) Linezolid is a specific inhibitor of 50S
ribosomal subunit formation in Staphylococcus aureus cells. Curr. Microbiol. 44,
350–356.
20.
20 Mabe, S., and Champney, W. S. (2005) A comparison of a new oral
streptogramin XRP2868 with quniupristin-dalfopristin against antibiotic-resistant
Haemophilus influenzae, Staphylococcus aureus, and Streptococcus pmeumoniae.
21.
21 Champney, W. S., and Pelt, J. (2002) The ketolide antibiotic ABT773 is an
inhibitor of protein synthesis and 50S ribosomal subunit formation in Streptococcus
pneumoniae cells. Curr. Microbiol. 45, 155–160.
22.
22 Champney, W. S., and Pelt, J. (2002) Telithromycin inhibition of protein synthesis
and 50S ribosomal subunit formation in Streptococcus pneumoniae cells. Curr.
Microbiol. 45, 328–333.
23.
23 Champney, W. S., Mentens, N., and Zurawick, K. (2004) An examination
of the differential sensitivity to ketolide antibiotics in ermB strains of
Streptococcus pneumoniae and Streptococcus pyogenes. Curr. Microbiol. 49,
239–247.
24.
24 Chittum, H. S., and Champney, W. S. (1995) Erythromycin inhibits the assembly
of the large ribosomal subunit in growing Escherichia coli cells. Curr. Microbiol.
30, 273–279.
25.
25 Mehta, R., and Champney, W. S. (2002) 30S ribosomal subunit assembly is a
target for inhibition by aminoglycosides in Escherichia coli. Antimicrob. Agents
Chemother. 46, 1546–1549.
26.
26 Champney, W. S., and Miller, M. (2002) Inhibition of 50S ribosomal subunit
assembly in Haemophilus influenzae cells by azithromycin and erythromycin.
27.
27 Champney, W. S., and Tober, C. L. (2003) Preferential inhibition of protein
synthesis by ketolide antibiotics in Haemophilus influenzae cells. Curr. Microbiol.
46, 103–108.
28.
28 Miller, J. H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY.
29.
29 Champney, W. S. (2001) Bacterial ribosomal subunit synthesis: A novel antibiotic
target. Curr. Drug Targets—Infectious Disorders 1, 19–36.
30.
30 Schlessinger, D. (1974) in Ribosomes (M. Nomura, A. Tissieres, and P. Lengyel,
eds.), Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 393–416.
31.
31 Mabe, S., Eller, J., and Champney, W. S. (2004) Structure-activity relationships
for three macrolide antibiotics in Haemophilus influenzae. Curr. Microbiol. 49,
248–254.
32.
32 Mehta, R., and Champney, W. S. (2003) Neomycin and paromomycin inhibit
30S ribosomal subunit assembly in Staphylococcus aureus. Curr. Microbiol. 43,
237–243.
33.
33 MacKenzie, F. M., and Gould, I. M. (1993) The post-antibiotic effect. J.
Antimicrob. Chemother. 32, 519–537.
34.
34 Jett, B. D., Hatter, K. L., Huycke, M., and Gilmore, M. S. (1997) Simplified agar
plate method for quantifying viable bacteria. BioTechniques 23, 648–650.
35.
35 Michaels, G. A. (1972) Ribosome maturation of Escherichia coli growing at
different growth rates. J. Bacteriol. 107, 385–387.
7
Inhibition of Chaperone-Dependent Bacterial

Ribosome Biogenesis
Abdalla Al Refaii and Jean-Hervé Alix
Summary
In Escherichia coli, the molecular chaperone HSP70 (DnaK) is necessary for 30S and 50S
ribosomal subunit assembly at temperatures above 37 °C. Inhibitors of DnaK should therefore
hinder ribosome biogenesis, in addition to all of the other DnaK-dependent cellular functions.
An easily testable phenotype of DnaK is described here based on -complementation of -
galactosidase. This protein fragment complementation requires a functional DnaK in vivo,
offering a suitable method for screening for DnaK inhibitors. Subsequently, it will be of great
importance to check whether inhibitors of bacterial DnaK selected in this way have an effect
(inhibitory or stimulatory) on the activities of eukaryotic HSP70 and HSC70 chaperones, because
of the universal conservation in all biota of these chaperones in both their structural and functional
properties. This question is important due to their implication in many pathways in immunology,
cancer biology, and neurodegenerative disorders.
Key Words: E.coli; chaperone; DnaK; HSP70; ribosome; ribosomal subunit assembly;
biogenesis; -complementation; -galactosidase.
1. Introduction
Extra-ribosomal factors are likely to be involved in the biogenesis of
bacterial ribosomal subunits (1,2). The E. coli chaperones DnaK/DnaJ/GrpE
(3,4) and GroEL/GroES (5) are candidates for such a function, because authentic
precursors (21S, 32S, and 45S particles) to ribosomal subunits (30S and 50S)
accumulate in an E. coli thermosensitive dnaK756-ts mutant at 44 °C (6). A
defective DnaK system (dnaK null mutant) does not affect ribosome assembly
at 30 °C, but seriously disturbs assembly at temperatures above 37 °C (5).

75
76 A. A. Refaii and J.-H. Alix
Ribosome biogenesis is therefore a thermosensitive process in the absence of

DnaK, and DnaK, although not absolutely necessary for ribosome biogenesis,
facilitates or accelerates considerably the late steps of this process (21S —>
30S and 32S —> 45S —> 50S) at high temperature. Compounds inhibiting
DnaK are therefore expected to hinder ribosome biogenesis at temperatures
above 37 °C.
Among a myriad of other functions (7), DnaK is also implicated in the
assembly and disassembly of protein and nucleoprotein complexes, and it was
therefore tempting to check whether DnaK also plays a role in the in vivo
-complementation of -galactosidase. This is an example of protein fragment
complementation in which two segments of a protein associate noncovalently
to form a functional structure. This was indeed the case (8), and the observation
of a role, either direct or indirect, for DnaK in -complementation provides an
easy and original phenotype (measurement of - complemented -galactosidase
activity) to detect functional changes in DnaK, and therefore to screen routinely
for compounds altering its activity.
Surprisingly, this target has been exploited very little until now, perhaps
because of lack of an easy assay to monitor in vivo the biological activity of
DnaK. This tool now exists. We reasoned that DnaK, which catalyzes specific
inter- and intramolecular protein interactions, should therefore participate in
the -complementation of -galactosidase, a paradigm for the formation of
a quaternary structure. Indeed, we have shown, by comparison between a
dnaK+ and a dnaK756-ts mutant of E. coli, that functional DnaK is necessary for
an enzymatically active -complemented ß-galactosidase (8). This novel and
easy phenotype (blue versus colorless bacterial colonies on X-Gal-containing
LB plates) and a measure of ß-galactosidase activity in bacterial crude extracts
therefore offer a reliable and routine tool to monitor the activity of DnaK in vivo
and to screen for potential inhibitors.
2. Materials
2.1. E. coli Strains and Growth Media
1. Ribosome assembly defects are generally exacerbated in E. coli strains devoid of
stringent control (relaxed phenotype), and therefore any dnaK+ , relA strain such
as AL26 (relA251: :kanR ) (4) or MC4100(relA1) (5) is suitable for studying the
pattern of labeled ribosomal particles by sedimentation analysis.
2. Strains harboring either a mutant dnaK allele (AL19 = AL26dnaK756-ts) (3) or
a dnaK null allele (BB1553 = MC4100dnaK52: :cmR , sidB1 (5)) (see Note 1)
can be used as control strains exhibiting typical ribosome assembly defects when
Chaperones and Ribosome Biogenesis 77
bacteria are radiolabeled at the non-permissive temperature (43 °C for AL19 ; 38

°C or more for BB1553 (see Note 2)).
3. Both minimal medium A (10), supplemented with 0.2% glucose, 1μg/mL thiamine,
and 0.2% casaminoacids, and MOPS medium (11) can be used for labeling bacteria
with [ 3 H]-uridine in liquid cultures.
4. To assay DnaK-dependent - complementation of -galactosidase, any dnaK+ ,
lacZM15 strain such as JM83 (12), DH5, NM522, or TR14 (8) transformed by
any plasmid encoding the LacZ-peptide such as pUC18/19 or pWSK129 (13) can
be used. Strains harboring either a mutant dnaK allele (TR20 = TR14dnaK756-ts)
(8) or a dnaK null allele (JM83 = JM83dnaK52: :cmR ) (8) transformed by any
plasmid encoding the LacZ-peptide listed above ( pUC18, pWSK129) can be used
as control strains. These are typically unable to sustain -complementation when
grown at 30 °C (in the case of JM83 ; see Note 3), or at the semi-permissive
temperature of 37 °C to 40 °C (in the case of TR20; see Note 4).
2.2. Labeling of Bacteria with [3 H]-Uridine

The [ 5-3 H]-uridine from Amersham (TRK178, 1 mCi/mL) of high specific
activity (26 Ci/mmol) is isotopically diluted with non-radioactive uridine
(Sigma, U-3750), to be added to the culture at a final concentration of 3 μM
and1 μCi/mL. Incubation of bacteria is continued for 1 h (see Note 5).
2.3. Sedimentation of Ribosomal Subunits and Precursor Particles

by Sucrose Gradient Centrifugation
1. Alumina (Alcoa, A305) is used to grind bacteria, and the bacterial crude extract is
prepared in TMNSH buffer: 10mM Tris-HCl, pH 7.4, 10 mM magnesium acetate,
60 mM ammonium chloride, 1 mM dithiothreitol.
2. A stock solution of 50% (w/w) sucrose is prepared by adding 1 kg sucrose to 1 L
of de-ionized water and is autoclaved for 20 min at 110 °C (not more, to avoid
carbonizing the sucrose). Linear sucrose gradients are made from 10% and 30%
sucrose solutions prepared either in TMNSH buffer (for sedimentation of ribosomes
in association conditions) or in TMNSH buffer containing 400 mM NaCl (for
sedimentation of ribosomes in dissociation conditions).
3. Ultracentrifugation is performed in an SW28 rotor (Beckman), which can take six
35 mL sucrose gradients or in an SW41 rotor (Beckman) with six 11 mL sucrose
gradients.
4. After centrifugation, sucrose gradients are collected in about 30 fractions by
aspirating from the bottom of the gradient with a peristaltic pump. Optical density
(A260 ) is measured first, and then the radioactivity contained in each fraction is
measured by precipitating the whole fraction with 5% trichloracetic acid, collecting
the acid-insoluble radioactivity on Millipore filters, and counting the [3 H] c.p.m.
by liquid scintillation counting.
2.4. -galactosidase Activity

1. LB plates (Luria-Bertani medium solidified with 1.5% agar) containing 100 μg/mL
X-Gal, the appropriate antibiotic depending on the resident plasmid (100 μg/mL
ampicillin or 25 μg/mL kanamycin), and IPTG at various concentrations (from 0 to
1 mM).
2. X-Gal at 20 mg/mL in dimethyl formamide.
3. Z buffer: 60mM Na2 HPO4 , 40mM NaH2 PO4 , 10mM KCl, 1mM MgSO4 , 50 mM
-mercaptoethanol.
4. Toluene (or chloroform and 0.1% SDS).
5. Ortho-nitrophenyl--galactoside (ONPG), a 4 mg/mL solution in 100 mM potassium
phosphate buffer, pH 7.
6. 1 M Na2 CO3 solution.
3. Methods
3.1. Analysis of the Ribosome Assembly Pattern
1. To label ribosomes synthesized by the strain under study (wild-type or mutant dnaK,
with a resident plasmid or not), liquid cultures (50 mL to 200 mL) are inoculated
with 0.01 volume of an overnight preculture grown in the same medium at 30 °C.
2. Incubation at 30 °C in a shaking water bath is continued for 3 to 5 h, and the
A600 /mL of the culture is measured each hour.
3. For labeling at 30°C, [3 H]-uridine is added to the culture at an A600 /mL between
0.3 and 0.6, and incubation is continued for 1 h.
4. For labeling at a non-permissive temperature, the culture is transferred to a second
water bath set up at the required temperature, and shaken for 1.5 h (see Note 6)
before adding the labeled uridine as above. Incubation is then continued for 1 h.
5. 1 mL of bacterial samples are withdrawn and acid-insoluble radioactivity is
measured, to estimate the amount of tritated uridine incorporated into RNA.
Labeling at 43 °C generally results in 105 to 106 [3 H] c.p.m. incorporated in the
culture, about 2–3-fold less than that obtained at 30 °C.
6. Aliquots of the culture and of the overnight culture are also streaked on plates to
verify the expected phenotypes of the strain under study, like antibiotic resistance
or thermosensitivity.
7. Bacteria are collected by centrifugation, washed with TMNSH buffer, and the
bacterial pellets (usually 50 to 200 mg) are kept frozen at –20 °C in 15 mL Corex
tubes.
8. Bacterial crude extracts are prepared by grinding bacteria in the Corex tubes
with a glass rod in the presence of twice their weight of alumina. They are
resuspended in 1 to 2 mL of TMNSH buffer, then centrifuged at 10,000 rpm
(12,000X g) for 20 min in a Sorvall centrifuge at 3 °C to pellet the alumina,
unbroken cells, and cell debris. The supernatants are immediately layered on sucrose
gradients.
3.2. Sucrose Gradient Centrifugation

1. Crude extracts (about 105 [3 H] c.p.m.) are mixed at 4 °C with 2 A260 units each
of non-radioactive wild-type E. coli 50S and 30S ribosomal subunits and layered
onto 11 mL 10% to 30% linear sucrose gradients prepared in TMNSH buffer. The
gradients are centrifuged at 3 °C in a Beckman SW41 rotor for 16 h at 26,000 rpm
(110,000X g) for analysis under ribosome association conditions.
2. For analysis under ribosome dissociation conditions, samples prepared as above
are adjusted to 400 mM NaCl and layered onto 35 mL 10% to 30% linear sucrose
gradients prepared in 400 mM NaCl-containing TMNSH buffer, and centrifuged at
3 °C in a Beckman SW28 rotor for 17 h at 27,000 rpm (110,000X g). Each gradient
is then collected in about 30 fractions whose optical density (A260 /mL) and [3 H]
radioactivity are measured, as described in Section 2. A typical result is shown in
Fig. 1.
Fig. 1. Sedimentation profiles of ribosomes and their subunits prepared from strains
AL26 (dnaK+ ) (A and B) , and AL19 (dnaK756-ts) (C and D) labeled with [3 H]-uridine
at 43°C. Ionic conditions in sucrose gradients promote either association of ribosomal
subunits (A and C) or their dissociation (B and D). Sedimentation is from right to left.
A260 /mL, open circles. [3 H] c.p.m, closed circles. (Taken from (4), with kind permission
of Springer Science and Business Media.)
3.3. -galactosidase Activity

1. The -galactosidase activity can be estimated (from the blue vs. colorless phenotype of
the bacterial colonies) by streaking strains on LB plates containing 100 μg/mL X-Gal,
the appropriate antibiotic depending on the resident plasmid (100 μg/mL ampicillin
or 25 μg/mL kanamycin), and IPTG at various concentrations (from 0 to 1 mM).
2. -galactosidase-specific activities of bacteria grown in liquid cultures (in LB
medium) are measured and expressed in Miller units following standard proce-
dures (10). -galactosidase activity can be measured after lysis of 1 mL samples of
bacteria kept on ice by the addition of one drop of toluene or chloroform and 0.1%
SDS. -galactosidase activity can also be measured the following day if desired.
3. Liquid cultures in LB medium or in minimal medium containing 0 to1 mM IPTG are
inoculated at low cell density by a 1/200 or 1/500 dilution of an overnight preculture
in the same medium. Bacterial growth is followed by measuring the A600 /mL, and
several bacterial samples (four or five) are withdrawn between 0.25 (exponential
growth) and 1.5 (stationary phase). The aliquots of the cultures are added to the
assay medium, ice-cold Z buffer in 5 mL glass tubes to give a final volume of 1
mL. If high levels of -galactosidase are expected, add 0.1 mL of culture to 0.9 mL
of Z buffer. In case of low levels, add 0.5 mL of culture to 0.5 mL of Z buffer.
4. Samples are kept on ice and bacteria are permeabilized by vortexing with one drop
of toluene (or one drop of chloroform and one drop of 0.1% SDS). -galactosidase
activity can be measured the following day; in this case, samples are kept overnight
in the cold (to allow toluene to evaporate).
5. Tubes are placed in a water bath at 28 °C for 5 min, and the reaction is started
(record the time) by adding 0.2 mL ortho-nitrophenyl--galactoside (ONPG). When
sufficient yellow color has developed, the reaction is stopped by adding 0.5 mL of
a 1 M Na2 CO3 solution (record the time again).
6. Transfer samples to Eppendorf tubes and spin down the cell debris in a small
centrifuge for 2 min at maximal speed.
7. Transfer supernatants to 1 cm pathlength cuvettes and record the optical density
at 420 nm. The A420 /mL should be ideally between 0.2 and 1.The -galactosidase-
specific activity is expressed per A600 /mL unit of the bacterial culture, i.e., in Miller
units (10), as follows = 1000 × A420 /mL/t × v × A600 /mL, where t is the time of
the reaction in minutes, and v the volume of culture used in the assay in mL. In
general, -galactosidase-specific activity should be constant during the exponential
growth phase of the bacterial culture.
3.4. Screening for Antibacterial Compounds Targeting DnaK

1. An E. coli strain designed for a routine protocol (TR14, for example) is dnaK+ and
harbors a chromosomal copy of the lacZM15 allele, which carries a partial deletion
that does not disturb the open reading frame. This lacZM15 gene product (called
the fragment) lacks amino acid residues 11 through 41 and forms an inactive
dimer (wild-type ß-galactosidase is a homotetramer). This strain is transformed by a

plasmid encoding the 7500 dalton -fragment of the ß-galactosidase. In the presence
of the -fragment, the - fragment reconstitutes a homotetramer with enzymatic
activity. This activity is easily monitored with the two chromogenic substrates of
the ß-galactosidase, X-Gal (producing blue colonies) and ONPG (hydrolyzed to the
yellow-colored orthonitrophenol by bacterial crude extracts).
2. In a typical routine assay, the TR14 strain is grown at 37 °C in LB medium in
the presence of the appropriate antibiotics (depending on the plasmid; see Note 7)
and 100 μM IPTG, the lactose operon inducer (see Note 8). Compounds to be
assayed are introduced at the final concentration of 100 μg/mL in a first attempt.
When bacteria reach the stationary phase, cell growth (A600 /mL) and ß-galactosidase
activity (A420 /mL of crude cell extracts after hydrolysis of ONPG) are measured.
3. The assay can be miniaturized to be installed on a Beckman Biomec 2000 robot
allowing the use of 96-well plates for screening. Each set of experiments should
include the control strain TR20pUC18 or TR20pWKS129 harboring the dnaK756-ts
allele, which abolishes the -complementation of the ß-galactosidase at 37 °C (but
not at 30 °C; see Fig. 2).
Fig. 2. -Complementation of -galactosidase in dnaK756 (Ts) and dnaK+ strains

plated at 30 °C and 37 °C. Strains TR14 (dnaK+ ) pUC18 and TR20 [dnaK756(Ts)]
pUC18 were streaked on two LB plates containing 100 μg of X-Gal per mL, 1 mM
IPTG, and 100 μg of ampicillin per mL and incubated for 48 h at 30 °C or 37 °C.
pUC18 is a high-copy-number plasmid with a ColE1 replication origin, expressing
a LacZ -peptide and resistance to ampicillin. (Taken from (8), with permission of
American Society for Microbiology.)
4. Compounds with a positive signal can be studied over a wide range of

concentrations, to determine their minimal inhibitory concentration (M.I.C.) for
-galactosidase activity. They can also be checked to see whether a plasmid-driven
overexpression of DnaK (for example, plasmid pKP31; see Fig. 3) reverses the
inhibitory effects of these compounds. In order to confirm a specific inhibition of
DnaK and not of the ß-galactosidase itself, positive compounds can be tested against
an IPTG-induced wild-type lacZ+ strain where no inhibition is expected. Finally,
they can be tested in other microbiological assays that necessitate a functional
DnaK, but are unrelated to the -complementation of the ß-galactosidase, such as
the lytic multiplication of bacteriophage , the shut-off of the heat-shock response
(7), or the DnaK-dependent ribosome assembly.
5. An obvious limitation of the methodology described here is the selective perme-
ability barrier of the outer membrane of E. coli toward many compounds (large
peptides, for example). To circumvent this problem, the -complementation system
Fig. 3. DnaK-dependent -complementation of -galactosidase. Strains TR14

(dnaK+ ) [pWSK129 pBR322], TR14 (dnaK+ ) [pWSK129 pKP31], TR20
[dnaK756(Ts)][pWSK129 pBR322], and TR20 [dnaK756(Ts)][pWSK129 pKP31] were
streaked on two LB plates containing X-Gal, IPTG, ampicillin, and 25 μg/mL of
kanamycin, which were incubated for 48 h at 30 or 37 °C. pWSK129 is a low-
copy-number plasmid with a pSC101 replication origin, expressing a LacZ -peptide
and resistance to kanamycin. Plasmid pKP31 (ColE1 replication origin, resistance to
ampicillin), which overexpresses dnaK+ , is compatible with pWSK129. pBR322 is the
empty vector corresponding to pKP31. (Taken from (8), with permission of American
Society for Microbiology.)
can be transferred into other E. coli strains (14,15) permeable to a variety of

hydrophobic and high-molecular-weight substances (up to 5000 daltons). The -
complementation system can also be set up in naturally more permeable cells, such
as Gram-positive eubacteria , mycoplasma, or S. cerevisiae (16).
6. Selected compounds can finally be checked in vitro, in well-defined biochemical
assays of purified DnaK (ATPase activity or re-naturation of denatured luciferase,
for example). In parallel, the activities of the eucaryotic HSP70 and HSC70 in the
presence of these compounds can also be tested. As potential antibacterial molecules,
these inhibitors should be more active on bacterial DnaK than on the eukaryotic
chaperones. However, inhibitors of eukaryotic chaperones could also be very inter-
esting, because of their participation in many pathways in immunology (presentation
of the antigen) and in molecular cancer biology (anti-apoptosis factors).
4. Notes
1. The sidB1 mutation is an extragenic suppressor present in the strain BB1553, in
addition to the disrupted dnaK gene. It prevents the excessive synthesis of heat-
shock proteins that occurs in the absence of DnaK, the negative regulator of the
heat-shock response in prokaryotes. It is a mutant allele of rpoH, which encodes
the heat-shock-specific transcription factor 32 . The point mutation (Thr252Met) in
sidB1 affects the activity rather than the cellular concentration of 32 and suppresses
the major cellular defects of the dnaK52 mutant by reducing the elevated level of
expression of heat-shock proteins (9).
2. Strains AL19 and BB1553 (dnaK) are thermosensitive for growth on LB plates
at 44 °C and 38 °C, respectively, whereas dnaK+ strains AL26 and MC4100 grow
on LB plates at 44 °C. BB1553 (cmR ) grows on LB plates containing 25 μ g/mL
chloramphenicol at 30 °C.
3. Strain JM83 (lacZM15, dnaK52::cmR ) is chloramphenicol-resistant,
temperature-sensitive (at 40 °C), and cold-sensitive (at 20 °C), as expected. When
transformed to kanamycin resistance with plasmid pWSK129, it is unable to sustain
-complementation after streaking on LB plates containing IPTG, X-Gal, and
kanamycin, since all the isolated colonies are white after 48 h at 30 °C. However, the
high-cell-density portion of the streak is pale blue (see Fig. 5A of (8)), and therefore
it is important to examine the lac phenotype at the level of isolated colonies and
not at high cell density.
4. Strain TR20 (dnaK756-ts) grows normally in LB medium at 37 °C and also at 40 °C,
although a slight inhibition of growth is observed at 40 °C. -complementation is
abolished at these temperatures but is normal at 30 °C, the permissive temperature.
5. In the case of a pulse-chase experiment, labeling is performed for 30 s (with [5-3 H]
uridine Amersham (TRK178) isotopically undiluted), followed by a chase with 0.5
mM unlabeled uridine.
6. It is assumed that the mutant DnaK756 protein present in strain AL19 is thermosen-
sitive and inactive only when synthesized at 43 °C, but that the portion synthesized
at 30 °C is still active and thermoresistant at 43 °C. Therefore, a certain period

of time (1.5 h) is needed for its dilution and/or decay in bacteria shifted to the
non-permissive temperature.
7. Strains containing pUC18 are grown in LB medium containing 100 μg/mL
ampicillin, and those containing pWSK129 in the same medium containing
25 μg/mL kanamycin.
8. In the case of strains harboring pUC18, addition of IPTG to the culture medium is
unecessary, because of the titration of the LacI repressor by the numerous pUC18-
borne lac operators. pUC18 is a high-copy-number plasmid with 100 to 200 copies
per cell.
References
1.
1 Alix, J. H. (1993) Extrinsic factors in ribosome assembly. In The Translational
Apparatus: Structure, Function, Regulation, Evolution (K. H. Nierhaus et al., eds.),
Plenum, New York, pp.173–184.
2.
2 Culver, G. M. (2003) Assembly of the 30S ribosomal subunit. Biopolymers 68,
234–249.
3.
3 Alix, J. H., and Guérin, M. F. (1993) Mutant DnaK chaperones cause ribosome
assembly defects in E. coli. Proc. Natl. Acad. Sci. USA 90, 9725–9729.
4.
4 Sbaï, M., and Alix, J. H. (1998) DnaK-dependent ribosome biogenesis in E. coli:
Competition for dominance between the alleles dnaK756 and dnaK+ . Mol. Gen.
Genet . 260, 199–206.
5.
5 El Hage, A., Sbaï, M., and Alix, J. H. (2001) The chaperonin GroEL and other
heat-shock proteins, besides DnaK, participate in ribosome biogenesis in E. coli.
Mol. Gen. Genet. 264, 796–808.
6.
6 El Hage, A., and Alix, J. H. (2004) Authentic precursors to ribosomal subunits
accumulate in E. coli in the absence of functional DnaK chaperone. Mol. Microbiol.
51, 189–201.
7.
7 Alix, J. H. (2004) The work of chaperones. In Protein Synthesis and Ribosome
Structure (K. H. Nierhaus.and D. N. Wilson, eds.), Wiley-VCH Verlag, New York,
pp. 529–562.
8.
8 Lopes Ferreira, N., and Alix, J. H. (2002) The DnaK chaperone is necessary for
-complementation of -galactosidase in E. coli. J. Bacteriol. 184, 7047–7054.
9.
9 Bukau, B., and Walker, G. C. (1990) Mutations altering heat shock specific subunit
of RNA polymerase suppress major cellular defects of E. coli mutants lacking the
DnaK chaperone. EMBO J. 9, 4027–4036.
10.
10 Miller, J. H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor
Laboratory Press, New York.
11.
11 Neidhardt, F. C., Bloch, P. L., and Smith, D. F. (1974) Culture medium for
enterobacteria. J. Bacteriol. 119, 736–747.
12.
12 Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Improved M13 phage
cloning vectors and host strains: Nucleotide sequences of the M13mp18 and pUC19
vectors. Gene 33, 103–119.
13.
13 Wang, R. F., and Kushner, S. R. (1991) Construction of versatile low-copy-number
vectors for cloning, sequencing and gene expression in E. coli. Gene 100, 195–199.
14.
14 Rida, S., Caillet, J., and Alix, J. H. (1996) Amplification of a novel gene, sanA,
abolishes a vancomycin-sensitive defect in E. coli. J. Bacteriol. 178, 94–102.
15.
15 Shapiro, S., and Baneyx, F. (2002) Stress-based identification and classification
of antibacterial agents: Second-generation E. coli reporter strains and optimization
of detection. Antimicrob. Agents Chemother. 46, 2490–2497.
16.
16 Abbas-Terki, T. and Picard, D. (1999) -Complementation of -galactosidase: An
in vivo model substrate for the molecular chaperone heat-shock protein 90 in yeast.
Eur. J. Biochem. 266, 517–523.
8
Assays for the Identification of Inhibitors Targeting

Specific Translational Steps
Letizia Brandi, John Dresios, and Claudio O. Gualerzi
Summary
While bacterial protein synthesis is the target of about half of the known antibiotics, the great
structural-functional complexity of the translational machinery still offers remarkable oppor-
tunities for identifying novel and specific inhibitors of unexploited targets. We designed a
knowledge-based in vitro translation assay to identify inhibitors selectively targeting the bacterial
or the yeast translational apparatus, preferentially blocking the early steps of protein synthesis.
Using a natural-like, “universal” model mRNA and cell-free extracts prepared from Eschericha
coli, Saccharomyces cerevisiae, and HeLa cells, we were able to translate, with comparable
yields in the three systems, the immunogenic peptide encoded by this “universal” mRNA. The
immuno-enzymatic quantification of the translated peptide in the presence of a potential inhibitor
can identify a selective bacterial or fungal inhibitor inactive in the human system. When applied
to the high-throughput screening (HTS) of a library of approximately 25,000 natural products,
this assay led to the identification of two novel and specific inhibitors of bacterial translation.
Key Words: translation inhibitors; bacterial translation initiation; eukaryotic translation.
1. Introduction
The translational apparatus of both bacteria and lower eukaryotes, such as
pathogenic protozoa and fungi, is an ideal target for the identification of new
anti-infective drugs. In fact, protein synthesis is a vital, multi-target process
involving the largest and most complex ribozyme found in nature (i.e., the
ribosome) in addition to over 100 RNA and protein molecules. The mechanism
of protein synthesis is essentially the same in all kingdoms of life and relies

87
88 L. Brandi et al.
on a large number of molecular components, most of which have a common

ancestral origin. Nevertheless, prokaryotic translation and eukaryotic translation
are significantly different, at least for some of the components involved and
for the mechanistic aspects of some steps of their pathways (1) so as to
confer at least kingdom-specificity to a large number of antibiotics targeting
the translational apparatus. Furthermore, protein synthesis can be easily repro-
duced in vitro as the whole process or dissected into its single steps, which
can be individually studied. Finally, the large body of information available
concerning both structural and functional aspects of the translational apparatus,
including the recently elucidated high-resolution 3D structure of the bacterial
ribosome alone (2–8) or in complex with antibiotics (9), ensures that identifi-
cation, characterization, improvement, and rational design of inhibitors can be
further pursued as a truly knowledge-based research.
The success of the translation apparatus as an antibiotic target is demonstrated
by the fact that it represents the target of approximately half of all known
antibacterial agents (10–12). In spite of this, the structural-functional complexity
of the translational pathway and of its components still offers remarkable
opportunities for identifying new bacterial inhibitors specific for unexploited
targets such as, for instance, the translation initiation step. On the other hand,
the translational apparatus of pathogenic lower eukaryotes (e.g., protozoa and
fungi), unlike that of bacteria, has rarely been found as a target for anti-
infective drugs active against these organisms. Thus, the simple identification of
a translation inhibitor selectively active on lower and not on higher eukaryotic
systems would be novel and important for the control of the infectious diseases
caused by these organisms.
We have designed a model mRNA that displays all the relevant character-
istics of a natural bacterial mRNA and is therefore able to drive an initiation-
and termination-dependent translation in the presence of a bacterial cell extract.
The same mRNA has then been appropriately modified to direct eukaryotic
translation in the presence of either yeast or mammalian cell-free extracts,
thus yielding a “universal” mRNA capable of programming, with comparable
efficiency, translational systems derived from three different cellular sources
(Eschericha coli, Saccharomyces cerevisiae, and human HeLa cells). Thus,
the same peptide synthesized in the three systems can be detected by the
same immune-enzymatic reaction, thereby allowing a direct comparison of the
inhibitory power of either natural or synthetic compounds in prokaryotic, lower
and higher eukaryotic systems. The main characteristics of the “universal”
model mRNA are described in Section 1.1.
Translation Test for Antibiotic Detection 89
When adapted to the high-throughput-screening (HTS) format and applied

to the screening of a library consisting of several thousands of natural products,
this approach led to the identification of two novel inhibitors of bacterial protein
synthesis such as GE81112 (13,14) and GE82832 (15) as well as of other
bacteria-specific and yeast-specific inhibitors (unpublished results).
1.1. Characteristics of the “Universal” Model mRNA

The model mRNA designated “27IF2Cp(A) mRNA,” schematically illustrated
in Fig. 1, contains the relevant characteristics of mRNA naturally occurring
in prokaryotes and eukaryotes. Hence, it can be regarded as a universal
mRNA that can be used to drive translation in cell-free systems derived from
bacterial and low and high eukaryotic cells (i.e., E. coli, S. cerevisiae, and
HeLa cells).
The main features of the “27IF2Cp(A) mRNA” are the following:
1. Important for prokaryotic translation is the presence of a translation initiation region
(T.I.R.) (16) comprising a short Shine and Dalgarno (SD) sequence (AGGU), a
9-nucleotide spacer between the SD and the initiation codon, and a canonical AUG
initiation triplet.
2. Important for the eukaryotic translation (17,18) are the sequence context neighboring
the AUG start triplet that contains an A at position –3 and a U at position +4,
the length of the 5’UTR (which is 74 nucleotides long); the AU-rich nature of the
leader region was designed to lack secondary structures; the 3‘UTR containing a
poly (A) tail of 26 adenosines that allows CAP-independent translation initiation
(see Note 1).
3. The coding sequence is composed of the synthetic 027 gene, encoding the 027
peptide, followed by a cleavable linker of 16 amino acids and the natural coding
sequence for the 220 amino acids long C-terminal domain of B. stearothermophilus
initiation factor IF2. The 027 gene consists of the 002 mRNA sequence (19)
encoding for only 3 amino acids (Phe, Ile, Thr) repeated 3.5 times for a total of
35 residues. In contrast to the amino acid composition of the 027 peptide, the
linker and the IF2C sequence contain all the natural amino acids with the exception
of Trp.
2. Materials
2.1. General Materials
1. Mortar (20 cm diameter).
2. Polystyrene roller bottles (Corning 850 cm2 ).
3. Dialysis tubing (Spectrum Laboratories, Inc.) with 3,500 Da molecular weight
cut-off.
90 L. Brandi et al.
5’- gggaauucaaaaauuuaaaaguuaacagguauacauacu AUG UUU ACG AUU

M F T I
ACU ACG AUC UUC UUU ACG AUC UUC UUU ACG AUU ACU ACG AUC UUC
T T I F F T I F F T I T T I F
UUU ACG AUU ACU ACG AUC UUC UUU ACG AUU ACU ACG AUC UUC UUU
F T I T T I F F T I T T I F F
ACG GGG CUG GUU CCG CGU GGA UCC UCU AGA GUC GAC CUG CAG GAG
T G L V P R G S S R V D L Q E
CAG CGG AGC GUG AAA ACG CGC GUC AGC CUC GAC GAU UUG UUC GAA
Q R S V K T R V S L D D L F E
CAA AUC AAG CAA GGC GAA AUG AAA GAG CUG AAC UUG AUC GUC AAA
Q I K Q G E M K E L N L I V K
GCC GAU GUU CAA GGA UCG GUU GAG GCG CUG GUU GCC GCC UUG CAA
A D V Q G S V E A L V A A L Q
AAA AUC GAU GUC GAA GGC GUG CGG GUG AAA AUC AUC CAU GCG GCG
K I D V E G V R V K I I H A A
GUC GGC GCC AUC ACC GAA UCG GAU AUU UCA CUG GCG ACG GCA UCG
V G A I T E S D I S L A T A S
AAC GCU AUC GUC AUU GGC UUU AAC GUC CGC CCG GAU GCG AAU GCG
N A I V I G F N V R P D A N A
AAG CGC GCC GCU GAA UCG GAA AAA GUC GAC AUC CGC CUC CAU CGC
K R A A E S E K V D I R L H R
AUC AUU UAC AAC GUC AUU GAG GAA AUU GAA GCG GCG AUG AAA GGG
I I Y N V I E E I E A A M K G
AUG CUC GAC CCG GAA UAC GAA GAG AAA GUC AUC GGC CAA GCG GAA
M L D P E Y E E K V I G Q A E
GUG CGG CAA ACG UUC AAA GUG UCC AAA GUU GGC ACG AUC GCC GGC
V R Q T F K V S K V G T I A G
UGC UAU GUC ACC GAC GGC AAA AUC ACC CGC GAC AGC AAA GUG CGC
C Y V T D G K I T R D S K V R
CUC AUC CGC CAA GGC AUC GUC GUG UAC GAA GGC GAA AUC GAU UCG
L I R Q G I V V Y E G E I D S
CUC AAA CGG UAU AAA GAG GAU GUG CGC CAA GUG GCG CAA GGA UAU
L K R Y K E D V R Q V A Q G Y
GAG UGC GGC UUG ACG AUC AAA AAC UUC AAU GAC AUU AAA GAA GGG
E C G L T I K N F N D I K E G
GAC GUU AUU GAA GCG UAC GUC AUG CAG GAA GUG GCU CGG GCA UGA
D V I E A Y V M Q E V A R A
ucggcuuugccgcatgcaagcu(A)26 gcuu - 3’
Fig. 1. Sequence of the “universal” 27IF2Cp(A) mRNA and of its product.

The Shine–Dalgarno sequence, the initiation, and termination triplets are written
in bold and underlined. The 5‘UTR and 3‘UTR are in lowercase letters, and the
open reading frames are in uppercase letters with the nucleotides encoding the
thrombin-sensitive linker underlined. The amino acid sequence of the 027 peptide is
indicated in bold letters. The amino acids of the thrombin-sensitive spacer (uppercase
single-letter amino acids) correspond to the underlined nucleotide sequences and
are followed by the Bacillus stearothermophilus IF2 C-domain (uppercase amino acids).
4. 3MM paper 25 mm round filters (Schleicher & Schuell).

5. Oligo d(T) cellulose Type 7 (Amersham).
6. Sephadex G-25 Fine (Amersham).
7. Unwashed glass beads (425–600 μm, Sigma) (see Note 2).
8. Slot-blot apparatus (BioRad) with nitrocellulose membrane (0.45 μm) (Schleicher
& Schuell).
9. Protease Inhibitor Cocktail for Fungal and Yeast extracts (Sigma) and complete
EDTA-free Proteinase Inhibitors Cocktail (Roche).
10. [14 C] Phenylalanine, 93.8 mCi/mmol (Amersham).
11. Ultima Gold scintillation liquid (Packard).
12. 9F11 monoclonal antibody (Areta International).
13. Anti-mouse Horseradish-Peroxidase-conjugated (Amersham).
2.2. Stock Solutions

1. Ribonucleotide triphosphates, Na salts (Roche) are dissolved in DEPC-treated H2 O
(see Note 3) at 0.1 M. The pH is adjusted to 7.1–7.5 (at room temperature) by
addition of 5 N KOH. The solutions are divided in aliquots and stored at –20 °C.
2. Spermidine trihydrochloride and DTT are dissolved in DEPC-treated H2 O to 1 M,
divided in aliquots and stored at –20 °C.
3. Na acetate is dissolved in sterile water to 3 M, adjusted to pH 5.2 with glacial
acetic acid, sterilized by autoclaving, divided in aliquots, and stored at –20 °C.
4. 150 mL of 50% glucose is made by adding 100 mL of water to 75 g of powder.
The powder will go into solution upon autoclaving.
5. E. coli MRE600 tRNA is dissolved in sterile water to 100 mg/mL and bovine liver
tRNA to 6 mg/mL. The solutions are divided in aliquots and stored at –20 °C.
6. Benzamidine is dissolved in sterile water to 0.1 M and stored at 4 °C up to a few
months.
7. Phenylmethylsulfonyl fluoride (PMSF) (Caution: very toxic upon inhalation and
contact with skin) is dissolved in ethanol to 0.1 M and stored up to a few months
at 4 °C.
8. Phospho enol pyruvate (0.4 M): The powder is resuspended in 1 N KOH. Sterile
water is added, and the pH is adjusted to 7.0 with 1 N (or more concentrated)
KOH and brought to the final volume with sterile water.
9. Amino acids mixture: starting from the stock solution (in sterile water) of each
amino acid (0.1 M all amino acids but for glu, asn, trp, asp, and tyr, which are
0.05 M). A solution of the desired composition is made by mixing the appropriate
amino acids and diluting to a final concentration of 2.5 mM each in 100 mM
Tris-HCl, pH 7.7. The final pH should be around 7.
10. 10-Formyl-tetrahydrofolate (10-formyl THF): 10 mg of 5-formyl-tetrahydrofolate
(5- formyl THF) are dissolved in 1 mL of 0.1 M HCl that has been flushed exten-
sively with N2 . Store the well-closed vial at 4 °C overnight to obtain a yellow
suspension of 5,10-methenyl THF. This suspension is agitated and an aliquot
92 L. Brandi et al.
withdrawn for spectrophotometric determination of the concentration (6 mM

solution = 85 OD355nm ). The expected 5,10-methenyl THF concentration is approx-
imately 20 mM. Since the 10-formyl THF is stable for only a few weeks, it is
convenient to store the cyclic methenyl THF, which is stable for several weeks
at –20 °C, and prepare fresh 10-formyl THF as needed by hydrolyzing the cyclic
methenyl THF. For this, dilute the stock solution in 100 mM Tris-HCl, pH 8.0,
extensively flushed with N2 and supplemented with 100 mM of 2-mercaptoethanol.
After 15 min incubation at 20 °C, divide the solution in aliquots and store
at –20 °C.
11. 3-Aminoethylcarbazole (AEC) stock solution: Dissolve 0.4 g of 3-aminoethyl
carbazole (Caution: toxic) in 100 mL of N,N dimethyl formamide.
12. Staining solution for the Western blot: 0.67 mL of AEC stock solution are diluted
in 10 mL 0.1 M Na acetate, pH 5.2. To start the peroxidase reaction, add 10 μL
of 30% H2 O2 .
13. Creatine phosphate (CP): Dissolve to 1 M in sterile water, and store in aliquots
at –20 °C.
14. Creatine phospho kinase (CPK): Dissolve in 30 mM Hepes-KOH, pH 7.4,
and 50% glycerol to 5 mg/mL final concentration, and store in aliquots
at –20 °C.
15. Ethidium bromide (Caution: possible carcinogen) stock solution: 10 mg/mL in
H2 O. Store at room temperature in a dark bottle. Before use, dilute to 0.5 μg/mL
with H2 O.
16. TCA stock solutions: Dissolve 100 g of TCA in 100 mL of water. Dilute to 10%
and store at 4 °C; dilute to 5% and store at room temperature.
2.3. Buffers
1. Binding buffer: 20mM Tris-HCl, pH 7.5, 500 mM NaCl, 1mM EDTA, pH 8.0.
Sterilized by autoclaving.
2. Wash buffer: 20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1mM EDTA, pH 8.0.
3. Elution buffer: 20 mM Tris-HCl, pH 7.5, 1mM EDTA, pH 8.0. Sterilized by
autoclaving.
4. Buffer A: 10mM Tris-HCl, pH 7.7, 10mM Mg acetate, 60mM NH4 Cl, 10%
glycerol. Sterilized by autoclaving. Just before use, make 0.2 mM benzamidine,
0.2 mM PMSF, and 1 mM DTT.
5. Bacterial grinding/extraction buffer: Buffer A containing 0.5 g/L bentonite.
6. Breaking buffer: 30 mM Hepes-KOH, pH 7.4, 100 mM K acetate, 2 mM Mg
acetate, 20% glycerol. Sterilized by autoclaving. Add mannitol, 85 g/L, and just
before use, make 2 mM DTT and 0.5 mM PMSF.
7. MC buffer: 10 mM Hepes-KOH, pH 7.6, 10 mM K acetate, 0.5 mM Mg acetate,

sterilized by autoclaving and supplemented before use with 5 mM DTT and 1X
Complete EDTA-free Proteinase Inhibitors Cocktail (see Note 4).
8. Phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 10mM Na2 HPO4 ,
2 mM KH2 PO4 . Adjust the pH to 7.4 with HCl and sterilize by autoclaving.
9. 5X Tris Borate EDTA (TBE): 450 mM Tris, 450 mM borate, 10mM EDTA, pH 8
(see Note 5).
10. RNA loading buffer: 98% (v/v) formamide, 10 mM EDTA, pH 8, 1 mg/mL
bromophenol blue, and 1 mg/mL xylene cyanol FF.
2.4. Cells and Growth Media

1. E. coli MRE600 was grown in LB medium: tryptone, 10 g/L, yeast extract, 5 g/L,
NaCl, 5 g/L, and separately autoclaved glucose (final concentration: 0.5%).
2. S. cerevisiae SKQ 2M was grown in YPD medium: yeast extract, 10 g/L, peptone,
20 g/L, glucose, 20 g/L.
3. Human HeLa S3 (ATCC CCL-2.2), a clonal derivative of the parent HeLa (ATCC
CCL-2) line adapted to grow in suspension and therefore more suitable for
production of large biomass, was maintained in Minimum Essential Medium Eagle
Joklik Modification, supplemented with 10% Fetal Bovine Serum as suspension
cultures in Polystyrene Roller Bottle.
2.5. Preparation of the Model mRNA

2.5.1. For in vitro Transcription
To prepare the model mRNA, the following materials are required:
1. DEPC-treated water.
2. Ribonucleotide triphosphates, ATP, GTP, UTP, CTP, Na salts (Roche).
3. BSA RNase-free, 20 mg/mL (Roche), and RNasin Ribonuclease Inhibitor, 40 U/mL
(Promega).
4. 1 M Tris-HCl, pH 8.0, 1 M MgCl2 , 1 M spermidine trihydrochloride, and 1 M
DTT.
5. T7 RNA polymerase (BioLabs).
2.5.2. For mRNA Purification

1. For purification by oligo d(T) cellulose chromatography: binding buffer, wash
buffer, elution buffer in addition to ethanol and 3M Na acetate, pH 5.2 for
precipitation.
2. For purification by LiCl precipitation: 5 M LiCl, ethanol, and 3M Na acetate,
pH 5.2.
94 L. Brandi et al.
2.5.3. Quality Control of mRNA

For the quality control of the transcript, evaluated by PAGE-UREA
electrophoresis, the following materials are required:
1. 5X TBE.
2. 6% acrylamide/Bis-acrylamide/7M urea gel.
3. RNA loading buffer.
4. Ethidium bromide staining solution.
2.6. Preparation of E. coli Cell Extract

1. Alumina.
2. Mortar and pestle.
3. DNase (RNase-free) (Roche).
4. Bacterial grinding/extraction buffer.
5. Buffer A.
6. Dialysis tubing.
2.7. Preparation of S. cerevisiae Cell Extract

1. Breaking buffer (with and without mannitol).
2. Glass beads.
3. Protease Inhibitor Cocktail for fungal and yeast extracts.
4. Sephadex G-25 (Fine).
2.8. Preparation of HeLa Cell Extract

1. Tight-fitting Dounce homogenizer.
2. MC buffer.
3. 1X Complete EDTA-free Proteinase Inhibitors Cocktail.
2.9. Bacterial in vitro Translation (Radioactive Product)

1. All the components for in vitro translation are dissolved or diluted using sterile
materials (disposable sterile plastic ware or glassware sterilized in oven at 180 °C
for 8 h) and DEPC-treated water or water-autoclaved 3–4 times. For buffers
and salt solutions, it is preferred to resterilize by autoclaving the final solutions;
temperature-sensitive solutions are sterilized by filtration through 0.2 μm nitrocel-
lulose membranes.
2. Bacterial cell extract.
3. Universal model mRNA.
4. 1 M Tris-HCl, pH 7.7.
5. 1 M Mg acetate.
6. 4M NH4 Cl.
7. 1M DTT.
8. 100 mg/mL tRNA (E. coli).

9. 100 mM ATP.
10. 100 mM GTP.
11. 0.4 M PEP.
12. 2.5 mM amino acids mixture minus Phe.
13. 6 mM 10-formyl THF.
14. [14 C] phenylalanine.
15. 10 mM phenylalanine.
16. 3MM filter paper discs.
17. 10% TCA.
18. 5% TCA.
19. Ethanol-ether 1:1.
20. Ether.
21. Ultima Gold scintillation fluid.
2.10. Bacterial in vitro Translation (Non-radioactive Product)

1. This reaction requires the same components listed in Section 2.9 with the exception
that non-radioactive phenylalanine is used in place of [14 C] phenylalanine.
2. The translation product is filtered on 0.45 μm nitrocellulose membranes using a
slot-blot apparatus.
3. BSA.
4. 9F11 monoclonal antibody.
5. Tween 20.
6. Anti-mouse horseradish-peroxidase-conjugated antibody.
7. Staining solution for Western blot.
2.11. Yeast in vitro Translation (Radioactive Product)

The components for the in vitro yeast translation are prepared using the same
precautions used for the bacterial translation.
1. Yeast cell extract.
2. 1 M Hepes-KOH, pH 7.4.
3. 2.5 M K acetate.
4. 1 M Mg acetate.
5. 1 M DTT.
6. 100 mM ATP.
7. 100 mM GTP.
8. 1 M CP.
9. 5 mg/mL CPK.
10. 40 U/mL RNase inhibitor.
11. 2.5 mM amino acid mixture minus Phe.
96 L. Brandi et al.
12. [14 C] phenylalanine.

13. 10 mM phenylalanine.
The quantification of the product requires the same materials listed for
bacterial translation.
2.12. Yeast in vitro Translation (Non-radioactive Product)
This reaction requires the same components and materials listed in Section
2.1 with the exception that non-radioactive phenylalanine is used in place of
[14 C] phenylalanine and product detection requires the same materials listed in
Section 2.10.
2.13. Human in vitro Translation
The components and materials required for in vitro translation with HeLa cell
extracts and for immunological product detection are the same as those listed
in Section 2.12 with the exception that human cell extract and Hepes-KOH,
pH 7.6, are used. In addition, this test requires 1 M spermidine and 6 mg/mL
bovine liver tRNA.
3. Methods
3.1. In vitro Transcription of Model mRNA
The quality of the mRNA is a key element in determining the quality of
the results obtained in the translation tests. Thus, special care should be taken
in the preparation and purification of the mRNA. The main characteristics
of the universal mRNA 27IF2Cp(A) are described in Section 1.1.The DNA
template used for the in vitro transcription is present as an insert in a plasmid
(pTZ18UmRNA). For the transcription reaction it is possible to use either a
DNA template prepared by PCR amplification of the relevant coding sequence
or the HindIII-linearized plasmid. The mRNA produced by transcription can be
purified (see Note 6) either by column chromatography on oligo (dT) cellulose
(Section 3.1.2.1) or by LiCl precipitation (Section 3.1.2.2). Disposable sterile
plastic ware as well as glassware oven-sterilized for 4 h at 180 °C after rinsing
with DEPC-treated water is used in the preparative transcription of the mRNA.
3.1.1. Transcription Reaction
1. The reaction mix (typically 12 mL) consists of 0.02 μM DNA template, 40 mM
Tris-HCl, pH 8.1, 20 mM MgCl2 , 10 mM spermidine, 5 mM DTT, 0.1 mg/mL
BSA, 0.05 U/μL RNase inhibitor, 0.004 U/μL PPase, 3.75 mM each ribonucleotide
triphosphates, and 1.2–1.7 U/μL T7 RNA polymerase.
2. The reaction mix is incubated for 2–3 h at 37 °C (see Note 7).
3.1.2. mRNA Purification

3.1.2.1. Purification by oligo-dT Cellulose Chromatography
1. Resuspend (typically, 5 g) oligo-(dT) cellulose in DEPC-treated water and
autoclave at 120 °C for 20 min.
2. Pack resin into a small glass column (2.2 cm × 6 cm) and equilibrate with
10 column volumes of Binding buffer.
3. At the end of the transcription reaction, adjust the NaCl concentration of the mix
to 0.5 M by addition of 5 M NaCl and load the sample onto the column. Collect
the flowthrough and repeat the loading.
4. Wash the column with 10 column volumes of Binding buffer followed by
5 volumes of Wash buffer.
5. Elute the mRNA with 3 column volumes of Elution buffer. Collect fractions
corresponding to approximately 1/7th the column volume (see Note 8).
6. Dilute each fraction 1:20 and determine A260 .
7. Pool the fractions corresponding to peak of highest A260 . Add 0.1 volume of 3 M
Na acetate (pH 5.2) and 2.5 volumes of cold absolute ethanol. Store at –20 °C for
at least 30 min.
8. Centrifuge 30 min at 12K rpm 12,000Xg at 4 °C (Sorvall, SA600 rotor).
9. Wash pellet with 70% ethanol. Air-dry pellet.
10. Resuspend RNA in small volume of DEPC-treated water. Determine concentration
spectrophotometrically (1A260 = 40 μg/mL) (see Note 9).
3.1.2.2. Purification by LiCl Precipitation

1. At the end of the transcription reaction, add to the reaction mix an equal volume
of sterile 5 M LiCl. Keep on ice for 30 min.
2. Centrifuge 10 min at 12K rpm (12,000Xg) (Sorvall SA600 rotor) at room temper-
ature (see Note 10).
3. Rinse the pellet with 70% ethanol, resuspend it in DEPC-treated water, and add
0.1 volume of 3 M Na acetate (pH 5.2) and 2.5 volumes of cold absolute ethanol.
Store at –20 °C for at least 30 min.
4. Centrifuge 10 min at 12K rpm (12,000Xg) (Sorvall SA600 rotor) at 4 °C. Repeat
Steps 3 and 4 at least twice.
5. Air-dry the last pellet. Resuspend RNA in a small volume of DEPC-treated water.
Determine concentration spectrophotometrically (1 A260 = 40 μg/mL).
3.1.2.3. Analysis of the mRNA Quality by PAGE-Urea

1. To check the success of the transcription reaction, remove 5 μL of reaction mix
at the beginning and end of the transcription reaction and add to 5 μL of sample
buffer.
98 L. Brandi et al.
2. Incubate at 65 °C for 5 min and load on a 6% acrylamide-7M urea gel. To check

the quality of the purified mRNA, 100–200 μg of RNA are analyzed on the same
gel. Run the electrophoresis with 1X TBE running buffer.
3.2. Preparation of E. coli Cells and Cell-Free Extract

The E. coli cell-free extract (S30) fraction is prepared from cells grown
in a fermenter to early-mid log phase, harvested, and stored at –80 °C. The
frozen cells are disrupted by grinding with alumina. The S30 fraction, obtained
by centrifugation of the crude cell extract to remove membranes and other
debris, is dialyzed and stored at –80 °C. Normally, one obtains 1 mL cell
extract per gram of cell paste. The activity of the S30 extract is evaluated in a
dose-response experiment.
3.2.1. Growth of E. coli Cells

1. Inoculate 15 L of LB medium containing separately sterilized glucose (f.c. 0.5%)
with 300 mL of an overnight culture (A600 4) of E. coli MRE600 cells. Incubate
at 37 °C with vigorous aeration to A600 1.2.
2. Harvest the cells by continuous-flow centrifugation at 42K rpm (CEPA laboratory
LE centrifuge).
3. Resuspend the cells, and wash three or four times with buffer A.
4. Rapidly freeze and store final cell pellet at –80 °C. The average yield is 35–45 g
of washed cells per fermentation.
3.2.2. Preparation of E. coli Cell-Free Extract

1. Grind 50 g frozen E. coli cell paste for approximately 25 min with 75 g pre-cooled
alumina in a pre-chilled mortar kept on ice.
2. Add DNAse (RNase-free) (2.5 μg/g cells) to the thick cell slurry.
3. Resuspend the cell slurry in 50 mL Bacterial grinding/extraction buffer and gently
stir in a beaker for 10 min at 4 °C.
4. Centrifuge the crude cell extract at 12K rpm (12,000X g) for 15 min at 4 °C in an
SA600 Sorvall rotor.
5. Discard pellet containing alumina and cell debris and recentrifuge the supernatant
at 12K rpm (12,000Xg) for 60 min at 4 °C (SA600 rotor) to obtain the S30
fraction.
6. Dialyze the S30 extract at 4 °C against 40 volumes of buffer A, changing the buffer
every 2–3 h for a total of 3 changes.
7. After dialysis, clarify the extract by centrifugation at 12K rpm for 20 min at 4 °C
(SA600 rotor).
8. Store S30 in small aliquots (50 μL, 100 μL, 200 μL) at –80 °C (see Note 11).
3.3. Preparation of Yeast Cells and Cell-Free Extract

The growth conditions for S. cerevisiae are similar to those described for
E. coli, but the method for rupturing the cells (which involves shaking with
glass beads) and preparing the cell extract are quite different. All operations
are performed in a cold room and, whenever possible, with incubations in an
ice/NaCl mix to maintain a working temperature between –4° and –5 °C.
3.3.1. Growth of S. cerevisiae SKQ 2 M

1. Inoculate 15 L of YPD medium with 200 mL of a saturated culture of S. cerevisiae
SKQ 2 M, and incubate at 28–30 °C for approximately 6 h to A660 1.
2. Harvest the cells by continuous-flow centrifugation (CEPA laboratory LE
centrifuge).
3. Resuspend the cells, and wash three to four times with Breaking buffer containing
mannitol.
4. Freeze and store the final cell pellet at –80 °C.
3.3.2. Preparation of S. cerevisiae Cell Extract

1. Resuspend cells with mild shaking in Breaking buffer with mannitol (2.5 mL/g
cells) supplemented with protease inhibitor cocktail.
2. Distribute the resuspended cells in 50 mL Sorvall centrifuge tubes (3–4 g cells per
tube). Add 3–4 g ice-cold glass beads per mL buffer. Cap the tubes.
3. Shake the tubes by hand, making 120 vertical 50 cm long movements/min followed
by a 1 min incubation in ice/NaCl (–5 °C).
4. Repeat Step 3 for a total of 4 times.
5. Centrifuge the extract at 14K rpm 15,000Xg for 20 min at -5 °C (Sorvall, SA600
rotor). Collect with a Pasteur pipette the S30 in the phase formed between the upper
lipid layer and the pelleted glass beads (see Note 12).
6. Equilibrate the Sephadex G-25 column (resuspend the resin in water and sterilize
it by autoclaving) with 5 volumes of Breaking buffer without mannitol.
7. Load crude S30 extract (6–10 mL) onto a Sephadex G-25 column (1.8 × 26 cm,
corresponding to ca. 60 mL) and elute with Breaking buffer without mannitol at a
flow rate of 1 mL/min, collecting fractions of 1 mL.
8. Dilute 1:100 a small aliquot of each fraction and determine A260 . Pool the excluded
fractions with highest A260 and determine the A260 of the pool. Store in suitable
aliquots at –80 °C. (See Note 13.)
3.4. Preparation of HeLa Cells and HeLa Cell Extract

In contrast to the bacterial and fungal cell extracts, which are prepared
from frozen cells, the preparation of HeLa cell extract must start from freshly
harvested cells.
100 L. Brandi et al.
3.4.1. Growth of HeLa Cells

1. A frozen 1 mL aliquot containing approximately 106 HeLa cells is resuspended in
25 mL fresh Minimum Essential Medium Eagle Joklik Modification supplemented
with fetal bovine serum (10%) and, in the presence of 5% CO2 , allowed to grow to
a cell density of approximately 3 × 105 cells/mL.
2. As the cells multiply in a suspension culture at 37 °C in Corning Polystyrene
Roller Bottles, fresh medium is periodically added to maintain a constant density
of 3 × 105 cells/mL.
3. HeLa cells are harvested from 2–3 L culture having reached a density of 3–6 ×
105 by centrifugation in GS3 rotor for 3 min at 2000 rpm (2000X g) at 4 °C using
250 mL sterile Falcon tubes.
3.4.2. Preparation of HeLa Cell Extract

1. Resuspend freshly harvested HeLa cell pellet in 20 mL sterile PBS and divide the
suspension in two 15 mL Falcon tubes. Centrifuge for 2 min at 2000 rpm (2000X g)
at 4 °C (Sorvall SA600).
2. Step 1 is repeated 3 times (see Note 14).
3. Resuspend final pellet in volume of MC buffer equal to volume of cell pellet. Leave
on ice 5 min.
4. Transfer resuspended cells to ice-cold, tight-fitting Dounce homogenizer. Break
cells with 15–18 strokes, pausing a few seconds between each stroke to avoid
heating.
5. Centrifuge the homogenate at 10,500 rpm 11,000Xg for 5 min at 4 °C (Sorvall
SA600 rotor).
3.5. In vitro Translation

3.5.1. In vitro Bacterial Translation
Two systems are available to test bacterial translational activity; one is
based on the detection of a radioactive product, the other on its immunological
detection. The translational systems yielding a radioactive and a non-radioactive
product are essentially the same except for the presence of radioactive or
non-radioactive phenylalanine, respectively. The first system is faster and very
sensitive because the “detection window” to quantify the product can span
from a few to several hundred thousand cpm. The non-radioactive translation
assay is suitable for systematic HTS assays in which massive use of radioactive
materials is problematic.
3.5.2. In vitro Bacterial Radioactive Translation
1. Translation is performed in 25–50 μL reaction mixtures containing 10 mM Tris-HCl,
pH 7.7, 7 mM Mg acetate, 100 mM NH4 Cl (see Note 15), 2 mM DTT, 2 mM ATP,
0.4 mM GTP, 10 mM PEP, 0.025 mg/mL PK, 0.12 mM 10-formyl-tetrahydrofolate,

3 μg /μL tRNA (E. coli), amino acid mixture containing 0.2 mM of all amino
acids with the exception of phenylalanine, 9 μM [14 C] phenylalanine, and 36 μM
non-radioactive phenylalanine.
2. Optimized aliquots of the S30 cell extract (generally, 2–4 μL/30 μL reaction volume)
and of universal mRNA (generally, 1 μM) are added to the reaction mixture (see
Notes 16 and 17).
3. The reaction mixture is incubated for 30–60 min at 37 °C, and 20–40 μL aliquots
from each tube are spotted on 3 MM paper discs that are immediately dropped into
10% ice-cold TCA.
4. After 30 min, the filters are transferred into 5% TCA and incubated 10 min at 90 °C.
After three 5 min washes at room temperature in 5% TCA, the filters are kept in a 1:1
ethyl ether:ethanol mixture for 10 min and finally in ether for an additional 10 min.
5. The filters are then dried and their radioactivity determined by liquid scintillation
counting (see Note 18).
3.5.3. In vitro Bacterial Non-radioactive Translation

The non-radioactive translation test is performed using the same protocol
described in Section 3.5.2 except that 0.045 mM non-radioactive phenylalanine
was used.
1. To detect the product of the reaction, 20 μL aliquots are filtered through a nitrocel-
lulose membrane using a slot-blot apparatus.
2. After washing in PBS for 45–60 min, the membrane is blocked for 1.5–2.0 h in
PBS containing 3% BSA before being incubated for 3 h in PBS with 0.3% BSA
with a suitable dilution of the first antibody (9F11).
3. After three 10 min washes in PBS with 0.05% Tween 20, the membrane is incubated
for 1 h in PBS with 0.3% BSA containing a suitable dilution of the second antibody
(Anti-mouse HRP-conjugated).
4. After three 10 min washes in PBS with 0.05% Tween 20, the membrane is incubated
in 10 mL of staining solution.
5. The reaction of the antibody-conjugated enzyme is stopped in H2 O, and the stained
bands are quantified densitometrically.
3.5.4. In vitro Yeast Translation

As for the bacterial translation, translational activity in yeast can also be
studied measuring the amount of peptide produced using either a radioactive
or an immunological test.
3.5.5. In vitro Yeast Radioactive Translation
1. Translation is performed in 25–50 μL reaction mixtures containing 33 mM Hepes-
KOH, pH 7.4, 160 mM K acetate, 3.8 mM Mg acetate (see Note 19), 3.3 mM DTT,
0.5 mM ATP, 0.1 mM GTP, 30 mM CP, 20 μg/mL CPK, 200 U/mL RNase inhibitor,
amino acid mixture containing 200 μM each of all amino acids (minus pheny-
lalanine), 9 μM [14 C] phenylalanine, and 36 μM non-radioactive phenylalanine.
2. Optimized aliquots of the S30 yeast extract (generally 0.5–1 A260 /tube is the best
concentration) and of universal mRNA (generally, 0.056 μM) are added to the
reaction mixture (following the same procedure described for bacterial translation
reported in Note 17).
3. The reaction mixture is incubated for 90–120 min at 25 °C, then 20 μL aliquots
from each sample are spotted on 3 MM filters and processed as described for the
bacterial system (see Section 3.5.2).
3.5.6. In vitro Yeast Non-radioactive Translation
The reaction mixture is prepared and incubated as described in Section 3.5.5
except for the omission of radioactive phenylalanine and the inclusion of 45
μM non-radioactive phenylalanine. The immunodetection and quantification of
the translated peptide are performed as described for the bacterial system (see
Section 3.5.3).
3.5.7. In vitro Human Translation
1. Translation is performed in 15–25 μL reaction mixtures containing 16 mM Hepes-
KOH, pH 7.6, 75 mM Ka acetate, 2.5 mM Mg acetate, 2mM DTT, 0.8 mM ATP,
0.1 mM GTP, 20 mM CP, 0.1μg/μL CPK, 0.1 μg/μL bovine liver tRNA, amino
acid mixture containing 200 μM each of all amino acids including phenylalanine,
and 0.1 mM spermidine.
2. Optimized aliquots of the HeLa cell extract (generally, 6–9 μL/15 μL is the best
concentration) and of universal mRNA (generally, 0.3 μM) are added to the
reaction mixture (following the same procedure described for bacterial translation
reported in Note 17).
3. The translation reaction is incubated for 60 min at 30 °C, and 10–25 μL are used
for the immunological quantification of the peptide produced, which is carried out
as described for the bacterial system (see Section 3.5.3).
4. Notes
1. Using the commercially available chemical capping system, our mRNA can be
capped and used to drive a CAP-dependent translation.
2. The unwashed glass beads were washed in 33% HCl (overnight), then washed
with plenty of water, and sterilized in an oven at 180 °C for 8 h.
3. DEPC-treated water is obtained by diluting 1:1000 the DEPC (Caution: toxic).
After stirring overnight, the solution is autoclaved at 120 °C for 20 min 2–3 times
in order to be sure that all the DEPC is completely removed. Since RNases can be
permanently denatured by multiple cycles of autoclaving, another way to sterilize
water (especially large volumes) is to autoclave it 3–4 times.
4. Dissolve one tablette of Complete EDTA-free Proteinase Inhibitors Cocktail in

2 mL of sterile water. This solution (25X) is stable at –20 °C for at least three
months. Dilute to 1X before use.
5. TBE is usually made and stored as 5X stock solution. Dilute the stock buffer just
before use, and make the gel solution and the electrophoresis buffer from the same
concentrated solution.
6. Purification by oligo-d(T) cellulose chromatography is more expensive than LiCl
precipitation but offers the advantage that the presence of the poly(A) tail at the
3’ end ensures that the purified mRNA is full length. Furthermore, this method
is less time-consuming because the eluted mRNA is then ethanol-precipitated,
resuspended in DEPC-treated water, and ready to use. The mRNA precipitated
by LiCl must be ethanol-precipitated at least three times to remove all the Li
+
ions, which may inhibit translation, especially in yeast. In general, purification
by oligo-d(T) cellulose chromatography is suitable for small mRNA preparations
and LiCl precipitation for large preparations.
7. Under our experimental conditions, an average of 48 A260 /mL of transcription
reaction, which is equivalent to 1.9 mg of pure mRNA, is obtained.
8. For short time conservation, the column can be left equilibrated in Binding buffer
at 4 °C; for longer storage, the DEPC-H2 O rinsed resin can be autoclaved, equili-
brated in Binding buffer, and stored at 4 °C. For very long storage, the resin can
be dried under vacuum after washing with 50% ethanol and stored at –20 °C.
9. According to the producer indications, 1 g of oligo-(dT) cellulose can bind 90
A260 of poly(A). Thus, 5 g of resin can be used to purify the mRNA produced in
10–12 mL of transcription reaction.
10. After incubation on ice, the LiCl-precipitated mRNA is collected by centrifu-
gation at room temperature. Centrifugation at 4 °C makes the pellet difficult to
resuspend. It is also not recommended to incubate the LiCl-precipitated-mRNA at
temperatures below 0 °C.
11. The extract is stable at –80 °C for a few years. If needed, it can be frozen and
thawed twice without loss of activity, but it is not recommended to freeze and
thaw it more than twice. The activity of each S30 preparation is tested by a
dose-response translation test to determine the optimal volume to be used in a
translation assay.
12. Usually, 8–10 mL of S30 can be obtained from 8 g of yeast cells.
13. The frozen yeast cell paste is usually kept for no longer than one month, while
the yeast S30 stored at –80 °C is stable for a longer period of time.
14. It is important to avoid prolonged contact between cells and PBS (20).
15. When calculating the final concentrations of these ions (Mg++ = 7 mM and NH4 +
= 100 mM) in the in vitro translation reaction mixture, one must keep in mind
that the S30 contains Mg++ and NH4 + .
16. The activity of S30 and mRNA can vary from one preparation to the next so that
the optimal amount must be preliminarily tested.
17. Keep all components of the translation reaction on ice. Prepare a premix consisting
of water, ions, energy system, amino acids, and tRNA in an ice-cold tube.
Distribute the S30 into the single Eppendorf tubes, and then add the premix and
finally the mRNA. The mRNA can be frozen and thawed many times, but use
sterile materials and make a fresh dilution for each experiment in order to add an
easy-to-pipette aliquot to the rest of the reagents to start the reaction. Transfer the
Eppendorf tubes from ice to a 37 °C incubator. Do not freeze leftover S30 more
than once.
18. To calculate the yield of product in pmoles, one must determine the specific
activity (cpm/pmole) of the Phe in the reaction mixture. This is done by directly
spotting 2 μL of the reaction mix onto a prewashed 3MM filter, determining the
cpm on the filter, and correlating the cpm with the known amount of Phe present
in the 2 μL. From this specific activity (cpm/pmol Phe) and knowing the number
of Phe present in the product peptide, one can calculate the pmoles of peptides
synthesized in vitro.
19. When calculating the final concentrations of these ions (Mg++ = 3.8 mM and
K+ = 160 mM) in the in vitro translation reaction mixture, one must keep in mind
that the S30 contains Mg++ and K+ .
Acknowledgments
The authors would like to thank Prof. Fabrizio Loreni for the kind gift of
the HeLa S3 cell line.
References
1.
1 Bottger, E. C., Springer, B., Prammananan, T., Kidan, Y., and Sander, P. (2001)
Structural basis for selectivity and toxicity of ribosomal antibiotics. EMBO Rep.
2, 318–323.
2.
2 Ban, N., Nissen, P., Hansen, J., Moore, P. B., and Steitz, T. A. (2000) The
complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science 289, 905–920.
3.
3 Harms, J., Schluenzen, F., Zarivach, R., Bashan, A., Gat, S., Agmon, I., Bartels,
H., Franceschi, F., and Yonath, A. (2001) High resolution structure of the large
ribosomal subunit from a mesophilic eubacterium. Cell 107, 679–688.
4.
4 Nissen, P., Hansen, J., Ban, N., Moore, P. B., and Steitz, T. A. (2000) The
structural basis of ribosome activity in peptide bond synthesis. Science 289,
920–930.
5.
5 Schluenzen, F., Tocilj, A., Zarivach, R., Harms, J., Gluehmann, M., Janell,
D., Bashan, A., Bartels, H., Agmon, I., Franceschi, F., and Yonath, A. (2000)
Structure of functionally activated small ribosomal subunit at 3.3 Angstroms
resolution. Cell 102, 615–623.
6.
6 Schuwirth, B. S., Borovinskaya, M. A., Hau, C. W., Zhang, W., Vila-Sanjurjo,
A., Holton, J. M., and Cate, J. H. (2005) Structures of the bacterial ribosome at
3.5 A resolution. Science 310, 827–834.
7.
7 Wimberly, B. T., Brodersen, D. E., Clemons, W. M. Jr., Morgan-Warren, R. J.,
Carter, A. P., Vonrhein, C., Hartsch, T., and Ramakrishnan, V. (2000) Structure
of the 30S ribosomal subunit. Nature 407, 327–339.
8.
8 Yusupov, M. M., Yusupova, G. Z., Baucom, A., Lieberman, K., Earnest, T.
N., Cate, J H, and Noller,H F. (2001) Crystal structure of the ribosome at 5.5
A resolution. Science 292, 883–896.
9.
9 Poehlsgaard, J., and Douthwaite, S. (2005) The bacterial ribosome as a target for
antibiotics. Nat. Rev. Microbiol. 3, 870–881.
10.
10 Bottger, E. C. (2006) The ribosome as a drug target. Trends Biotechnol. 24,
145–147.
11.
11 Harms, J. M., Bartels, H., Schlunzen, F., and Yonath, A. (2003) Antibiotics acting
on the translational machinery. J. Cell Sci. 116, 1391–1393.
12.
12 Tenson, T., and Mankin, A. (2006) Antibiotics and the ribosome. Mol. Microbiol.
59,1664–1677.
13.
13 Brandi, L., Lazzarini, A., Cavaletti, L., Abbondi, M., Corti, E., Ciciliato, I.,
Gastaldo, L., Marazzi, A., Feroggio, M., Fabbretti, A., Maio, A., Colombo, L.,
Donadio, S., Marinelli, F., Losi, F., Gualerzi, C. O., and Selva, E. (2006) Novel
tetrapeptide inhibitors of bacterial protein synthesis produced by a Streptomyces
sp. Biochemistry 45, 3692–3702.
14.
14 Brandi, L., Fabbretti, A., La Teana, A., Abbondi, M., Losi, D., Donadio, S.,
et al. (2006) Specific, efficient, and selective inhibition of prokaryotic translation
initiation by a novel peptide antibiatic. Proc Natl Acad Sci USA 103, 39–44.
15.
15 Brandi, L., Fabbretti, A., Di Stefano, M., Lazzarini, A., Abbondi, M., and
Gualerzi, C. O. (2006) Characterization of GE82832, a peptide inhibitor
of translocation interacting with bacterial 30S ribosomal subunits. RNA 12,
1262–1270.
16.
16 McCarthy, J. E., and Gualerzi, C. (1990) Translational control of prokaryotic
gene expression. Trends Genet. 6, 78–85.
17.
17 Cigan, A. M., and Donahue, T. F. (1987) Sequence and structural features
associated with translational initiator regions in yeast—A review. Gene 59, 1–18.
18.
18 Iizuka, N., Najita, L., Franzusoff, A., and Sarnow, P. (1994) Cap-dependent
and cap-independent translation by internal initiation of mRNAs in cell extracts
prepared from Saccharomyces cerevisiae. Mol. Cell Biol. 14, 7322–7330.
19.
19 Calogero, R. A., Pon, C. L., Canonaco, M. A., and Gualerzi, C. O. (1988)
Selection of the mRNA translation initiation region by Escherichia coli
ribosomes. Proc. Natl. Acad. Sci. USA 85, 6427–6431.
20.
20 Carroll, R., and Lucas-Lenard, J. (1993) Preparation of a cell-free trans-
lation system with minimal loss of initiation factor eIF-2/eIF-2B activity. Anal.
Biochem. 212, 17–23.
9
SPARK: A New Peptidyl Transferase Activity Assay
Alexander S. Mankin and Norbert Polacek
Summary
The formation of peptide bonds is the central chemical reaction during protein synthesis
and is catalyzed by the peptidyl transferase center residing in the large ribosomal subunit. This
active site is composed of universally conserved rRNA nucleosides. The peptidyl transferase
center is by far the most frequently used target site of natural antibiotics in the cell. Here we
describe a novel, simple, and convenient method to assess peptide bond formation which we
named SPARK. The basic principle of SPARK is the use of two reaction substrates that closely
resemble the natural tRNA substrates (one is biotinylated and the other carries a tritium label)
that become covalently connected during transpeptidation. Formation of this peptide bond then
allows capture and direct quantification of the radiolabled product, now joined to the biotin
group, using the scintillation proximity assay technology. Binding of the tritiated radioligand to
streptavidin-coated beads causes the excitation of the bead-embedded scintillant, thus resulting in
the detection of radioactivity. Since no product purification step is required, SPARK is amenable
to simple automation, which makes it useful in high-throughput screens of natural or synthetic
compound libraries in the search for novel antibiotics.
Key Words: ribosome; antibiotics; peptidyl transferase; high-throughput screening.
1. Introduction
All the proteins in the cell are synthesized by ribosomes, which use the
genetic information brought in the form of mRNA to polymerize amino
acids into functional polypeptides. The ribosome is an evolutionary preferred
antibiotic target: More than half of the known natural antibiotics inhibit growth
of bacteria by interfering with the functions of the translation apparatus.

107
108 A. S. Mankin and N. Polacek
Fig. 1. The principle of SPARK. a. The reaction of peptide bond formation (peptidyl
transfer reaction) catalyzed by the ribosome in the process of protein synthesis. In the
result of the reaction, the peptidyl residue (light gray circles) is transferred from the
P-site bound tRNA to the aminoacyl moiety (dark gray circle) of the A-site bound
aminoacyl-tRNA. b. SPARK-Pmn. The tritium-labeled formyl methionine (filled circle)
is transferred from the P-site bound formyl-[3 H]Met-tRNAfMet to the aminoacyl residue
(open circle) of biot CC-Pmn (biotin moiety is shown as a star). The reaction product
SPARK: A New Peptidyl Transferase Activity Assay 109
The ribosome consists of two subunits, large and small. Each of the subunits
is built of ribosomal RNA (rRNA) and ribosomal proteins, with rRNA being the
main structural and functional component of the ribosome. The key chemical
reaction catalyzed by the ribosome is the formation of new peptide bonds that
link amino acid residues into polypeptides. In the course of the reaction, the
growing polypeptide is transferred from the peptidyl-tRNA bound in the P-site
of the ribosome to the aminoacyl-tRNA bound in the ribosomal A-site. This
results in the elongation of the polypeptide by one amino acid (Fig. 1). In
chemical terms, the reaction involves a nucleophilic attack of the -amino group
of aminoacyl-tRNA on the carbonyl carbon atom of the ester bond that links
the peptidyl moiety to the 3’-hydroxyl of the 3’ terminal adenine residue of
peptidyl-tRNA. The reaction takes place in the active site of the catalytic center
of the large ribosomal subunit, which is called the peptidyl transferase center
(PTC). A great variety of natural antibiotics and their semisynthetic deriva-
tives bind at the PTC and interfere with peptide bond formation by obstructing
correct binding of the PTC substrates, peptidyl-tRNA and aminoacyl-tRNA,
or by affecting the orientation of critical nucleotides in the peptidyl trans-
ferase active site (1). Clinically important antibiotics such as lincosamides,
streptogramins A, oxazolidinones, and others act upon the PTC. Therefore, a
significant effort is dedicated to search for newer drugs that would inhibit trans-
lation by targeting the PTC, which arguably represents the best evolutionarily
and clinically validated antibiotic target.
The Scintillation Proximity Assay for Ribosome Kinetics (SPARK) is an
assay developed in collaboration with researchers at Pharmacia and Upjohn
(presently Pfizer) (2). SPARK provides a simple and efficient way to test
multiple compounds for their ability to inhibit peptide bond formation in a high-
throughput format. The reaction utilizes beads that carry embedded scintillant
(SPA beads, GE-Healthcare Bio-Sciences) and are coated with streptavidin.
SPA beads can detect the radioactivity of a tritium-labeled substrate bound on
the surface of the beads. One of the substrates used in SPARK assay carries

Fig. 1. (Continued) is captured by streptavidin-coated SPA beads, and the proximity
of the tritium source to the bead leads to activation of the bead-embedded scintillant.
c. SPARK-2T. The N-biotin-conjugated phenylalanine residue is transferred from the
P-site bound biotin-Phe-tRNAPhe to [3 H]Phe-tRNAPhe of the A-site bound aminoacyl-
tRNA. The reaction product is captured by streptavidin-coated SPA beads, and the
proximity of the tritium source to the bead leads to activation of the bead-embedded
scintillant.
a biotin tag, while the other is 3 H-labeled. The peptidyl transfer reaction (the
reaction of peptide bond formation) leads to a covalent linkage between the two
substrates and thus generates a biotinylated and tritium-labeled product that
can be monitored directly in the reaction mixture without further purification
(Fig. 1b–c). Depending on the experimenter’s needs, the reaction can utilize
various tRNA analogs. The activity of a complete (70S) ribosome or of an
isolated large (50S) ribosomal subunit can be assayed.
2. Materials
2.1. Ribosomes and S100 Supernatant
1. E. coli ribosomes and ribosomal subunits were prepared from the strain MRE600
or CAN20-12E, essentially as described in (3). A 25 g cell pellet is resuspended in
45 ml buffer A, 20 mM Tris-HCl, pH 7.5, 100 mM NH4 Cl, 10 mM MgCl2 , 0.5 mM
EDTA, 6 mM -mercaptoethanol, and lysed by passing the cells twice through a
French Press at 18,000 psi. The cell lysate is centrifuged for 15 min at 30,000X g
in an SS-34 rotor and the resulting supernatant incubated with 20 units RQ1 DNase
(Promega) for 5 min on ice. After another 15 min centrifugation at 30,000X g, the
cell lysate is layered on top of a 12 mL 1.1 M sucrose cushion prepared in buffer
B: 20 mM Tris-HCl, pH 7.5, 500 mM NH4 Cl, 10 mM MgCl2 , 0.5 mM EDTA
employing 32.4 mL Beckman Optiseal polyallomer tubes. Subsequent to a 17 h
ultracentrifugation at 100,000X g, the crude post-ribosomal supernatant (S100) is
removed and the ribosome pellet-washed with 5 mL buffer C: 50 mM Tris-HCl,
pH 7.6, 100 mM NH4 Cl, 10 mM MgCl2 , 6 mM -mercaptoethanol, and finally
resuspended in 300 μL buffer C. The concentration of the 70S ribosome prepa-
ration is determined by spectrophotometry (1A260 = 24 pmol 70S). The ribosome
concentration is adjusted to 24 μM, and the solution is aliquotted, snap-frozen, and
stored at –80°C.
2. In our experience, SPARK can be used with ribosomes from other Gram-positive
and Gram-negative species (Staphylococcus aureus, Thermus aquaticus, and others
(2,4)) without any modifications of the SPARK protocol.
3. The E. coli post-ribosomal supernatant (S100) containing aminoacyl-tRNA
synthetases is used for tRNA aminoacylation (5). The crude S100 supernatant from
Step 1 is dialyzed three times against 100 volumes of buffer D: 20 mM Hepes-
KOH, pH 7.6, 6 mM MgOAc2 30 mM NH4 Cl, 4 mM 2-mercaptoethanol for 30
min each at 4°C using a membrane with a molecular-weight cut-off of 3.5 kD. The
endogenous tRNAs are removed by batch treatment with DEAE-cellulose (Sigma-
Aldrich, St. Louis, MO) (this step also eliminates a substantial amount of cellular
RNases). 5 g of cellulose are resuspended in buffer E: 20 mM Hepes-KOH, pH
7.6, 10 mM MgOAc2 500 mM KCl prewarmed to 90°C, and incubated at 90°C
for 30 min. The supernatant is decanted, and the procedure repeated twice at 90°C
and three times with buffer F: 20 mM Hepes-KOH, pH 7.6, 10 mM MgOAc2
150 mM KCl at room temperature. The supernatant is removed, and the cellulose
matrix is left for at least 2 h at 4°C and subsequently combined with ∼50 mL S100
extract and incubated for 2 h at 0°C under occasional swirling. After centrifugation
(10,000X g at 4°C for 30 min in an SS-34 rotor), the supernatant is removed, and
the resin is resuspended in 15 mL of buffer F and incubated for 2 h on ice. The
resin is pelleted by centrifugation (10,000X g, 4°C, 30 min in an SS-34 rotor), and
the supernatant (fraction II) is saved. The elution step is repeated two more times
using 15 mL buffer F200: 20 mM Hepes-KOH, pH 7.6, 10 mM MgOAc2 200 mM
KCl (fraction III), and finally 15 ml buffer E (fraction IV). The resulting fractions
II, III, and IV are individually dialyzed four times against 2 L of buffer D for 45
min at 4°C and centrifuged for 30 min at 30,000X g at 4°C. Typically, fractions
II and III show the highest activities in tRNA aminoacylation reactions. The active
S100 fractions are stored in aliquots at –80°C.
2.2. tRNAs and mRNAs

1. E.coli MRE600 tRNAPhe and tRNAfMet (Sigma-Aldrich, St. Louis, MO) were
dissolved in water, their concentration adjusted to 100 μM, and stored in aliquots
at –20°C.
2. The 10X charging buffer for tRNA aminoacylation: 200 mM Hepes-KOH, pH 7.6,
80 mM MgCl2 , 1.5 M NH4 Cl, 40 mM -mercaptoethanol, 20 mM spermidine, and
0.5 mM spermine.
3. The formyl donor (leucovorin) required for preparation of formyl-Met-tRNAfMet
(fMet-tRNA) was synthesized by combining 5 mg of folinic acid (Sigma-Aldrich,
St. Louis, MO), 400 μL 50 mM -mercaptoethanol, and 44 μL 1 M HCl for 3 h at
room temperature (25°C). Aliquots of leucovorin were stored at –20°C.
4. The tritiated amino acids L-[2,6-3 H]-phenylalanine and L-[methyl-3 H]-methionine
were from GE-Healthcare Bio-Sciences (Piscataway, NJ).
5. Sulfosuccinamidyl 6-(biotinamido) hexanoate (Catalog # 21335ZZ, Pierce Biotech-
nology, Rockford, IL) was used for biotinylating the -amino group of aminoacyl
tRNAs, when necessary.
6. An RNA oligonucleotide AAGGAGAUAUAACAAUGGGU (Dharmacon)
containing a unique Met codon (underlined) or poly(U) (Sigma-Aldrich, St. Louis,
MO) was used as mRNA analogs.
2.3. Biotinylated Puromycin Derivatives

1. The 5’-biotin-puromycin derivative used in the original papers describing SPARK
(2,4) is no longer available from the commercial sources. However, 5’-biotin-CC-
puromycin (Biot CC-Pmn) (Dharmacon RNA Technologies, Lafayette, CO) can be
used as a substitute. Biot CC-Pmn is dissolved in water and stored in aliquots at a
concentration of 12 μM at –20°C.
2.4. Reaction Buffers for SPARK

1. SPARK-Pmn reaction buffer (2X): 40 mM Hepes-KOH, pH 7.6, 60 mM MgOAc2 ,
300 mM NH4 Cl, 8 mM -mercaptoethanol, 4 mM spermidine, and 0.1 mM
spermine.
2. SPARK-2T reaction buffer (2X): 40 mM Hepes-KOH, pH 7.6, 12 mM MgOAc2 ,
300 mM NH4 Cl, 8 mM -mercaptoethanol, 4 mM spermidine, and 0.1 mM
spermine (6).
3. SPARK stop mix: 0.45 mg SPA beads per 120 μL of 10 mM sodium phosphate
buffer, pH 7.4, 2.7 mM NaCl, and 125 mM EDTA (see Note 1).
2.5. SPA Beads and Product Detection

1. Streptavidin-coated SPA beads (catalog # RPNQ0006, GE-Healthcare Bio-Sciences,
Piscataway, NJ). The binding capacity of the SPA beads is 127 pmol biotin/mg
beads (see Note 2).
2. A 96-well-plate top counter (e.g., Top Count NXT, Perkin-Elmer) is used when
SPARK is performed in a 96-well-plate format.
3. A standard liquid scintillation counter (e.g., Beckman LS 6000IC) is used when
SPARK is performed in Eppendorf tubes (see Note 3).
3. Methods
SPARK can be used for studying catalysis of peptide bond formation (see
Note 4) or in screenings (low- or high-throughput) of natural or synthetic
compound libraries for new inhibitors of protein synthesis. It has been optimized
to be used with a full-size peptidyl-tRNA analog as a donor substrate and a
minimal A-site substrate analog, Biot CC-Pmn, as acceptor (SPARK-Pmn) or
with full-length peptidyl- and aminoacyl tRNAs (SPARK-2T).
3.1. Preparation of the Peptidyl-tRNA Donor Substrate

for SPARK-Pmn
1. Formyl-[3 H]Met-tRNAfMet is prepared in a final volume of 500 μL of 1X
charging buffer supplemented with ATP to a final concentration of 3 mM. The
reaction contains 5,000 pmol tRNAfMet , 10,000 pmol L-[methyl-3 H]-methionine
(6.5 Ci/mmol), 88 μL leucovorin solution (see Note 5), and 50 μL of S100 cell
lysate from E. coli (see Note 6).
2. The reaction is incubated for 25 min at 37°C.
3. Aminoacylation is stopped by adding 50 μL 3M NaOAc (pH 5.5) followed by the
addition of one reaction volume of water-saturated phenol and shaking for 5 min
at room temperature. After separation of the phases by centrifugation in a table-top
microcentrifuge (12,000 rpm, room temperature), the aqueous phase is transferred
to another tube and re-extracted with an equal volume of phenol/chloroform and
then with chloroform.
4. Formyl-[3 H]Met-tRNAfMet is precipitated by the addition of three volumes of ethanol

and incubation for 5 min at –70°C. The RNA pellet is recovered by centrifugation
(12,000 rpm, 4 C°), resuspended in water, and stored in aliquots at –80°C. Formyl-
[3 H]Met-tRNAfMet can be additionally purified by HPLC following the conditions
described in (7).
3.2. Monitoring Peptide Bond Formation by SPARK-Pmn

1. 24 pmol 70S ribosomes (1A260 = 24 pmol) are incubated in a final volume of
57.5 μL SPARK-Pmn reaction buffer with 76 pmol synthetic mRNA and 48 pmol
formyl-[3 H]Met-tRNAfMet for 10 min at 37°C (see Note 7).
2. The peptidyl transfer reaction is initiated by the addition of 2.5 μL of SPARK-Pmn
reaction buffer containing 30 pmol of biot CC-Pmn and performed at 37°C for 15
min (see Note 8).
3. The reaction is terminated by the addition of 2 volumes (120 μL) SPARK stop
solution (containing the SPA beads).
4. For best scintillation readouts, incubate for 1 h at room temperature to allow
complete binding of the reaction products to SPA beads and full bead settling prior
to counting radioactivity (see Note 9).
3.3. Preparation of the Peptidyl-tRNA Donor Substrate for SPARK-2T

1. Phe-tRNAPhe is prepared in a final volume of 500 μL of 1X charging buffer
supplemented with ATP to a final concentration of 3 mM. The reaction contains
5,000 pmol tRNAPhe , 10,000 pmol L-phenylalanine, and 50 μL of S100 cell lysate
from E. coli (see Note 6).
3. Aminoacylation is stopped by adding 50 μL of 3 M NaOAc (pH 5.5) followed by
the extraction with water-saturated phenol, phenol/chloroform, and chloroform and
ethanol precipitation as described in Section 3.1.
4. Biotin-Phe-tRNAPhe is prepared by combining 200 μL of 50 mM NaHCO3 (pH
8.2) containing 1700 pmol Phe-tRNAPhe with 100 μL of a 7 mg/mL solution of
sulfosuccinamidyl 6-(biotinamido) hexanoate and incubating 1 h on ice. Biotin-
Phe-tRNAPhe is then purified by HPLC following the procedure described in (7).
HPLC-purified biotin-Phe-tRNAPhe is ethanol-precipitated and dissolved in H2 O
(see Note 10).
3.4. Preparation of the Aminoacyl-tRNA Acceptor Substrate

for SPARK-2T
1. [3 H]Phe-tRNAPhe is prepared in a final volume of 1 mL of 1X charging buffer
supplemented with ATP to a final concentration of 3 mM. The reaction contains
10,000 pmol tRNAPhe , 30,000 pmol L-[3 H]-phenylalanine (6.5 Ci/mmol), and
100 μL of E. coli S100 cell lysate (see Note 6).

3. The reaction is stopped by adding 100 μL of 3 M NaOAc (pH 5.5) followed by
the extraction with water-saturated phenol, phenol/chloroform, and chloroform and
ethanol precipitation as described in Section 3.1. To improve the SPARK reaction
performance, [3 H]Phe-tRNAPhe can be further purified by HPLC as described in
(7), ethanol-precipitated, and resuspended in H2 O (see Note 11).
3.5. Monitoring Peptide Bond Formation by SPARK-2T

1. 7 pmol 70S ribosomes are incubated with 5.7 pmol biotin-Phe-tRNAPhe and 40 μg
of poly(U) in 22 μL SPARK-2T reaction buffer for 15 min at 37°C.
2. The peptidyl transfer reaction is initiated by the addition of 1.3 μL H2 O containing
5.2 pmol [3 H]Phe-tRNAPhe The reaction is incubated at 37° C for 20 min (see
Note 12).
3. The reaction is stopped by the addition of 47 μL SPARK stop solution (containing
the SPA beads) (see Note 13).
4. Notes
1. The SPARK stop mix should always be prepared freshly.
2. The SPA beads should be stored at 4°C and should not be frozen.
3. After the SPARK reaction performed in 1.5 mL Eppendorf tubes has been stopped,
the reaction mixture does not need to be pipetted into a scintillation vial; the
Eppendorf tube can be directly placed into the scintillation vial instead.
4. The kinetics of the peptidyl transferase reaction as measured by SPARK is slower
than that catalyzed by the ribosome in the living cell. This can be due to the
presence of biotin on one of the reaction substrates. However, all the tested well-
characterized inhibitors of peptide bond formation readily inhibit the reaction
monitored by SPARK (2,8).
5. Before adding leucovorin to the reaction, the pH of the leucovorin solution has to
be increased by adding 2 μL of 5 M KOH to a 120 μL aliquot in order to allow
complete dissolving.
6. It is important to adjust the final pH of the charging reaction to 7.5 by using 1 M
KOH before the S100 addition.
7. In SPARK reactions containing antibiotics, the drug is added after binding of the
donor (P-site) tRNA substrate prior to addition of the acceptor (A-site) substrate.
8. In SPARK-Pmn, the reaction with biot CC-Pmn as an acceptor substrate, a plateau
in product formation is reached after 30 min of incubation.
9. SPA beads register ∼35% of the radioactivity of the reaction products compared to
conventional liquid scintillation counting. The radioactivity of unreacted substrates
is essentially not registered, and background radioactivity values (obtained by
omitting ribosomes or the biotinylated substrate) are approximately 2 orders of
magnitude lower than the measured radioactivity of the reaction products produced
in the uninhibited reaction.
10. Biotin-Phe-tRNAPhe elutes in two distinct peaks from the HPLC C4 column.
While both fractions were shown to be biotinylated, only the slower-eluting tRNA
fraction is active in SPARK-2T.
11. HPLC purification of [3 H]Phe-tRNAPhe can be substituted with purification by
BD-cellulose column chromatography as described in (9).
12. Under these conditions, the reaction proceeds to completion and the entire
Phe-[3 H]Phe-tRNAPhe is converted into the dipeptidyl-tRNA product biotin-Phe-
[3 H]Phe-tRNAPhe .
13. SPARK-2T can also be used with isolated large ribosomal subunits instead of 70S
ribosomes. In this version of SPARK-2T, 14 pmol 50S subunits are incubated
with 11 pmol biotin-Phe-tRNAPhe in 28 μL of SPARK-Pmn reaction buffer for 10
min at 37°C. The reaction tube is then transferred on ice. 2 μL of H2 O containing
12 pmol [3 H]Phe-tRNAPhe are added, and the reaction is initiated by the addition
of 15 μL of cold methanol. The reaction is incubated on ice for 4 h and stopped
by the addition of 90 μL of SPARK stop mix (containing SPA beads).
Acknowledgments
The authors would like to thank Dean Shinabarger and Steven Swaney
(Pharmacia and Upjohn, currently Pfizer) for a fruitful collaboration leading to
the development of SPARK. Steven Swaney is additionally thanked for advice
on preparing the manuscript. This work was supported by NIH Grant GM
59028 to A.S.M. and by the Austrian Science Foundation (FWF) Grant P18709
to N.P.
References
1.
1 Polacek, N., and Mankin, A. S. (2005) The ribosomal peptidyl transferase center:
Structure, function, evolution, inhibition. Crit. Rev. Biochem. Mol. 40, 285–311.
2.
2 Polacek, N., Swaney, S., Shinabarger, S. D., and Mankin, A. S. (2002) SPARK—A
novel method to monitor ribosomal peptidyl transferase activity. Biochemistry 41,
11602–11610.
3.
3 Moazed, D., and Noller, H. F. (1989) Interaction of tRNA with 23S rRNA in the
ribosomal A, P, and E sites. Cell 57, 585–597.
4.
4 Polacek, N., Gaynor, M., Yassin, A., and Mankin, A. S. (2001) Ribosomal peptidyl
transferase can withstand mutations at the putative catalytic nucleotide. Nature 411,
498–501.
5.
5 Triana-Alonso, F. J., Spahn, C. M., Burkhardt, N., Rohrdanz, B., and Nierhaus, K. H.
(2000) Experimental prerequisites for determination of tRNA binding to ribosomes
from Escherichia coli. Methods Enzymol. 317, 261–276.
6.
6 Blaha, G., Stelzl, U., Spahn, C. M., Agrawal, R. K., Frank, J., and Nierhaus, K. H.
(2000) Preparation of functional ribosomal complexes and effect of buffer conditions
on tRNA positions observed by cryoelectron microscopy. Methods Enzymol. 317,

292–309.
7.
7 Erlacher, M. D., Lang, K., Shankaran, N., Wotzel, B., Huttenhofer, A., Micura, R.,
et al. (2005) Chemical engineering of the peptidyl transferase center reveals
an important role of the 2’-hydroxyl group of A2451. Nucleic Acids Res. 33,
1618–1627.
8.
8 Polacek, N., Gomez, M. G., Ito, K., Nakamura, Y., and Mankin, A. S. (2003) The
critical role of the universally conserved A2602 of 23S ribosomal RNA in the
release of the nascent peptide during translation termination. Mol. Cell 11, 103–112.
9.
9 Robertson, J. M., and Wintermeyer, W. (1981) Effect of translocation on topology
and conformation of anticodon and D loops of tRNAPhe . J. Mol. Biol. 151, 57–79.
10
High-Throughput Screening of Peptide Deformylase

Inhibitors
Kiet T. Nguyen and Dehua Pei
Summary
The emergence of bacterial pathogens resistant to current antibiotics has caused an urgent
demand for new treatments. Peptide deformylase (PDF) has become an exciting target for
designing novel antibiotics. To facilitate the screening of PDF inhibitors, three robust, coupled
assays have been developed. The first method couples the PDF reaction with that of formate
dehydrogenase. Formate dehydrogenase oxidizes formate into CO2 with a concomitant reduction
of NAD+ to NADH, which can be monitored spectrophotometrically. The second method
involves Aeromonas aminopeptidase (AAP) as the coupling enzyme and an artificial substrate,
f-Met-Leu-p-nitroanilide. The sequential action of PDF and AAP releases p-nitroanilide as a
highly chromogenic product. In the third method, f-Met-Lys-7-amino-4-methylcoumarin is used
as the substrate. Deformylation by PDF gives an excellent substrate for dipeptidyl peptidase I,
which releases the dipeptide Met-Lys and fluorogenic 7-amino-4-methylcoumarin. The combi-
nation of these assay methods should meet the needs of most laboratories.
Key Words: antibacterial agents; Aeromonas aminopeptidase; continuous assay; end-point

assay; dipeptidyl peptidase I; peptide deformylase; deformylase inhibitor; formate dehydrogenase;
N-formyl substrates.
1. Introduction
Peptide deformylase (PDF) has emerged as an exciting target for designing
novel antibacterial drugs to combat the ever-increasing antibiotic-resistant
pathogens (1–4). Bacterial protein biosynthesis starts with N-formylmethionine,
and, as a result, all newly synthesized polypeptides carry an N-terminal formyl

117
118 K. T. Nguyen and D. Pei
group (5). PDF catalyzes the hydrolytic removal of the N-formyl moiety from
the vast majority of these polypeptides. Subsequently, many of these polypep-
tides undergo further processing by methionine aminopeptidase to produce
mature proteins (6). The essentiality of PDF has been demonstrated both
by genetic studies (7–9) and by growth inhibition by PDF inhibitors (1–4).
PDF is present in all eubacteria and has a highly conserved active site,
which contains a tetrahedrally coordinated and catalytically essential divalent
metal ion (Fe2+ in most bacteria) (10,11). Although PDF is also present in
human mitochondrion, its physiological function in the mitochondrion remains
controversial, and specific PDF inhibitors have shown little toxicity to human
cells (12). These properties have made PDF an attractive antibacterial drug
target.
Many potent PDF inhibitors have been reported in recent years, and one of
the inhibitors has already advanced into phase I clinical trials for the treatment
of upper respiratory tract infections. To facilitate mechanistic study of this
enzyme and screening of PDF inhibitors, several robust assays have been
developed for PDF. One method monitors the release of formate by formate
dehydrogenase (FDH) as the coupling enzyme (Fig. 1a) (13,14). Oxidation
of formate into CO2 is coupled with the reduction of NAD+ into NADH,
which can be monitored at 340 nm. The second assay method employs N-
formylmethionyl-leucyl-p-nitroanilide (f-ML-pNA) as the substrate, and the
PDF reaction is coupled with Aeromonas aminopeptidase (AAP). Deformy-
lation by PDF releases ML-p-nitroanilide, which is sequentially hydrolyzed
by AAP to release methionine, leucine, and the chromophore p-nitroaniline
(Fig. 1b) (15). The third method employs N-formylmethionyl-lysyl-7-amino-
4-methylcoumarin (f-MK-AMC) as the substrate (16). The PDF reaction
produces MK-AMC as its product, which is an excellent substrate for dipep-
tidyl peptidase I (DPPI). DPPI hydrolysis generates 7-amino-4-methylcoumarin
as the chomophore/fluorophore (Fig. 1c). Although each assay method has its
strengths and weaknesses, a combination of the three methods should meet
most of the assay needs.
As mentioned above, native PDFs from most bacteria contain a Fe2+ ion in
the active site, which makes them extremely unstable under aerobic conditions
(17). A common practice has been to replace the Fe2+ ion with a more stable
metal ion such as Co2+ , Ni2+ , or Zn2+ . Both Ni(II)- and Co(II)-substituted PDF
variants retain essentially full catalytic activity and are highly stable (11,18,19).
They are frequently used in mechanistic studies and PDF inhibitor screening.
The Zn(II)-substituted enzyme is very stable but has greatly reduced activity
(>100-fold).
Peptide Deformylase 119
a MAS NAD+ NADH

O O
CO2
H MAS PDF H OH FDH
b
S S
O O NO2 NO2
H H O
PDF
N N
H N N H2N N
H O H O H
HCO2H
S
AAP
OH + H N OH + H2N NO2
H2N 2
O O
c
S S
O O H O
H PDF
N N
H N N O O H2N N O O
H O H O H
HCO2H
NH2 NH2
S
DPPI
H O
N +
H2N OH
O H2N O O
NH2
Fig. 1. Reactions involved in PDF coupled assays. (a) With FDH as coupling
enzyme; (b) with AAP as coupling enzyme; and (c) with DPPI as coupling enzyme.
2. Materials
2.1. Bacterial Strains and Expression Vectors
1. Escherichia coli strain DH5 cells [F− , 80dlac(lacZ)M15 (lacZYA-argF),
U169, endA1, recA1, hsdS17 (rK − m K + ), deoR, thi-1, supE44, gyrA96, relA1] for
subcloning and construction of expression vectors.
2. E. coli strain BL21 (DE3) cells [F− ,OmpThsdS B (rB − m B − ), gal, dcm, met (DE3)].
This is used for protein overexpression (see Note 1).
3. Plasmid pET22b(+) (Novagen, Madison, WI) as cloning and expression vector to
add a histidine tag to the C-terminus of PDF. Clone PDF gene by polymerase
chain reaction (PCR) and ligate it into NdeI and XhoI sites of pET22b to construct
pET22b-PDF.
2.2. Buffers and Materials for Protein Expression and Purification

1. Luria-Bertani (LB) media: 10 g/L Bacto Tryptone (Difco), 5 g/L yeast extract
(Difco), 5 g/L NaCl. Prepare the media in double-distilled H2 O, and autoclave it
before use.
2. Minimal media: 5 g/L Bacto casamino acids (acid hydrolysate of casein, Difco),
10.8 g/L K2 HPO4 , 5.5 g/L KH2 PO4 , 10 g/L NaCl in Millipore water with a
resistance at dissipation of 18.3 M. Autoclave at 121 °C for 20 min.
3. 1000X Trace metal supplement: 124 mg/L MgSO4 7H2 O, 74 μg/L CaCl2 2H2 O,
20 μg/L MnCl2 4H2 O, 31 μg/L H3 BO3 , 1.2 μg/L (NH4 )6 Mo7 O24 4H2 O, 1.6 μg/L
CuSO4 in 0.1 M HCl solution.
4. 100X Nutrient mix: 25% D-(+)-glucose, 10% ammonium sulfate, 20 mg/mL
thiamine (Sigma), and 10 mg/mL D-(+)-biotin (Sigma). Sterilize the solution by
filtration through a 0.45 μM nitrocellulose membrane filter (Nalgen).
5. Isopropyl--D-thiogalactopyranoside (IPTG) (Sigma) should be prepared fresh at
1000X concentration (100 mM stock) and filtered through the 0.45 μM membrane.
6. Lysis buffer (buffer A): 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic
acid (HEPES), pH 7.9, 500 mM NaCl, 5 mM imidazole, 0.1 mg/mL phenylmethyl-
sulfonyl fluoride (PMSF), 40 μg/mL trypsin inhibitor, 100 μg/mL lysozyme, 1%
Triton X-100, 0.05% protamine sulfate. All reagents are from Sigma. Prepare fresh
buffer.
7. Tris(2-carboxyethyl)phosphine (TCEP) (Aldrich, Milwaukee, WI).
8. Talon resin (Clontech, Mountain View, CA) for cobalt affinity column chromatog-
raphy.
9. Talon column wash buffer (buffer B): 20 mM HEPES, pH 7.9, 500 mM NaCl,
5 mM imidazole. Store at 4 °C.
10. Talon column elution buffer (buffer C): 20 mM HEPES, pH 7.9, 150 mM NaCl,
60 mM imidazole.
11. Dialysis buffer (buffer D): 20 mM HEPES, pH 7.0, 150 mM NaCl. Store at 4 °C.
12. Ni-NTA His-bind Resin (Novagen).
13. Ni-NTA His-bind buffer (buffer E): 50 mM sodium phosphate, pH 8.0, 300 mM
NaCl, 10 mM imidazole. Store at 4 °C.
14. Ni-NTA elution buffer (buffer F): 50 mM sodium phosphate, 300 mM NaCl; 125
mM imidazole. Store at 4 °C.
15. Enzyme assay buffers. 10X FDH assay buffer (buffer G): 500 mM sodium
phosphate, pH 7.0; 10X AAP assay buffer (buffer H): 500 mM HEPES, pH 7.0,
1.5 M NaCl; 10X DPPI assay buffer (buffer I): 500 mM HEPES, pH 7.0, 1.5 mM
NaCl, 50 mM DTT. Store at room temperature.
16. Anion exchange buffers. Low-salt buffer (buffer J): 20 mM 2-[N-
morpholino]ethanesulfonic acid (MES), pH 6.0, 10 mM NaCl. High-salt buffer:
20 mM MES, pH 6.0, 1.0 M NaCl. Store at 4 °C.
17. Enzyme dilution buffer (buffer K): 50 mM HEPES, pH 7.0, 100 μg/mL bovine
serum albumin.
18. MonoQ HR 5/5 FPLC anion exchange column (Pharmacia).
2.3. Protein Quantitation and Storage

1. Protein assay dye reagent concentrate (Bio-Rad, Hercules, CA). Dilute 1 part of dye
concentrate to 4 parts of ddH2 O and store in a plastic bottle. The diluted solution
is good for up to 2 weeks at room temperature.
2. Bovine serum albumin (BSA) protein standard (Pierce, Rockford, IL). Samples are
stored as stocks of 2 mg/mL in ampules at 4 °C until use.
3. Purified PDFs are stored in 33% glycerol (v/v) by quick freeze in liquid nitrogen
and stored at –80 °C (see Note 2).
2.4. PDF Substrates

1. f-Met-Ala-Ser (f-MAS, Bachem) is dissolved in ddH2 O to make 10–100 mM stock
solutions. To determine the concentration of f-MAS (or other N-formylmethionyl
peptides) stock, the stock solution is diluted 50–100-fold into 1 mL of 50 mM
sodium phosphate, pH 7.0. Five to 10 μg of Co-EcPDF (1 μL) are added, and
the reaction is allowed to proceed at room temperature for 30 min to ensure the
complete release of the formate. Next, 5–10 U of FDH and 5 mM of NAD+ (final
concentration) are added, and the mixture is incubated at room temperature for 30
min. The absorbance at 340 nm is measured on a UV-Vis spectrophotometer. The
formate concentration is calculated using a molar absorptivity (340 nm ) of 6300
M−1 cm−1 .
2. f-ML-pNA (Bachem) stock solution is prepared by dissolving 5–10 mg of solid in
5 mL ethanol. To quantitate the f-ML-pNA stock concentration, dilute the stock
(50–100-fold) into 1 mL of 1 M NaOH. Heat the solution at 95 ºC for 10 min
to ensure complete hydrolysis. The solution will turn yellowish as hydrolysis of
f-ML-pNA releases the chromogenic pNA. The absorbance at 405 nm is measured,
and the concentration of f-ML-pNA is calculated (pNA molar absorptivity 405 nm =
10,600 M−1 cm−1 ). The stock solution (5–10 mM) is stored at -20 ºC (see Note 3).
3. f-MK-AMC is not yet commercially available but can be easily prepared in a chemical
or biochemical laboratory (16). A stock solution is prepared in DMSO and stored
at -20 ºC. The concentration is determined by diluting the stock solution 10–100-
fold in 1 mL containing 50 mM HEPES, pH 7.0, 150 mM NaCl, and 5–10 μg of
Co-EcPDF. The reaction mixture is incubated at room temperature and covered with
aluminum foil for 3 h to allow the complete removal of the N-formyl moiety. Next,
5 mM DTT (final concentration) and 1 U of DPPI are added and incubated at room
temperature for 1 h to allow the complete release of the chromogenic 7-amino-4-
methylcoumarin (AMC). The absorbance at 360 nm is measured, and the concentration
of f-MK-AMC is calculated (AMC molar absorptivity e360 nm = 17,000 M−1 cm−1 ).
2.5. PDF Coupling Enzymes

1. Candida boidinii FDH (Sigma, St. Louis, MO) stock solution (5 U/μL) is prepared
in 50 mM sodium phosphate, pH 7.0, and aliquots are stored frozen at –80°C (see
Note 4).
2. Aeromonas proteolytica AAP (Sigma, St. Louis, MO) stock solution (50 U/mL) is
prepared in 50 mM HEPES, pH 7.0, 150 mM NaCl. Aliquots are stored frozen at
–20°C (see Note 5).
3. DPPI (Sigma, St. Louis, MO) stock solution (5 U/mL) is prepared in 50 mM
HEPES, pH 7.0, 10 mM NaCl, 5 mM DTT. Aliquots are stored frozen at –80 °C
(see Note 6).
3. Methods
Since each PDF assay method has its advantages and disadvantages, we
make the following recommendations. For routine kinetic assays of wild-type
and mutant PDF in the absence of PDF inhibitors, the AAP-coupled assay is
the best choice. f-ML-pNA is an excellent substrate of PDF, and the released
p-nitroaniline has a large extinction coefficient, making this method highly
sensitive. Also, the released ML-pNA is rapidly hydrolyzed by AAP, so the
assay reaction can be conveniently performed in a continuous fashion. AAP is
a very stable enzyme and easy to purify to near homogeneity. The disadvantage
of this method is that AAP is also a metallopeptidase and therefore often
strongly inhibited by PDF inhibitors, which are usually metal chelators. Both
FDH and DPPI assays may be employed to screen PDF inhibitors. The FDH
assay has the advantage that PDF inhibitors seldom affect the FDH reaction.
However, FDH is a rather inefficient enzyme, and the coupled assay is typically
performed in an end-point (discontinuous) fashion. If kinetic characterization
of a PDF inhibitor is desired or if the PDF inhibitor is exceptionally potent (low
KI -value), the DPPI assay is the method of choice. This method is extremely
sensitive because f-MK-AMC is a very efficient substrate of PDF, MK-AMC
is an excellent substrate of DPPI, and detection is based on fluorescence. Since

DPPI, a cysteine protease, is not inhibited by PDF inhibitors, the coupled assay
can be carried out in a continuous fashion in the presence of PDF inhibitors.
However, for applications that require high substrate concentrations, which
cause internal fluorescence quenching, the DPPI assay is best performed in the
absorbance mode.
3.1. Purification of PDF

3.1.1. Bacterial Cell Growth
1. Prepare minimal media for bacterial culture. Add 10 mL of 100X nutrient mix, 1
mL of 1000X trace metal supplement, and 1 mL of 75 mg/mL ampicillin to 1 L of
minimal media.
2. Inoculate 100 mL of the above minimal media with a single colony of E.
coli BL21(DE3) cells harboring the pET22b-PDF expression vector and incubate
overnight at 37 °C with shaking.
3. Next morning, dilute 10 mL of the overnight culture into 1 L of the prepared
minimal media. Incubate at 37 °C with shaking until OD600 nm reaches 0.5–0.7.
This typically takes ∼3 h.
4. Add 1 mL of 100 mM IPTG and 1 mL of 100 mM CoCl2 (or FeCl3 , or 50 mM
NiCl2 ) to each flask containing 1 L of cell culture.
5. Reduce the temperature to 30 °C, and continue to shake for an additional 6 h.
6. Pellet the cells by centrifugation at 5000X g in a GS3 rotor for 5 min.
7. Wash the cell pellet with 50 mM sodium phosphate, pH 7.0.
8. The cells may be immediately used in protein purification or stored at –80 ºC until
later use.
3.1.2. Purification of PDF

3.1.2.1. Co(II)-PDF-HT
1. If the cell pellet is frozen, slowly thaw it out on ice.
2. For cells derived from 3 L of cell culture, add 100 mL of lysis buffer.
3. Stir the cells in a cold room for 30 min to make a fine suspension.
4. Lyse the cells by sonication (5 × 8 s pulses) over a 30-min period. Be sure not to
heat up the solution.
5. Remove cell debris by centrifugation at 15,000 rpm (27,000X g) (SS-34 rotor) for
30 min.
6. Load the supernatant onto a Talon column (20 mL of resin) that has been pre-
equilibrated in buffer B. Wash the column with the same buffer (3 × 50 mL).
7. Elute the bound PDF protein with buffer C.
8. Collect PDF-active fractions, which can be located by SDS-PAGE analysis or
activity assays. For Co(II)-PDF, protein fractions are lightly pink colored. Protein
purified by this method is typically free of major impurities and may be used
directly in PDF activity assays.
9. Dialyze the protein against 2 L of dialysis buffer at 4 ºC (two buffer changes) to
remove imidazole from the sample. If necessary, the dialyzed protein solution can
be concentrated by ultrafiltration using aYM-3 membrane filter. Glycerol is added
to the protein to a final concentration of 33%, and the resulting mixture is quickly
frozen in liquid N2 and stored at -80 ºC. Protein concentration is determined by the
Bradford method using bovine serum albumin as standard.
3.1.2.2. Ni(II)-PDF-HT
1. The cell pellet from 3 L of culture is resuspended in 100 mL of lysis buffer plus
5 mM NiCl2 .
2. Cell lysis is carried out similarly as described above.
3. The crude lysate (supernatant) is loaded onto an Ni-NTA column (20 mL of resin).
Wash the column with 3 × 50 mL of buffer E.
4. Elute the bound Ni(II)-PDF-HT as described above with buffer F.
5. Pool the PDF fractions (∼50 mL) and precipitate the protein by the addition of
ammonium sulfate to 80% saturation. Dissolve the precipitate in 10 mL of buffer J
and load it onto a FPLC MonoQ HR 5/5 column (AKTA, Pharmacia) that has been
equilibrated in buffer J. Elute the bound PDF by a linear gradient of 10 mM–1 M
NaCl in buffer J.
6. Collect fractions containing significant PDF activity and analyze their purity on a
15% SDS-PAGE gel.
7. Pool the pure PDF fractions and dialyze the protein against buffer D plus 50 μM
NiCl2 at 4 ºC (2 buffer changes). The resulting protein is concentrated and stored
as described above.
3.1.2.3. Fe(II)-PDFH6
1. All buffers must be degassed by first applying a vacuum and then sparging with a
dry inert gas (He or Ar) for 30 min.
2. Add a freshly prepared TCEP solution to the lysis buffer to give a final concentration
of 1 mM. Buffers for all subsequent purification steps must contain 0.5 mM TCEP,
and purification steps are carried out as fast as possible.
3. Cell lysis and purification on Talon column are carried out as described above.
4. The PDF fractions from the Talon column are concentrated by ammonium sulfate
precipitation (80% saturation).
5. Dissolve the protein pellet in 5 mL of degassed 20 mM HEPES, pH 7.0, 150 mM
NaCl, 1 mM TCEP. The sample is frozen and stored at –80 ºC.
3.2. FDH Coupled Assay

This method utilizes the activity of Candida boidinii FDH. The formate
released by PDF is oxidized into CO2 by FDH while reducing NAD+ to NADH
(Fig. 1a). The formation of NADH is monitored at 340 nm (340 nm = 6300

M−1 cm−1 ) on a UV-Vis spectrophotometer. Peptide f-MAS is usually used
as substrate, although any N-formylmethionyl peptide will also work. Co(II)-
substituted E. coli PDF (Co-EcPDF) has a kcat /KM -value of 2.9 × 104 M−1 s−1
toward this substrate (18). A major advantage of this method is that PDF
inhibitors do not typically inhibit FDH. However, FDH is inhibited by a high
salt concentration (e.g., >50 mM NaCl). In addition, FDH has low specific
activity for formate (kcat of 0.9 s−1 and KM of 2.5 mM), making the FDH
reaction partially rate-limiting as manifested by an early lag phase (0–20 s).
Consequently, screening for PDF inhibitors by this method is often carried out
in an end-point fashion.
3.2.1. Continuous Assay

1. Prepare f-MAS substrate stock solution in ddH2 O (typically, 10–100 mM).
2. To a quartz cuvette with a 1 cm optical path, sequentially add 20 μL of 10X FDH
assay buffer, 20 μL of 100 mM NAD+ stock solution, 20 μL of f-MAS (1 mM final
concentration), 1.0 U of FDH, a proper concentration of PDF inhibitor, and ddH2 O
to adjust the total volume to 190 μL.
3. Initiate the reaction by the addition of 10 μL of diluted PDF working stock (0.1–
10 μg).
4. Monitor the reaction at 340 nm on a UV-Vis spectrophotometer.
3.2.2. End-Point Assay

1. To a microcentrifuge tube, add 30 μL of 10X FDH assay buffer, 30 μL of f-MAS
(1 mM final concentration), a proper concentration of PDF inhibitor, and ddH2 O to
make a total volume of 290 μL.
2. Add 10 μL of PDF (0.1–10 μg) to initiate the reaction. Allow the reaction to proceed
for 60 s at room temperature (see Note 7).
3. Quench the reaction by heating in a boiling water bath for 5 min (see Note 8).
4. Cool the mixture to room temperature, and centrifuge at 14,000 rpm (17,000X g)
for 5 min in a microcentrifuge.
5. Add 50 μL of 100 mM NAD+ , 0.2 U of FDH, and ddH2 O to bring it to total volume
of 500 μL.
6. Allow the reaction to proceed to completion at room temperature (∼10 min).
7. Measure the OD340 nm in a UV-Vis spectrophotometer.
8. Calculate the inhibition constants.
3.3. AAP Coupled Assay

This assay utilizes AAP as the coupling enzyme and f-ML-pNA as substrate
(Fig. 1b). Removal of the N-formyl group by PDF produces ML-pNA, which is
subsequently hydrolyzed by AAP into Met, Leu, and p-nitroaniline. f-ML-pNA

is an excellent substrate of PDF (e.g., Co-EcPDF has a KM -value of 20 μM, a
kcat -value of 38 s−1 , and a kcat /KM -value of 1.9 × 106 M−1 s−1 ). ML-pNA is also
a very efficient substrate of AAP. For example, the last step, the hydrolysis of
Leu-pNA, is extremely fast, with a KM -value of 38 μM, a kcat -value of 28 s−1 ,
and a kcat /KM -value of 7.5 × 105 M−1 s−1 . The released chromophore (pNA) has
a large molar absorptivity (405 nm = 10,600 M−1 cm−1 ). These features make the
AAP assay highly sensitive, convenient to perform, and relatively inexpensive.
However, AAP enzyme is also a zinc metallopeptidase and may be inhibited
by PDF inhibitors. Therefore, this assay is most useful for mechanistic studies
of wild-type and mutant PDF in the absence of inhibitors, or screening of PDF
inhibitors in the end-point fashion (15).
3.3.1. Continuous Assay
1. The assay reaction is most conveniently carried out in a disposable 1.5-mL
polystyrene cuvette.
2. To the cuvette, add 100 μL of 10X AAP assay buffer, 0–200 μM f-ML-pNA, 0.8
U AAP, and ddH2 O to make a total volume of 990 μL.
3. Initiate the reaction by the addition of 10 μL of PDF (0.1–1 μg) diluted in buffer K
(50 mM HEPES, pH 7.0, 100 μg/mL bovine serum albumin).
4. Monitor the reaction progress at 405 nm on a UV-Vis spectrophotometer. The initial
reaction rate is calculated from the first 60 s of the reaction progress curve.
5. Reactions at the lowest and highest substrate concentrations are generally repeated
with a doubled amount of AAP (1.6 U) to ensure that the PDF reaction is rate-
limiting in the coupled reaction sequence.
3.3.2. End-Point Assay

1. Assay reactions are typically carried out in 1.7-mL microcentrifuge tubes with a
200-μL total reaction volume (see Note 8).
2. Add 20 μL of 10X AAP assay buffer, 0–200 μM f-ML-pNA, a proper concentration
of PDF inhibitor, and ddH2 O to make a total volume of 190 μL.
3. Initiate the reaction by the addition of 10 μL of diluted PDF (0–90 ng), and incubate
at room temperature for 60 s.
4. Quench the reaction by quickly placing the reaction tubes in a 95 °C water bath for
5 min. PDF inactivation typically occurs in less than 30 s.
5. Remove the tubes from the water bath, cool to room temperature, and spin for
5 min in a microcentrifuge.
6. Add 0.4 U AAP and incubate the mixture at room temperature for 30 min.
7. Transfer the reaction contents into a microcuvette and measure the absorbance
at 405 nm on a UV-Vis spectrophotometer. For samples at low-substrate and/or
-inhibitor concentrations, the percentage of substrate-to-product conversion should
be calculated. This is done by comparing the amount of pNA formed and the
initial concentration of f-ML-pNA. It is imperative that the percentage does not
exceed 20%.
3.4. DPPI Coupled Assay

The DPPI coupled assay uses N-formyl-Met-Lys-AMC as a highly efficient
PDF substrate, which has a KM -value of 40 μM, a kcat -value of 26 s−1 , and
a kcat /KM -value of 6.5 × 105 M−1 s−1 toward Co-EcPDF. Removal of the N-
formyl moiety by PDF gives MK-AMC as a product, which is rapidly converted
into dipeptide Met-Lys and 7-amino-4-methylcoumarin (KM = 2.8 μM, kcat
= 5.7 s−1 , and kcat /KM = 2.1 × 106 M−1 s−1 ) (Fig. 1c). Coupled with fluores-
cence detection, this method is therefore extremely sensitive. This method
is ideally suited for PDF inhibitor screening. PDF inhibition assays can be
carried out in a continuous fashion by simply adding the proper PDF inhibitor
into the reaction mixture. This latter feature is especially useful for real-
time kinetic experiments and has been applied to determine the slow-binding
kinetics of macrocyclic PDF inhibitors (16,20). A minor drawback of this
method is the presence of slight background hydrolysis of f-MK-AMC by DPPI
(KM = 82 μM, kcat = 0.06 s−1 , and kcat /KM = 760 M−1 s −1 ). This is not a
major problem for routine kinetic assays or inhibitor screening involving the
wild-type PDF. However, this background reaction may become significant
and thus complicate the assay results involving catalytically impaired PDF
mutants.
1. The following procedure is based on detection in the absorbance mode (see Note 9).
Assay reactions are carried out in quartz microcuvettes.
2. Prior to use, DPPI is treated with 5 mM DTT for 30 min on ice in 50 mM HEPES,
pH 7.0, 10 mM NaCl.
3. Prepare fresh 10X DPPI assay buffer each day by adding 50 mM DTT to the buffer.
4. Prepare inhibitor stock solutions (1 mM) in DMSO since many PDF inhibitors have
limited solubility in aqueous solution. Working stock solutions of 10–100 μM are
prepared from this original stock by diluting in DMSO.
5. A typical assay reaction has a 200-μL total volume. To a microcuvette, add 20 μL
of the 10X DPPI assay buffer, 1–5 μL of working inhibitor stock solution (0–200
nM final concentration), 0.1 U of DPPI, 100 μM f-MK-AMC, and ddH2 O to bring
the reaction volume to 195 μL. Place the cuvette in the spectrophotometer and
monitor the reaction for 30 s at 360 nm. The slope of the curve gives the amount
of background hydrolysis of substrate by DPPI.
6. The PDF reaction is then initiated by the addition of 5 μL of PDF (4.0 nM final
concentration). The reaction is monitored continuously for another 60–120 s. The
initial rate is calculated from the early region of the progress curve (0–30 s after
the addition of PDF) and corrected by subtracting the background rate from above.
7. The inhibition constant (KI ) is calculated according to the equation
V = Vmax ×
S/ KM 1 +
I/KI +
S
4. Notes
1. Expression of eukaryotic PDF in E. coli may suffer from low yields due to codon
usage bias. This problem can be alleviated by the use of the E. coli BL21 (DE3)
Rosetta strain (Novagen). This particular strain carries rare tRNA synthetases, which
recognize rare codons that are normally found in E. coli but frequently encountered
in G+C-rich DNA.
2. Fe(II)-PDF is very unstable when stored as a solution, even when every effort is
made to remove reactive oxygen species. However, it is stable for at least 1 year
when stored frozen at –80 °C. We recommend that it be stored in small aliquots
at –80 °C and that a fresh aliquot be thawed on ice and used at least once a day.
Co(II)-, Ni(II)-, and Zn(II)-EcPDF are more stable and can be stored at 4 °C for
weeks without significant loss of activity.
3. f-ML-pNA has a maximal solubility of ∼200 μM in aqueous solution. Prepare
the solution at neutral pH. Acidic pH facilitates hydrolysis of the N-formyl group,
whereas basic pH promotes hydrolysis of the pNA group.
4. Formate dehydrogenase is sensitive to chloride ions. Samples come as lyophilized
powder. One unit will oxidize 1.0 μmole of formate to CO2 per min in the presence
of -NAD at pH 7.6 at 37 °C. It is less problematic when the assay is monitored at
365 nm. Co(II)-PDF has strong absorption near 340 nm.
5. AAP is a zinc-containing enzyme. Samples come in lyophilized powder. Often, AAP
obtained from Sigma contains background endopeptidase activity. The Prescott and
Wilkes method employing the gelatin digestion assay can measure the endopeptidase
activity (21). The residual enzyme activity can often be removed by heating the
stock enzyme solution at 65 °C for 2 h. One unit will hydrolyze 1.0 μmole of
L-leucine-p-nitroanilide to L-leucine and p-nitroaniline per min at pH 8.0 at 25 °C.
Working stock samples can be stored at 4 °C for up to 2 weeks. Avoid freeze-
thaw cycles. Since this assay is the method of choice in our lab for routine PDF
characterization, we found it to be economical to purify AAP from Aeromonas
proteolytica by the Prescott and Wilkes method (21).
6. Dipeptidyl peptidase I from bovine spleen is a cysteine protease and must be
reactivated with 5 mM dithiothreitol (DTT) for 30 min on ice in 50 mM HEPES,
pH 7.0, 10 mM NaCl before use. Samples come in lyophilized powder. The enzyme
is very unstable and must be stored frozen. One unit will produce 1 μmole of
Gly-Phe-NHOH from Gly-Phe-NH2 and hydroxylamine per min at pH 6.8 at 37 °C

using DL-phenylalanine hydroxamic acid as the standard.
7. The reaction time should be short due to rapid inactivation of Fe-PDF under the
assay conditions. For Co- and Ni-PDF, which are stable, smaller amounts of PDF
and longer reaction times (5–10 min) are recommended.
8. Smaller sample volumes are easier to quench with heating. Alternatively, the
reaction can be terminated by the addition of 25 μL of 1 M HCl. The reaction is
neutralized by the addition of 25 μL of 2 M HEPES, pH 7.0. Make sure that the
final reaction is at pH ∼7 by testing it with a pH paper before adding AAP. If the
pH is not ∼7, adjust the pH to 7 by adding additional 2 M HEPES, pH 7.0 solution.
9. PDF inhibition assay can also be monitored in the fluorescence mode on an Aminco-
Bowman Series 2 Luminescence spectrometer and adapts a similar procedure to the
absorbance mode. The excitation and emission wavelengths are set at 380 and 460
nm, respectively.
Acknowledgments
This work was supported by NIH Grant AI40575.
References
1.
1 Giglione, C., Pierre, M., and Meinnel, T. (2000) Peptide deformylase as a target
for new generation, broad spectrum antimicrobial agents. Mol. Microbiol. 36,
1197–1205.
2.
2 Pei, D. (2001) Peptide deformylase: A target for novel antibiotics? Emerging Ther.
Targets 5, 23–40.
3.
3 Yuan, Z, Trias, J., and White, R. J. (2001) Deformylase as a novel antibacterial
target. Drug Discovery Today 6, 954–961.
4.
4 Clements, J. M., Beckett, R. P., Brown, A., Catlin, G., Lobell, M., Palan, S.,
Thomas, W., Whittaker, M., Wood, S., Salama, S., Baker, P. J., Rodgers, H. F.,
Barynin, V., Rice, D. W., and Hunter, M. G. (2001) Antibiotic activity and charac-
terization of BB-3497, a novel peptide deformylase inhibitor. Antimicrob. Agents
Chemother. 45, 563–570.
5.
5 Meinnel, T., Mechulam, Y., and Blanquet, S. (1993) Methionine as translation start
signal: A review of the enzymes of the pathway in Escherichia coli. Biochimie
75, 1061–1075.
6.
6 Ben-Bassart, A., Baur, K., Chang, S. Y., Myambo, K., Boosman, A., and Chang, S.
(1987) Processing of the initiation methionine from proteins: Properties of the
Escherichia coli methionine aminopeptidase and its gene structure. J. Bacteriol.
169, 751–757.
7.
7 Mazel, D., Pochet, S., and Marliere, P. (1994) Genetic characterization of
polypeptide deformylase, a distinctive enzyme of eubacterial translation. EMBO J.
13, 914–923.
8.
8 Meinnel, T., and Blanquet, S. (1994) Characterization of the Thermus thermophilus
locus encoding peptide deformylase and methionyl-tRNA(fMet) formyltransferase.
J. Bacteriol. 176, 7387–7390.
9.
9 Margolis, P. S., Hackbarth, C. J., Young, D. C., Wang, W., Chen, D., Yuan, Z.,
White, R., Trias, J. (2001) Peptide deformylase in S. aureus: Resistance to
inhibition is mediated by mutations in the formyltransferase gene. Antimicrob.
Agents Chemother. 44, 825–1831.
10.
10 Rajagopalan, P. T. R., Yu, X. C., and Pei, D. (1997) Peptide deformylase: A new
type of mononuclear iron protein. J. Am. Chem. Soc. 119, 12418–12419.
11.
11 Groche, D., Becker, A., Schlichting, I., Kabsch, W., Schultz, S., and
Wagner, A. F. V. (1998) Isolation and crystallization of functionally competent
Escherichia coli peptide deformylase forms containing either iron or nickel in the
active site. Biochem. Biophys. Res. Comm. 246, 342–346.
12.
12 Nguyen, K. T., Hu, X., Colton, C., Chakratarti, R., Zhu, M. X., and Pei, D. (2003)
Characterization of a human peptide deformylase: Implications for antibacterial
drug design. Biochemistry 42, 9952–9958.
13.
13 Lazennec, C., and Meinnel, T. (1997) Formate dehydrogenase-coupled spectropho-
tometric assay of peptide deformylase. Anal. Biochem. 244, 180–182.
14.
14 Rajagopalan, P. T. R., Datta, A., and Pei, D. (1997) Purification, characterization,
and inhibition of peptide deformylase from Escherichia coli. Biochemistry 36,
13910–13918.
15.
15 Wei, Y., and Pei, D. (1997) Continuous spectrophotometric assay of peptide
deformylase. Anal. Biochem. 250, 29–34.
16.
16 Nguyen, K. T., Hu, X., and Pei, D. (2004) Slow-binding inhibition of peptide
deformylase by cyclic peptidomimetics as revealed by a new spectrophotometric
assay. Bioorg. Chem. 32, 178–191.
17.
17 Rajagopalan, P. T. R., and Pei, D. (1998) Oxygen mediated inactivation of peptide
deformylase. J. Biol. Chem. 273, 22305–22310.
18.
18 Rajagopalan, P. T. R., Grimme, S., and Pei, D. (2000) Characterization of
Cobalt(II)-substituted peptide deformylase: Function of the metal ion and the
catalytic residue Glu-133. Biochemistry 39, 779–790.
19.
19 Hu, X., Nguyen, K. T., Jiang, V. C., Lofland, D., Moser, H. E., and Pei, D. (2004)
Macrocyclic inhibitors for peptide deformylase: A structure-activity relationship
study of the ring size. J. Med. Chem. 47, 4941–4949.
20.
20 Prescott, J. M., and Wilkes, S. H. (1976) Aeromonas aminopeptidase. Methods
Enzylmol. 45, 530–543.
11
A Method to Assay Penicillin-Binding Proteins
Michael J. Pucci and Thomas J. Dougherty
Summary
Key enzymes that assemble the bacterial cell wall are also the target of the -lactam class
of antibiotics. The covalent binding of labeled penicillin to these proteins has been used in
numerous studies in drug discovery, antibiotic mechanisms of action and resistance, and cell
wall physiology. Methods to label and measure penicillin binding proteins in two prototypical
organisms, a Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus), are
described. The methods discussed include identifying penicillin-binding proteins in both intact
cells (in vivo measurements) and isolated cell membranes.
Key Words: penicillin-binding proteins; peptidoglycan; membrane protein; fluorography.
1. Introduction
The penicillin-binding proteins (PBPs) are a set of enzymes catalyzing
terminal reactions of bacterial peptidoglycan biosynthesis (1–3). The ability
to use radioactive or fluorescent labeled penicillin to identify this subset of
bacterial proteins is the genesis of the terminology. In fact, these proteins, which
are situated on the outer surface of the bacterial cytoplasmic membrane, possess
key cell wall assembly enzymatic activities, which include transglycosylation
and transpeptidation, along with endopeptidase and carboxypeptidase functions.
The transpeptidation and carboxypeptidase functions are inhibited when these
proteins are acylated by a -lactam antibiotic, with the -lactam ring opening
and forming a covalent bond with an active-site serine residue found in a highly
conserved binding pocket present in PBPs (4). Much of our initial knowledge
about the roles of individual PBPs came from work done primarily in the

131
132 M. J. Pucci and T. J. Dougherty
Gram-negative rod-shaped organism E. coli and the Gram-positive rod Bacillus

subtilis (5–7). These proteins were found to play roles in both peptidoglycan
synthesis and cell morphogenesis. However, much remains to be understood
concerning their specific roles in cell wall growth and cell division.
Working with E. coli, Spratt published an indirect estimate of the numbers
of individual PBPs in an average E. coli cell (8). Nearly two decades later,
Dougherty et al. directly calculated the numbers of molecules per cell of
individual PBPs by measuring both the cell numbers present and the radioac-
tivity in the individual PBPs from a precise quantity of cells (9). Pucci and
Dougherty published a similar analysis in Staphylococcus aureus in 2002 (10).
The results of these studies indicated that the numbers of the higher–molecular-
weight PBPs are relatively low, as few as 120 per cell, in both of these species.
Penicillin-binding proteins are the targets for -lactams, one of the most
effective and widely used classes of antibiotics for the treatment of bacterial
infections (11). These include the penicillins and cephalosporins, which have
saved innumerable lives for more than 60 years. Many key species of bacterial
pathogens have been found to possess modified PBPs that exhibit greatly
reduced affinities for -lactam antibiotics, leading to increased levels of
antibiotic resistance. The reduced-affinity PBPs have been shown in many cases
to be the result of promiscuous genetic exchange among bacteria (1).
PBP assays have been used in competition assays with labeled penicillin
to obtain PBP binding affinity data for individual -lactam compounds, as
well as the kinetics of binding in the study of PBP–-lactam interactions. This
has resulted in the discovery and characterization of many new and improved
antibacterial agents in this class. We describe in this chapter methods to assay
PBPs in representative Gram-negative and Gram-positive bacterial species.
2. Materials
2.1. Cell Culture, Lysis, and Membrane Preparation
1. Tryptone broth and Brain-Heart-Infusion broth (Difco, Detroit, MI). Lennox L broth
or LB (Gibco BRL, Gaithersburg, MD) (see Note 1).
2. Agitation on a gyratory shaking incubator from New Brunswick Scientific Co. For
E. coli and staphylococci, vigorous shaking at ∼250 rpm is used (see Note 2).
3. Bacterial growth is monitored using a Spectronic 20 spectrophotometer or equivalent
at 600 nm.
4. Sonication buffer: 0.05 M Tris-HCl, pH 7.5, containing 1 mM MgCl2 , 1 mM
2-mercaptoethanol, and 5 μg/ml DNase.
5. Proteins are assayed by either the bicinchoninic acid assay (BCA; Pierce) or Lowry
assay (12).
A Method to Assay Penicillin-Binding Proteins 133
6. Staphylococcal lysis buffer: 50 mM Tris-HCl, pH 7.0, 10 mM MgCl2 , 2.5 μg of

DNase/mL, and 2.5 μg of RNase/mL followed by addition of lysostaphin (Sigma)
to a final concentration of 200 μg/mL.
7. The Bead-Beater was purchased from Bio-Spec Products (Bartlesville, OK). Glass
beads are obtained from this same vendor. The sonicator, Vibra-Cell, Model VC-
600, was purchased from Sonics and Materials (Danbury, CT) (see Note 3).
2.2. SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)

1. Separating gel: 10 mL of 1.5 M Tris-HCl buffer pH 8.8, 16.6 mL of Bis-acrylamide
(0.2:24 v/v), 0.4 mL of 10% SDS, and 13 mL of water (see Note 4) for a total
volume of 40 mL.
2. Stacking gel: 2.5 mL of 0.5 M Tris-HCl buffer pH 6.8, 1.7 mL of Bis-acrylamide
(0.2:24 v/v), 0.1 mL of 10% SDS, and 5.6 mL of water for a total volume of 9.9 mL.
3. Running buffer, pH 8.3, 10X stock: Tris base 15 g/L, glycine 72 g/L, and SDS
5 g/L.
4. Sample buffer, 2X: 2.5 mL of 0.5 M Tris-HCl, pH 6.8, 2.0 mL of 10% SDS, 2.0 mL
glycerol, 3.3 mL of water, and 0.1 mL of 2-mercaptoethanol.
5. Staining solution (1 L): 500 mL of methanol, 100 mL of glacial acetic acid, 400 mL
of water, and 2.75 g of Coomassie Blue.
6. Destaining solution (1 L): 100 mL of methanol, 100 mL of glacial acetic acid, and
800 mL of water.
3. Methods
PBPs are usually assayed by an indirect method using labeled -lactam
antibiotics, most often radiolabeled penicillin. This material must be custom-
synthesized, as it is generally not available commercially. The [3 H] version of
labeled penicillin is made as an ethylpiperidinium salt, which is soluble in both
acetone and water. The material is stored in acetone as small volume aliquots
(40–60 μL, based on specific activity) in 1.5 mL micro fuge tubes at –80°C and
is stable for up to 2 years. Just prior to use, the acetone is removed with a gentle
stream of nitrogen, and the dried residue in the tube is resuspended with an
appropriate volume of phosphate buffer. Alternatively, a fluorescent penicillin
derivative (Bocillin), which is currently available commercially, may be used.
The labeling of the PBPs can either be in vivo using whole cells or by using
isolated membrane proteins. Labeled PBPs then can be separated on SDS-PAGE
gels where band migration distances (and thus apparent molecular weights)
and relative amounts of labeled antibiotic can be analyzed. The utilization of
isolated membrane proteins is the more common method often resulting in gels
with better appearances than those from in vivo labeling experiments. However,
accurate quantitation in regard to the amount of input cells is very difficult using
membrane proteins because of variable losses during the membrane preparation

process. Also, membrane preparation methods differ among bacterial genera.
Examples of PBP assays from both a Gram-positive and Gram-negative bacteria
using both in vivo and isolated membrane protein methods are discussed in this
chapter (see Note 5).
3.1. Culture Growth Conditions—E. coli

1. A single bacterial colony is inoculated into 5 mL of tryptone broth and grown
overnight at 30°C with agitation.
2. For in vivo labeling, the next morning, a 200-fold dilution of the overnight culture
is made in 40 mL of LB medium in a flask and grown at 35°C with agitation (∼250
rpm) in a shaking incubator.
3. For membrane preparations, the next morning, a 200-fold dilution of the overnight
culture is made in 500 mL of LB medium in a flask and grown at 35°C with
agitation (∼250 rpm) in a shaking incubator.
4. Growth is monitored in a spectrophotometer at 600 nm. Experiments are started
in the A600 range of 0.3 to 0.4, which is the mid-logarithmic growth phase and
represents about 2 × 108 cells per mL.
3.2. In vivo Labeling of PBPs—E. coli

1. Exactly 1 mL of mid-logarithmic phase cells is collected and centrifuged in
microfuge tubes for 2 min at 12,000X g.
2. The supernatant is removed, and the cells are resuspended in 50 μL of 50 mM
sodium phosphate buffer, pH 7.0.
3. The samples are subjected to three cycles of freeze-thaw from –80°C to 37°C, for
3 min at each temperature.
4. After the last thaw, 2 μg of radiolabeled penicillin ([3 H]benzylpenicillin,
ethylpiperidium salt; 27.2 Ci/mmol) are added immediately, for a final concentration
of 40 μg/mL.
5. The samples are incubated at 37°C for 20 min.
6. The reaction is terminated by addition of 25 μL of 20% Sarkosyl detergent.
7. To prepare samples for SDS-PAGE, 25 μL of SDS sample buffer containing
2-mercaptoethanol are added followed by incubation at 100°C for 5 min.
3.3. Membrane Preparations: Sonication and Differential

Centrifugation—E. coli
1. E. coli cells are grown in LB medium in culture volumes of 500 mL at 35°C with
agitation.
2. When the cells reach an A600 of 0.4 to 0.5, they are harvested by centrifugation
at 7,000X g for 10 min at 4°C, washed once with 0.05 M of potassium phosphate
buffer, followed by resuspension in 2 volumes of sonication buffer.
3. The cells are then sonicated with cooling in an ice bath until 95% or greater breakage
occurs. This may require several cycles with cooling in between.
4. Unbroken cells and cellular debris are removed by a low-speed centrifugation at
3,000X g. Retain the sonicated supernatants.
5. Supernatent fluids from the low-speed centrifugation are centrifuged to pellet
membranes by ultracentrifugation at 100,000X g for 30 min at 4°C. Membranes are
resuspended in sodium phosphate buffer, pH 7.0, and washed once at 100,000X g
at 4°C for 30 min. Pellets are resuspended in 500 μL of phosphate buffer and stored
at –70°C if not used immediately.
6. Small samples (5 μL) of the pellet resuspension are taken for protein concentration
determinations by the bicinchoninic acid assay or Lowry assay, and 100 μg of
protein were used per gel lane.
3.4. Membrane Preparations: Mechanical Breakage—E. coli

1. E. coli cells are grown in LB medium in culture volumes of 500 mL at 35°C with
agitation.
2. When the cells reach an A600 of 0.4 to 0.5, they are harvested by centrifugation at
7,000X g for 10 min at 4°C,
3. The cells are resuspended in 10 mL of sodium phosphate buffer, pH 7.0, and broken
with a Bead-Beater.
4. Glass beads (35 g) are added, and the mixture is subjected to eight cycles of agitation
(15 s) in an ice-jacketed chamber.
5. Beads are separated from broken cells by filtration over a sintered glass filter, and
the membranes are collected by ultracentrifugation at 155,000X g for 30 min at 4°C.
6. Membranes are resuspended and washed once with sodium phosphate buffer at
4°C, again pelleted by ultracentrifugation at 155,000X g, and resuspended in a final
volume of 250 μL in sodium phosphate buffer. If membranes are not to be used
immediately, pellets resuspended in a small volume of phosphate buffer can be
stored frozen at –70°C.
7. Samples are taken for protein concentration determinations by the bicinchoninic
acid assay or Lowry assay, and 100–200 μg of protein are used per gel lane.
3.5. Culture Growth Conditions—Staphylococcus aureus

1. A single bacterial colony is inoculated into 5 mL of BHI broth and grown overnight
at 35°C with agitation.
2. For in vivo labeling, the next morning, a 200-fold dilution of the overnight culture
is made in 40 mL of BHI medium in a flask and grown at 35°C with agitation
(∼250 rpm) in a shaking incubator.
3. For membrane preparations, the next morning, a 200-fold dilution of the overnight
culture is made in 1 L of BHI medium in a flask and grown at 35°C with agitation
(∼250 rpm) in a shaking incubator.
4. Growth is monitored in a spectrophotometer at 600 nm. Experiments are started

in the A600 range of 0.3 to 0.4, which is the mid-logarithmic growth phase and
represents about 2 × 108 cells per mL.
3.6. In vivo Labeling of PBPs—S. aureus

1. One-mL samples of cells from mid-logarithmic phase cultures of S. aureus are
immediately centrifuged and resuspended in 50 μL of staphylococcal lysis buffer.
2. Two microliters of radiolabeled penicillin ([3 H]benzylpenicillin, ethylpiperidium
salt, 26.5 Ci/mmol; final concentration, 40 μg/mL) are immediately added, followed
by a 20-min incubation at 37°C (see Note 6).
3. Five microliters of lysostaphin are added to a final concentration of 200 μg/mL,
and samples were incubated at 37°C for an additional 5 min to allow cell lysis to
occur, as indicated by clearing of the sample solution.
4. Immediately after lysis occurs, an SDS-PAGE sample buffer is added and the
samples are boiled for 5 min.
5. The entire sample volumes are loaded into lanes on an SDS-PAGE gel and subjected
to electrophoresis.
6. Following electrophoresis, gels are subjected to fluorography to reveal the positions
of the radiolabeled PBPs. Bands on films can be quantitated and analyzed.
3.7. Membrane Preparations: Mechanical Breakage—S. aureus

1. S. aureus strains are grown to mid-logarithmic phase in BHI broth with aeration.
Volumes of 500 or 1000 mL will usually provide sufficient cell numbers to prepare
membranes for a reasonable number of experiments.
2. When the cells reach an A600 of approximately 0.6, they are harvested by centrifu-
gation at 7,000X g for 10 min at 4°C. The cells are washed once and resuspended
in 10 mL of ice-cold 10 mM sodium phosphate buffer, pH 7.0.
3. Alternatively, pellets can be frozen at –70°C overnight and thawed and resuspended
prior to further use.
4. Glass beads (∼35 g) of 0.1 mm diameter are added, and the mixture is subjected to
8 cycles of agitation (20 s) in a Bead-Beater using an ice-jacketed chamber allowing
5 min of cooling in between bursts.
5. The lysates are passed through a coarse-grade sintered glass filter to remove the
beads. The filtrate then is centrifuged at 3000 rpm to remove any remaining glass
beads and unbroken cells.
6. The supernatant is centrifuged at 100,000X g for 30 min at 4°C to pellet membranes.
The membranes are resuspended in sodium phosphate buffer and washed once by
centrifugation at 100,000X g.
7. Membranes are resuspended to a final volume of 1 mL in 10 mM sodium phosphate
buffer, pH 7.0. Remove a small amount, ∼10 μL, for protein determination. If
membranes are not to be used immediately, the resuspended pellets can be stored
frozen at –70°C. Membranes can also be aliquotted and frozen after protein concen-
tration is estimated.
8. Protein concentration determinations are obtained by the bicinchoninic acid assay
or Lowry assay, and 100 μg of protein are used per gel lane.
3.8. SDS-Polyacrylamide Gel Electrophoresis

1. To maximize resolution of PBP bands, gels should be run on a long bed gel
(≥20 cm) at a constant current of 10 mA at 4°C for 16 h. This is important, as
some PBPs have very similar molecular weights and can be challenging to resolve.
2. Prepare a 1.5-mm-thick, 10% separating gel using glass plates (one with a comb
notch) and plastic spacers on both sides and bottom of the sandwich. The spacers
and plate sandwich are held together with alligator clips. Degas the gel solution
under vacuum for 5 min. Add 160 μL of 10% ammonium persulfate and 16 μL
of TEMED and swirl to mix. Pour the separating gel immediately, leaving space
for the stacking gel, and overlay with water-saturated isobutanol. Allow 1 h for
complete polymerization.
3. Pour off the isobutanol, and rinse the top of the gel with water.
4. Prepare the 5% stacking gel. Degas the gel solution under vacuum for 5 min. Add
100 μL of freshly made 10% ammonium persulfate and 5 μL of TEMED, and swirl
to mix. Pour the stacking gel and quickly insert the comb. The stacking gel should
polymerize within 30 min.
5. Prepare the running buffer by diluting 100 mL of the 10X running buffer with
900 mL of water in a beaker with stirring.
6. Once the stacking gel has set, carefully remove the comb and use a 3-mL syringe
with a 22-gauge needle to wash the wells with running buffer. Remove the bottom
spacer between the glass plates.
7. Attach the glass plates containing the complete gel to the gel unit with clamps,
and fill the gel unit with runner buffer. Using a glass pipette with the tip bent at
a 45° angle by heating, remove any air bubbles from the bottom interface of the
gel, where the spacer was removed. Complete filling of the gel unit with running
buffer. Check for and remove air bubbles from loading areas between the teeth of
the stacking gel by flushing with buffer using a hand pipettor with a disposable
sequencing gel tip.
8. Load samples with a pipettor and narrow, disposable sequencing tips into each well,
including molecular-weight markers. Run gel overnight at 10 mA constant current.
The dye front should be run to the bottom of the gel or off the gel completely.
3.9. Fluorography and Quantitation of PBPs

1. Following electrophoresis, the gel is fixed and stained and prepared for fluorography
with En3 Hance fluor. After drying on a gel dryer, the dried gel is exposed to
preflashed X-OMAT AR X-ray film (Kodak) at –70°C (see Note 7). The film is
first oriented as to position on the gel by marking with a marker on both the gel
Fig. 1. Fluorograph of E. coli K-12 isolated membranes in PBP competition exper-

iments with a cephalosporin. PBP designations are indicated on the left. Radiola-
beled penicillin is added to a final concentration of 40 μg/mL. The concentrations of
competing antibiotic in lanes a to h are 0, 0.125, 0.25, 0.5, 1.0, 2.0, 4.0, and 8.0 μg/mL.
and the film (see Note 8). The film is developed and fixed to reveal the positions of
the radiolabeled bands (see Note 9). Examples of results for E. coli and S. aureus
are shown in Figs. 1 and 2.
2. Penicillin binding can be quantified by scanning PBP fluorographs using a scanning
laser densitometer or an image analyzer device to generate areas under the peaks
corresponding to the various PBPs in each gel lane. The areas are plotted, and
best-fit sigmoidal curves are determined by using curve-fitting software such as
Prism or SigmaPlot. Kinetics of binding and IC50 values can be determined for
PBPs and -lactam antibiotics. An example is shown in Fig. 3.
1 a b c d e f g
2a
2
3
Fig. 2. Fluorograph of S. aureus RN4220 isolated membranes in PBP competition

experiments with methicillin. PBP designations are indicated on the left. Radiola-
beled penicillin is added to a final concentration of 40 μg/mL. The concentrations of
competing antibiotic in lanes a to g are 0, 8, 16, 32, 64, 128, and 0 μg/mL.
Fig. 3. E. coli PBP binding curve for a cephalosporin antibiotic. Areas were deter-
mined by scanning laser densitometry of individual lanes on fluorographs. Areas under
the peaks are plotted versus the log of the concentrations (μg/mL) of the competing
antibiotic. Best-fit sigmoidal curves were plotted using GraphPad Prism software.
3.10. Detection Using a Fluorescent Penicillin Derivative

1. Substitute Bocillin FL (sodium salt-Invitrogen, Carlsbad, CA) for [3 H] or [14 C]
penicillin (13,14). Bocillin FL is dissolved in water and stored in aliquots at –20°C
in the dark. Bocillin is diluted and added in final concentrations of 5–10 μM and
incubated with membranes in either phosphate (pH 7.4) or Tris-Cl (pH 7.5) and
NaCl (0.15–0.5 M) for 30 min at 35°C. The membrane preparations are then treated
as above by boiling in SDS containing sample buffer to stop the reaction.
2. Samples are loaded onto SDS-polyacrylamide gels and electrophoresed as described
above. After electrophoresis, the gel is washed briefly with distilled water.
3. The PBPs with the bound fluorescent Bocillin can be visualized by eye with a UV
lamp. Quantitation of the labeled PBPs can be accomplished with an instrument such
as a FluorImager 595 (Molecular Dynamics, Sunnyvale, CA) by excitation at 488 nm
and detection at 530 nm. Other imaging systems such as the Storm PhosphoImager
(Molecular Dynamics) or Alphaimager (Alpha Innotech, San Leandro, CA) can be
employed.
4. Notes
1. Suggested bacterial culture media are listed. Other media may also be appropriate,
but adjustments may be necessary to adjust for varied cell numbers.
2. Agitation of cultures was done in New Brunswick shaking incubators. It is important
to maintain vigorous aeration of E. coli and staphylococcal cultures to ensure optimal
growth rates. Other Gram-positive bacteria such as streptococci and enterococci

must be grown without agitation and aeration.
3. Care must be taken when using either a sonicator or Bead-Beater to prevent cells
and lysates from warming. Cooling periods in an ice-water bath are essential.
4. All solutions should be prepared in distilled water or water with a resistivity of 18.2
M-cm.
5. The methods should work for most strains dependent upon satisfactory growth in
culture medium.
6. Radiolabeled penicillin may require a custom synthesis from the vendor.
7. If [3 H]benylpenicillin is used, films should be exposed for 3–7 days. If
[14 C]benzylpenicillin is used, films should be exposed for 2–4 weeks. Film is
preflashed as described in (15) to obtain a linear response.
8. It is important to carefully orient the film to the gel so that the exposed bands can
be aligned with the molecular-weight marker bands for size estimation.
9. Films can be developed manually using standard X-ray film developer and fixer or
by automated X-ray film processors, if available.
Acknowledgments
We would like to thank Alexander Tomasz and Roberta Fontana for their
assistance in helping us become proficient in the methodologies described in
this work. We also thank Regine Hakenbeck and Brigitte Berger-Bachi for
helpful discussions over the years.
References
1.
1 Macheboeuf, P., Contreras, C., Job, V., Dideberg, O., and Dessen, A. (2006)
Penicillin binding proteins: Key players in bacterial cell cycle and drug resistance
processes. FEMS Microbiol. Rev. 30, 673–691.
2.
2 Spratt, B. G. (1975) Distinct penicillin-binding proteins involved in the division,
elongation, and shape of Escherichia coli K-12. Proc. Natl. Acad. Sci. USA 72,
2999–3003.
3.
3 Koch, A. L. (2000) Penicillin-binding proteins, beta-lactams, and lactamases:
Offenses, attacks, and defensive countermeasures. Crit. Rev. Microbiol. 26,
205–220.
4.
4 Goffin, C., and Ghuysen, J.-M. (1998) Multimodular penicillin-binding proteins:
An enigmatic family of orthologs and paralogs. Microbiol. Mol. Biol. Rev. 62,
1079–1093.
5.
5 Young, K. D. (2001) Approaching the physiological functions of penicillin-binding
proteins in Escherichia coli. Biochemie 83, 99–102.
6.
6 McPherson, D. C., and Popham, D. L. (2003) Peptidoglycan synthesis in the
absence of class A penicillin-binding proteins in Bacillus subtilis. J. Bacteriol.
185, 1423–1431.
7.
7 Stewart, G. C. (2005) Taking shape: Control of bacterial cell wall biosynthesis.
Mol. Microbiol. 57, 1177–1181.
8.
8 Spratt, B. G. (1977) Properties of the penicillin-binding proteins of Escherichia
coli K-12. Eur. J. Biochem. 72, 341–352.
9.
9 Dougherty, T. J., Kennedy K., Kessler, R. E., and Pucci, M. J. (1996) Direct
quantitation of the number of individual penicillin-binding proteins per cell in
Escherichia coli. J. Bacteriol. 178, 6110–6115.
10.
10 Pucci, M. J., and Dougherty, T. J. (2002) Direct quantitation of the number
of individual penicillin-binding proteins per cell in Staphylococcus aureus.
J. Bacteriol. 184, 588–591.
11.
11 Tipper, D. J., and Strominger, J. L. (1965) Mechanism of action of penicillins:
A proposal based on their structural similarity to acyl-D-alanyl-D-alanine. Proc.
Natl. Acad. Sci. USA 54, 1133–1141.
12.
12 Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) Protein
measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275.
13.
13 Zhao, G., Meier, T. I., Kahl, S. D., Gee, K. R., and Blaszczak, L. C. (1999)
Bocillin FL, a sensitive and commercially available reagent for detection of
penicillin-binding proteins. Antimicrob. Agents Chemother. 43, 1124–1128.
14.
14 Kaczmarek, F. S., Gootz, T. D., Dib-Hajj, F., Shang, W., Hallowell, S., and
Cronan, M. (2004) Genetic and molecular characterization of -lactamase-negative
ampicillin-resistant Haemophilus influenzae with unusually high resistance to
ampicillin. Antimicrob. Agents Chemother. 48, 1630–1639.
15.
15 Laskey, R. A., and Mills, A. D. (1975) Quantitative film detection of 3H and 14C
in polyacrylamide gels by fluorography. Eur. J. Biochem. 56, 335–341.
12
A Method to Assay Inhibitors

of Lipopolysaccharide Synthesis
Marcy Hernick and Carol A. Fierke
Summary
Treatment of Gram-negative bacterial infections is complicated by innate and acquired
drug resistance resulting in a limited number of effective antibiotics. Several Gram-negative
bacteria, for which current therapies are ineffective, have recently been identified as potential
bioterror agents. These findings highlight the need for new antibiotics, specifically antibiotics
that act on new drug targets to circumvent drug resistance. Potential targets in Gram-negative
bacteria include enzymes involved in the biosynthesis of lipopolysaccharides (LPS) that form
outer membranes of these organisms. UDP-3-O-(R-3-hydroxymyristoyl)-N-acetylglucosamine
deacetylase (LpxC) catalyzes the committed step in the biosynthesis of the lipid A portion of
LPS. Therefore, inhibitors of this enzyme have the potential to serve as antibiotics, and efforts
toward the development of LpxC inhibitors are currently underway. Here we describe methods
for assaying LpxC inhibitors, including methods for measuring deacetylase activity and binding
affinity for LpxC, which will be useful for the development of LpxC inhibitors.
Key Words: lipopolysaccharide; LPS; LpxC; lipid A; inhibitor; metal-dependent

deacetylase.
1. Introduction
Lipopolysaccharides (LPS) are negatively charged molecules that form the
outer membranes of Gram-negative bacteria and act as barriers to prevent
entry of small molecules, thereby contributing to the viability and innate resis-
tance of these organisms (1,2). Structurally, LPS consists of three regions:
O-antigen, core, and lipid A. The O-antigen and core portions of LPS are
variable oligosaccharides, while lipid A is a glucosamine phospholipid that

143
144 M. Hernick and C. A. Fierke
has relatively conserved architecture across different organisms (1). Lipid A is

responsible for anchoring LPS to the outer membrane and is also the portion
of LPS responsible for stimulating the immune system in Gram-negative sepsis
(1–3). The loss of lipid A results in decreased viability and increased sensitivity
to antibiotics; therefore, inhibitors of lipid A biosynthesis have the potential to
function as antibiotics and/or anti-endotoxins (1,2,4).
UDP-3-O-(R-3-hydroxymyristate)-N-acetyl-glucosamine deacetylase (LpxC)
is a metal-dependent enzyme that catalyzes the committed, and second
overall, step in the biosynthesis of lipid A—the conversion of UDP-3-O-(R-3-
hydroxymyristate)-N-acetyl-glucosamine to UDP-3-O-(R-3-hydroxymyristate)-
glucosamine and acetate (5,6). Consequently, LpxC is currently being pursued
as a target for the development of antibiotics (4,7–12). The appeal of
LpxC as a drug target is enhanced by the finding that it is a metal-
loenzyme (6) with known information regarding its biochemical mechanism
(13–16) and a solved three dimensional structure (17,18). LpxC inhibitors
typically contain a group capable of chelating the catalytic metal ion (i.e.,
hydroxamate, phosphonate, carboxylate) (4,7–12), based on knowledge from
past successes in developing metalloenzyme inhibitors (19–23). In the future,
LpxC inhibitors will be optimized for potency and specificity as more
biochemical and structural data become available. Here we describe assays for
in vitro evaluation of LpxC inhibitors using purified LpxC, including assays
for measuring the effect of inhibitors on deacetylase activity and inhibitor
binding affinity for LpxC.
2. Materials
2.1. Preparation of [14 C]-UDP-3-O-(R,S-hydroxymyristoyl)
-N-acetyl-glucosamine
1. 1 M bis-tris, pH 6 (Research Organics Inc., Cleveland, OH).
2. 50 mM bis-tris, pH 6, 1 M NaCl.
3. 10 mM bis-tris, pH 6.
4. 0.2 M NaCl (see Note 1).
5. Filter (0.2 μm) aqueous solutions and store at room temperature.
6. Freshly prepared solutions: 0.4 M HEPES, pH 8 (Fisher Scientific), 10 mg/mL
bovine serum albumin fatty acid-free (BSA; Sigma, St. Louis, MO), and 100 mM
methyl methanethiosulfonate (MMTS; Sigma, St. Louis, MO).
7. [14 C]-UDP-N-acetyl-glucosamine (NEN Life Science Products, Boston, MA)
stored at –20 °C.
8. Disposable 10 mL and 60 mL luer-lok syringes (Fisher Scientific).
9. Costar 3620 1.7 mL microcentrifuge tubes (Corning Incorporated, Corning, NY)
(see Note 2).
A Method to Assay Inhibitors of Lipopolysaccharide Synthesis 145
10. Poly prep columns, 0.8 × 4 cm (Bio-Rad, Hercules, CA) filled with 2 mL DEAE-
sepharose fast flow resin (GE Healthcare BioSciences, Piscataway, NJ). Prior to
initiating reactions: Wash column with 18 mL H2 O (to remove ethanol), equilibrate
column with 16 mL 1 M bis-tris, pH 6, followed by 8 mL 50 mM bis-tris, pH 6, 1
M NaCl, and finally 8 mL 10 mM bis-tris, pH 6. Use a 60 mL disposable syringe
fitted with column adapter to apply pressure (air) to speed the flow of solutions
through the column.
11. C18 sep-pak (Waters, Milford, MA) washed with 10 mL methanol followed
by 20 mL H2 O. Attach equilibrated sep-pak onto bottom of DEAE-sepharose
column.
12. R S-3-hydroxy-myristate-ACP (2-3 mM) and LpxA (11–39 mg/mL) stored
at –80 °C (see Note 3).
2.2. LpxC Deacetylase Assay

1. Costar 3620 1.7 mL microcentrifuge tubes, Costar 4826 (0.1–10 μL) tips, and
Costar 4863 (1–200 μL) tips (Corning Incorporated, Corning, NY). ART 10 and
20P pipette tips (Molecular BioProducts, San Diego, CA) (see Note 2).
2. 200 mM bis-tris propane (Sigma, St. Louis, MO).
3. 15 mM triscarboxyethylphosphine (TCEP; Sigma, St. Louis, MO), pH 7.5.
4. 100 mg/mL fatty acid-free BSA.
5. 10X inhibitor stock (see Note 4).
6. 10 μM LpxC, iolated as described (6,13) (see Note 5).
7. 13 μM [14 C]-UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine. Store all
buffers and reagents at –20 °C, and store LpxC at –80 °C.
8. 1.25 M NaOH.
9. 80:20 iso-propanol (iPrOH)/1.5 M acetic acid.
10. 0.1 M guanidine hydrochloride.
11. Scintiverse scintillation fluid (Fisher Scientific). Store at room temperature.
Aliquot quench (1.25 M NaOH) into microfuge tubes prior to starting assay
(see Note 6).
12. PEI-cellulose TLC plates (20 cm × 20 cm; Fisher Scientific) cut into 10 cm × 20
cm plates prior to use.
13. Biomax MS film, Kodak Photo Developer, and Kodak Photo Fixer. Dilute photo
developer and fixer solutions with water (as indicated) prior to use.
2.3. Ultrafiltration Binding Assay

1. 200 mM bis-tris propane, 15 mM TCEP, pH 7.5 (10X buffer). Store at 4 °C (short
term) or –20 °C (long term).
2. 0.1 M NaOH and Scintiverse scintillation fluid. Store at room temperature.
3. Microcons (MWCO 30K, Millipore, Bedford, MA). Microcons must be washed
prior to assay to remove glycerol from the membranes (see Note 7) .
4. LpxC.
5. Inhibitor.
6. [14 C]-UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine (see Notes 4, 5, 8).
7. Costar 3620 1.7 mL microcentrifuge tubes, Costar 4826 (0.1–10 μL) tips, and Costar
4863 (1–200 μL) tips (Corning Incorporated, Corning, NY). ART 200 and 1000
tips (Molecular BioProducts, San Diego, CA) (see Note 2).
3. Methods
3.1. Preparation of [14 C]-UDP-3-O-(R-hydroxymyristoyl)
-N-acetyl-glucosamine
1. Mix together 100 μL 0.4 M HEPES, pH 8, 100 μL 10 mg/mL BSA, 540 μL H2 O,
200 μL [14 C]-UDP-N-acetyl-glucosamine, 10 μL 100 mM MMTS, and 30 μL 2–3
mM R,S-3-hydroxymyristate-ACP in 1.7 mL microfuge tube. Spin in microfuge for
10 s (see Note 9).
2. Initiate reaction with the addition of 20 μL 11–39 mg/mL LpxA to assay mixture.
Vortex. Spin in microfuge for 10 s. Incubate in heat block at 30 °C for 30 min.
3. Transfer 1 μL of assay mixture into a scintillation vial (for counting). Load
remaining assay mixture onto pre-equilibrated DEAE column.
4. Wash column with 18 mL 0.2 M NaCl to load radioactivity onto sep-pak. Remove
sep-pak from DEAE-sepharose column. Discard DEAE column in radioactive waste.
5. Wash sep-pak with 30 mL H2 O using a disposable luer-lok syringe to remove
unreacted [14 C]-UDP-N-acetylglucosamine. Collect waste in a 50 mL conical tube,
and dispose of in radioactive waste (if necessary).
6. Elute [14 C]-UDP-3-O-(R,S-hydroxymyristoyl)-N-acetyl-glucosamine into 50 mL
conical tube with 15 mL methanol using a disposable luer-lok syringe.
7. Concentrate methanol solution to dryness using a speed vac (see Note 9).
8. Resuspend [14 C]-UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine in 100 μL
10 mM bis-tris pH 6, and transfer into 1.7 mL microfuge tube. Transfer 1
μL of product into scintillation vial (for counting). Store [14 C]-UDP-3-O-(R-
hydroxymyristoyl)-N-acetyl-glucosamine at –20 °C.
9. Add scintillation fluid to vials and count using scintillation counter. Determine
reaction yield from the ratio of purified product (cpm)/total assay mixture (cpm).
Yields for purified [14 C]-UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine
using this procedure are typically >90%. Concentrations of stored product can
be determined using the specific activity of purchased [14 C]-UDP-N-acetyl-gluco-
samine.
3.2. LpxC Deacetylase Turnover Assay for Measuring

Inhibition Constants
1. Mix together 20 mM bis-tris propane, 1.5 mM TCEP pH 7.5, 1 mg/mL BSA with
or without inhibitor in 1.7 mL microfuge tube. Spin in microfuge. Equilibrate assay
mixtures at desired temperatures, 30 °C for E. coli LpxC (13) or Pseudomonas

aeroginosa LpxC (8) or 60 °C for Aquifex aeolicus LpxC (17,18), for at least 15
min prior to initiating reactions.
2. In a separate 1.7 mL microfuge tube, dilute 10 μM LpxC to 30 nM, so that the
final solution contains 20 mM bis-tris propane, 1.5 mM TCEP pH 7.5, and 1
mg/mL BSA.
3. Add diluted LpxC to assay mixture (with or without the inhibitor) pre-equilibrated
to the assay temperature (30 or 60 °C). Vortex. Incubate this solution at the assay
temperature for 15 to 25 min as needed to form the E•I complex.
4. Initiate reaction with the addition of 13 μM [14 C]-UDP-3-O-(R-hydroxymyristoyl)-
N-acetyl-glucosamine to assay mixture at a final concentration of 200 nM. Vortex.
For determination of kcat -, K M -, and KI -values, the initial linear rate needs to be
determined at multiple concentrations of substrate (i.e., 50 nM to 8 μM) and/or
inhibitor.
5. Remove aliquots after various times (≥ 6 different time points) and add to quench
(see Note 6). For reactions without inhibitor, recommended time points are every
30 s, whereas reactions that are significantly slowed by the addition of inhibitor
will require longer time points (i.e., every 1–5 min) for better accuracy.
6. Let quenched aliquots sit at room temperature for at least 10 min.
7. Neutralize quenched aliquots with the addition of 80:20 iPrOH/1.5 M acetic acid
and vortex (see Note 6). Concentrate neutralized aliquots down to ∼2 μL using
speed vac.
8. Resuspend concentrated aliquots in 14 μL 10 mM bis-tris, pH 6. Spin in microfuge
for 30 s. Spot mixture onto PEI-cellulose plates in two portions. Let plates sit at
room temperature until dry (∼30 min).
9. Soak plates in methanol for 5 min each. Let sit at room temperature until dry
(∼ 5 min).
10. Run plates in 0.1 M guanidine hydrochloride until solvent front reaches the top
of plate (∼11 min). Let plates sit at room temperature until dry (∼1 h).
11. Expose plates to film, and place in film cassettes. Place at –80 °C overnight.
12. Develop film. Cut substrate and product from TLC plates, and transfer into scintil-
lation vials (see Note 10).
13. Add scintillation fluid. Count substrate and product using scintillation counter.
14. Convert fraction product (cpmproduct /cpmtotal ) into [product]. Plot [product] as a
function of time, and fit linear equation to data to obtain initial linear rate (v; Fig. 1).
15. Plot observed velocity (v) as a function of inhibitor concentration ([I]) and fit Eq.
(1) to these data to obtain IC50 values (Fig. 2). For determination of kcat -, KM -,
and KI -values, plot observed activity (v) as a function of substrate concentration
([S]) and fit Eq. (2) to these data:
Fig. 1. Example of initial linear product formation for turnover of [14 C]-UDP-3-O-
(R,S-hydroxymyristoyl)-N-acetyl-glucosamine catalyzed by EcLpxC (20 mM bis-tris
propane, 10 mM TCEP, pH 7.5, 30 °C).
Fig. 2. Example of LpxC inhibition by a hydroxamate inhibitor (20 mM bis-tris

propane, 10 mM TCEP, pH 7.5, 30 °C). Initial linear rates of LpxC turnover were
plotted as a function of concentration inhibitor, and Eq. (1) was fit to these data to
obtain an IC50 of 3.6 ± 0.4 nM.
IC50
v= (1)
I + IC50
V S
v= max (2)
KM 1 + KI + S
I
3.3. Ultrafiltration Binding Assay

1. For direct binding measurements, mix together 10X buffer, H2 O, LpxC (varied
concentrations, i.e., 1–200 μM), and inhibitor (constant concentration, i.e., [I]/KI
= 0.1) in 1.7 mL microfuge tubes so that the final concentration of buffer is
1X. For competition-based assays, [14 C]-UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-
glucosamine (73 nM) is also included in reaction mixtures. Spin in microfuge
(see Notes 8 and 11).
2. Incubate at 30 °C for 15 to 30 min to allow for ligand equilibration/product
formation.
3. Transfer mixtures into pre-rinsed microcons (see Note 7).
4. Spin at 3000X g for 3 min. Transfer filtrate back into sample reservoirs. Vortex.
This step is to ensure that the filtrate sample is not diluted by residual buffer from
the washing steps.
5. Spin at 3000X g for 2.5 min. Transfer 75 μL each of filtrate into scintillation vials.
6. Place sample reservoirs containing the retentate upside down in new collection
tubes. Spin at 3000X g for 3 min. Transfer 75 μL each into scintillation vials.
7. Add scintillation fluid to vials and count using scintillation counter.
8. Plot EL/Ltotal , where L = radiolabeled ligand, as a function of [LpxC] (Fig. 3).
KD Inhibitor -values are obtained by fitting Eq. (3) to these data for direct binding
assay, or Eq. (4) for competition-based assays, where KD Product refers to the KD -
value for [14 C]-UDP-3-O-(R-hydroxymyristoyl)-glucosamine binding to EcLpxC
under similar conditions (i.e., 1.5 ± 0.2 μM; Fig. 3).

EL
EL Ltotal Endpt
= + EL L (3)
Ltotal 1 + EKD total Background
total

EL
EL Ltotal
= Pr oduct + EL L Initial (4)
Ltotal KD
1 + LpxC 1 + Inhibitor
K Inhibitor
D
Fig. 3. Example of [14 C]-UDP-3-O-(R,S-hydroxymyristoyl)-glucosamine binding to

EcLpxC (20 mM bis-tris propane, 1.5 mM TCEP, pH 7.5, 30 °C) determined using
ultrafiltration. Equation (3) was fit to these data to obtain a KD Product -value of 1.5 ±
0.2μM.
4. Notes
1. All water used in the described methods is milliQ purified water.
2. LpxC is catalytically active with one bound Zn(II) (E•Zn); however, LpxC can
bind a second Zn(II) to form an inactive E•Zn2 complex (6,17). Therefore, low-
metal-content tubes and tips are used throughout the methods to minimize Zn(II)
contamination and formation of E•Zn2 during assays and storage. Aerosol-resistant
tips are used for pipetting radioactive materials.
3. Procedures for preparation of R,S-3-hydroxy-myristoyl-ACP and LpxA are
provided in references (24,25).
4. Inhibitor stocks should be prepared at 10X the desired final concentration. Water-
soluble LpxC inhibitors should be dissolved in 1X buffer. DMSO (≤ 10 % v/v
final) can be included for inhibitors with low water solubility.
5. To minimize formation of E•Zn2 , all metal ions should be removed from purified
LpxC by treatment with 20 mM dipicolinate as previously described (6). The
catalytic Zn(II) is added back by incubation of apo-LpxC with Zn(II) (6). The
concentration of LpxC required will depend on the type of assay, as well as the
inhibitor potency. For assays that measure deacetylase activity, low concentrations
of LpxC are typically required (i.e., 1–10 nM), while much higher concentrations
of LpxC are required for assays that measure binding affinity (i.e., 1–200 μM).
6. The amount of 1.25 M NaOH required will depend on the volume of the reaction
being quenched. For a typical assay, 20 μL of reaction is quenched with 8 μL 1.25
M NaOH prior to neutralization with 94 μL 80:20 i-PrOH/1.5 M acetic acid.
7. To wash microcons, fill sample reservoirs with 500 μL each of 0.1 M NaOH.
Spin at 14,000X g for 12 min. Discard filtrate. Repeat for a total of three washes.
Fill sample reservoirs with 500 μL 25 mM bis-tris propane, 1.5 mM TCEP, pH
7.5. Spin at 14,000X g for 12 min. Discard filtrate. Fill sample reservoirs with
500 μL 20 mM bis-tris propane, 1.5 mM TCEP, pH 7.5. Microcons can be stored
in buffer at 4 °C for several days prior to use. Immediately before use, spin at
14,000X g for 12 min. Place the sample reservoirs upside down over collection
tubes. Spin at 3000X g for 3 min. Discard filtrate. Insert sample reservoirs into
collection tube. Microcons are now ready for loading samples.
8. The KD -values of radiolabeled, or fluorescent, inhibitors for LpxC are deter-
mined using a direct binding assay, while the KD -values of unlabeled inhibitors
are determined using a competition-based assay between the unlabeled inhibitor
and [14 C]-UDP-3-O-(R,S-hydroxymyristoyl)-glucosamine. In these experiments,
the concentration of either LpxC or inhibitor is varied, and the concentration of
the other reagent held constant (below the KD -value). Since LpxC overexpresses
at high levels and is unstable at low concentrations, the concentration of LpxC
is typically varied in these experiments (typical range 1–200 μM). Both direct
and competition-based assays require EL/Ltotal measurements at 6 to 10 different
concentrations of LpxC to obtain a KD -value for a specific ligand.
9. The 3-acyl group on UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine can
undergo isomerization to afford a molecule that is not a substrate for LpxC (24).
To avoid isomerization of the acyl group, it is important to carry out the synthesis
as quickly as possible, and the reaction should be kept cool. Therefore, the DEAE-
sepharose columns and sep-paks should be equilibrated prior to initiating the
LpxA reaction, a syringe should be used to speed the rate of flow through the
column, and the speed vac concentration step should be carried out at room
temperature. If materials needed for the biochemical preparation are not readily
available, radiolabeled UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine can
also be prepared synthetically (26).
10. The length of film exposure will depend on the amount of radioactivity loaded
onto the TLC plates, but in general ≥16 h is long enough to visualize substrate
and/or product. Substrate migrates ∼1 cm below product on the PEI-cellulose
TLC plate (Rf -values of ∼0.5 and ∼0.6, respectively), under these conditions.
In experiments where product formation is low (steady-state conditions, <20%
reaction), the product band on film is only visible after long exposure times
(several days). In this case, TLC plates can be cut just above the substrate band
and each piece loaded into scintillation vials.
11. LpxC is generally unstable at concentrations <1 μM, and therefore BSA (1 mg/mL)
is included in assay buffers to stabilize the LpxC at low concentrations (6).
However, BSA binds UDP-3-O-(R-hydroxymyristoyl)-glucosamine, as well as

other small molecules, preventing them from passing freely through the microcon
membranes (unpublished results). Therefore, BSA should be excluded from buffers
used to measure binding affinity for LpxC.
Acknowledments
This work was supported by the National Institutes of Health (GM40602 to
C.A.F.) and the Cystic Fibrosis Foundation (HERNIC05F0 to M.H.).
References
1.
1 Raetz, C. R. H., and Whitfield, C. (2002) Lipopolysaccharide endotoxins. Ann.
Rev. Biochem. 71, 635–700.
2.
2 Wyckoff, T. J. O., Raetz, C. R. H., and Jackman, J. E. (1998) Antibacterial and
anti-inflammatory agents that target endotoxin. Trends Microbiol. 6, 154–159.
3.
3 Darveau, R. P. (1998) Lipid A diversity and the innate host response to bacterial
infection. Curr. Opin. Microbiol. 1, 36–42.
4.
4 Onishi, H. R., Pelak, B. A., Gerckens, L. S., Silver, L. L., Kahan, F. M.,
Chen, M. H., Patchett, A. A., Galloway, S. M., Hyland, S. A., Anderson, M. S.,
and Raetz, C. R. H. (1996) Antibacterial agents that inhibit lipid A biosynthesis.
Science 274, 980–982.
5.
5 Young, K., Silver, L. L., Bramhill, D., Cameron, P., Eveland, S. S.,
Raetz, C. R. H., Hyland, S. A., and Anderson, M. S. (1995) The envA
permeability cell division gene of Escherichia coli encodes the second enzyme
of lipid A biosynthesis—UDP-3-O-(R-3-hydroxymyristoyl)-N-acetylglucosamine
deacetylase. J. Biol. Chem. 270, 30384–30391.
6.
6 Jackman, J. E., Raetz, C. R. H., and Fierke, C. A. (1999) UDP-3-O-(R-3-
hydroxymyristoyl)-N-acetylglucosamine deacetylase of Escherichia coli is a zinc
metalloenzyme. Biochemistry 38, 1902–1911.
7.
7 Clements, J. M., Coignard, F., Johnson, I., Chandler, S., Palan, S., Waller, A.,
Wijkmans, J., and Hunter, M. G. (2002) Antibacterial activities and characterization
of novel inhibitors of LpxC. Antimicrob. Agents Chemother. 46, 1793–1799.
8.
8 Kline, T., Andersen, N. H., Harwood, E. A., Bowman, J., Malanda, A., Endsley, S.,
Erwin, A. L., Doyle, M., Fong, S., Harris, A. L., Mendelsohn, B., Mdluli, K.,
Raetz, C. R. H., Stover, C. K., Witte, P. R., Yabannavar, A., and Zhu, S. G. (2002)
Potent, novel in vitro inhibitors of the Pseudomonas aeruginosa deacetylase LpxC.
J. Med. Chem. 45, 3112–3129.
9.
9 Li, X. C., Uchiyama, T., Raetz, C. R. H., and Hindsgaul, O. (2003) Synthesis of
a carbohydrate-derived hydroxamic acid inhibitor of the bacterial enzyme (LpxC)
involved in lipid A biosynthesis. Org. Lett. 5, 539–541.
10.
10 Pirrung, M. C., Tumey, L. N., McClerren, A. L., and Raetz, C. R. H.
(2003) High-throughput catch-and-release synthesis of oxazoline hydroxamates.
Structure-activity relationships in novel inhibitors of Escherichia coli LpxC: In

vitro enzyme inhibition and antibacterial properties. J. Amer. Chem. Soc. 125,
1575–1586.
11.
11 Pirrung, M. C., Tumey, L. N., Raetz, C. R. H., Jackman, J. E., Snehalatha, K.,
McClerren, A. L., Fierke, C. A., Gantt, S. L., and Rusche, K. M. (2002) Inhibition
of the antibacterial target UDP-(3-O-acyl)-N-acetylglucosamine deacetylase
(LpxC): Isoxazoline zinc amidase inhibitors bearing diverse metal binding groups.
J. Med. Chem. 45, 4359–4370.
12.
12 Jackman, J. E., Fierke, C. A., Tumey, L. N., Pirrung, M., Uchiyama, T., Tahir, S. H.,
Hindsgaul, O., and Raetz, C. R. H. (2000) Antibacterial agents that target
lipid A biosynthesis in Gram-negative bacteria—Inhibition of diverse UDP-3-O-
(R-3- hydroxymyristoyl)-N-acetyglucosamine deacetylases by substrate analogs
containing zinc binding motifs. J. Biol. Chem. 275, 11002–11009.
13.
13 Hernick, M., Gennadios, H. A., Whittington, D. A., Rusche, K. M.,
Christianson, D. W., and Fierke, C. A. (2005) UDP-3-O-((R)-3-hydroxymyristoyl)-
N-acetylglucosamine deacetylase functions through a general acid-base catalyst
pair mechanism. J. Biol. Chem. 280, 16969–16978.
14.
14 Hernick, M., and Fierke, C. A. (2006) Catalytic mechanism and molecular
recognition of E. coli UDP-3-O-(R-3-hydroxymyristoyl)-N-acetylglucosamine
deacetylase probed by mutagenesis. Biochemistry 45, 15240–15248.
15.
15 Coggins, B. E., McClerren, A. L., Jiang, L., Li, X., Rudolph, J., Hindsgaul, O.,
Raetz, C. R. H., and Zhou, P. (2005) Refined solution structure of the LpxC-
TU-514 complex and pKa analysis of an active site histidine: Insights into the
mechanism and inhibitor design. Biochemistry 44, 1114–1126.
16.
16 McClerren, A. L., Zhou, P., Guan, Z., Raetz, C. R. H., and Rudolph, J. (2005)
Kinetic analysis of the zinc-dependent deacetylase in the Lipid A biosynthetic
pathway. Biochemistry 44, 1106–1113.
17.
17 Whittington, D. A., Rusche, K. M., Shin, H., Fierke, C. A., and Christianson, D. W.
(2003) Crystal structure of LpxC, a zinc-dependent deacetylase essential for
endotoxin biosynthesis. PNAS 100, 8146–8150.
18.
18 Coggins, B. E., Li, X. C., McClerren, A. L., Hindsgaul, O., Raetz, C. R. H., and
Zhou, P. (2003) Structure of the LpxC deacetylase with a bound substrate-analog
inhibitor. Nature Struct. Bio. 10, 645–651.
19.
19 Leung, D., Abbenante, G., and Fairlie, D. P. (2000) Protease inhibitors: Current
status and future prospects. J. Med. Chem. 43, 305–341.
20.
20 Supuran, C. T., Casini, A., and Scozzafava, A. (2003) Protease inhibitors of the
sulfonamide type: Anticancer, antiinflammatory, and antiviral agents. Med. Res.
Rev. 23, 535–558.
21.
21 Supuran, C. T., Scozzafava, A., and Casini, A. (2003) Carbonic anhydrase
inhibitors. Med. Res. Rev. 23, 146–189.
22.
22 Scozzafava, A., and Supuran, C. T. (2000) Carbonic anhydrase and matrix
metalloproteinase inhibitors: Sulfonylated amino acid hydroxamates with MMP
inhibitory properties act as efficient inhibitors of CA isozymes I, II, and IV,

and N-hydroxysulfonamides inhibit both these zinc enzymes. J. Med. Chem. 43,
3677–3687.
23.
23 Hackbarth, C. J., Chen, D. Z., Lewis, J. G., Clark, K., Mangold, J. B., Cramer, J. A.,
Margolis, P. S., Wang, W., Koehn, J., Wu, C., Lopez, S., Withers, G., Gu, H.,
Dunn, E., Kulathila, R., Pan, S. H., Porter, W. L., Jacobs, J., Trias, J., Patel, D. V.,
Weidmann, B., White, R. J., and Yuan, Z. Y. (2002) N-alkyl urea hydroxamic
acids as a new class of peptide deformylase inhibitors with antibacterial activity.
24.
24 Anderson, M., Bull, H., Galloway, S., Kelly, T., Mohan, S., Radika, K., and
Raetz, C. (1993) UDP-N-acetylglucosamine acyltransferase of Escherichia coli.
The first step of endotoxin biosynthesis is thermodynamically unfavorable. J. Biol.
Chem. 268, 19858–19865.
25.
25 Kelly, T. M., Stachula, S. A., Raetz, C. R. H., and Anderson, M. S. (1993) The Fira
gene of Escherichia coli encodes Udp-3-O-(R-3- Hydroxymyristoyl)-Glucosamine
N-Acyltransferase—The 3rd step of endotoxin biosynthesis. J. Biol. Chem. 268,
19866–19874.
26.
26 Maxwell, B. D., and Bronstein, J. C. (2005) An improved synthesis of UDP-3-O-
acyl-N-[3 H-acetyl]glucosamine: A probe for inhibitors of LpxC in Gram-negative
bacteria. J. Labelled Compounds and Radiopharmaceuticals 48, 1049–1054.
13
Methods for Assessing the Structure and Function

of Cationic Antimicrobial Peptides
Michelle Pate and Jack Blazyk
Summary
Widespread resistance to antibiotics in current clinical use is increasing at an alarming rate.
Novel approaches in antimicrobial therapy will be required in the near future to maintain control
of infectious diseases. An enormous array of small cationic peptides exists in nature as part of
the innate defense systems of organisms ranging from bacteria to humans. For most naturally
occurring linear peptides, such as magainins and cecropins, a common feature is their capacity
to form an amphipathic -helix (with polar and nonpolar groups on opposite faces of the helix),
a structural feature believed to be important in their antimicrobial function as membrane-lytic
agents. A massive effort over the past two decades has resulted in a better understanding of the
molecular mechanism of antimicrobial peptides and the production of more potent analogues.
To date, however, few of these peptides have been shown to have clinical efficacy, especially
for systemic use, in large part due to insufficient selectivity between target and host cells.
Recently, we developed a new strategy in the design of antimicrobial peptides. These linear
cationic peptides, which form amphipathic -sheets rather than -helices, demonstrated superior
selectivity in binding to the lipids contained in bacterial vs. mammalian plasma membranes. Here
we describe methods to evaluate the structure and function of cationic antimicrobial peptides.
Key Words: antimicrobial peptides; circular dichroism (CD); large unilamellar vesicles
(LUV); membrane leakage; tryptophan fluorescence; acrylamide quenching.
1. Introduction
The structure, function, and interactions that occur between cationic antimi-
crobial peptides and various cell membranes and lipid model systems can
be evaluated using the experimental approaches described in this chapter.

155
156 M. Pate and J. Blazyk
Peptide secondary structure and binding properties can be monitored using

fluorescence and circular dichroism (CD) spectroscopy. Functional properties
measuring the effects on cells can be addressed using bacterial growth
inhibition and membrane leakage in bacteria, human red blood cells, and lipid
vesicles of any defined composition. Taken together, these results can provide
insight into structure-function relationships and the molecular mechanisms of
these peptides.
Antimicrobial activity is determined by a minimum inhibitory concentration
(MIC) assay, which measures the lowest concentration of peptide that can
prevent cell growth after a 24-hour incubation period. We generally use three
test organisms in the initial screening—two Gram-negative [Escherichia coli
(E. coli) and Pseudomonas aeruginosa (P. aeruginosa)] and one Gram-positive
[Staphylococcus aureus (S. aureus)] bacterial species. Highly active antimi-
crobial peptides can achieve MIC values of 2 μg/mL or less. Since the activity
of many, if not most, of these peptides is associated with membrane leakage
or cell lysis, a hemolytic assay is performed to test the effects of the peptide
on human red blood cells. In order to demonstrate good selectivity between
bacterial and host cells, the peptides will not induce leakage in these cells at a
concentration of at least 50 times the MIC values. We routinely test hemolytic
activity at peptide concentrations of 100, 250, and 500 μg/mL (1–3).
In order to determine whether peptide-induced membrane leakage may be
responsible for antimicrobial activity, it is useful to perform experiments specif-
ically designed to measure membrane permeability changes in bacteria and in
lipid vesicles where the composition can be manipulated to resemble either
bacterial or mammalian plasma membranes. One such assay uses a strain
of E. coli called ML-35 that possesses constitutive -galactosidase activity
that can catalyze the cleavage of the modified sugar, o-nitrophenyl -D-
galactopyranoside (ONPG), if it enters the cell. Since the bacterial membrane
in this lactose permease-deficient strain of E. coli is normally impermeable to
ONPG, a simple colorimetric measurement resulting from the production of
o-nitrophenol is used to monitor peptide-induced membrane leakage (4).
A second method involves large unilamellar vesicles (LUV) of uniform size
(usually, 100 nm in diameter), which can be formed from a wide variety of
lipid mixtures using an extrusion process. These vesicles can be loaded with
a concentrated solution of the fluorescent dye, calcein, during their assembly.
Following removal of external calcein by gel filtration, the calcein-loaded LUV
are used to monitor peptide-initiated leakage of the dye from the vesicles.
Since the calcein trapped in the vesicles undergoes self-quenching, leakage of
calcein from the LUV results in an increase in fluorescence intensity, which
Structure-Function of Cationic Antimicrobial Peptides 157
is monitored over time. By adjusting the lipid composition of the LUV, it is

possible to observe the lytic effects of the peptides on lipid bilayers mimicking
either bacterial or mammalian plasma membranes (2).
Absorbance and fluorescence spectroscopy is also useful in measuring
peptide concentration and observing the interactions between peptides and lipid
vesicles; however, peptides must contain at least one tryptophan residue in
order to take advantage of this approach. Since tryptophan absorbs light at 280
nm, a simple absorbance measurement is used to determine the concentration of
these peptides. In addition, tryptophan fluorescence is used to assess the inter-
actions between peptides and lipid vesicles. This method is based upon changes
in the emission spectrum in response to solvent polarity in the vicinity of the
tryptophan. In aqueous solution, the fluorescence emission maximum is approx-
imately 355 nm. If the peptide binds to a lipid bilayer so that the tryptophan
is shielded from water (i.e., the polarity of the environment decreases), the
emission maximum shifts to lower wavelengths (by as much as 15–20 nm) and
the fluorescence intensity is enhanced due to an increase in quantum yield (5).
This experimental observation of tryptophan fluorescence in the presence and
absence of LUV of defined composition is exploited to measure the extent and
nature of peptide binding in a quantitative fashion.
An additional tool to complement these fluorescence studies employs an
aqueous quencher of tryptophan fluorescence. By adding varying concentrations
of acrylamide to peptide-LUV mixtures, it is possible to measure the extent to
which the indole side chain is exposed to the aqueous phase. This is accom-
plished by measuring the quenching constant as determined by the Stern–Volmer
equation (6,7). An alternative approach is to incorporate quenchers such as
bromine or nitroxides in the LUV in order to provide information about the
precise location of bound peptides in relation to the lipid bilayer structure (8–10).
Circular dichroism (CD) spectroscopy can yield detailed information about
both peptide secondary structure and the interaction between peptides and lipid
vesicles. This technique can be used to distinguish between unordered (random
coil) and ordered (-helix or -sheet) structures. CD detects the wavelength-
dependent difference in absorption of right- and left-circularly polarized light
by optically active molecules such as peptides and proteins. The CD spectrum
of unordered peptides is usually characterized by a single minimum band below
200 nm, while the -helical structure usually presents two negative bands at
208 and 222 nm and one positive band at 190 nm, and the -sheet structure
typically shows a negative band at 217 nm and a positive band at 195 nm (11).
Most linear cationic antimicrobial peptides are unordered in aqueous
solution. Because these molecules are amphipathic, however, they can adopt
a defined secondary structure upon binding to the polar–nonpolar interface

of a lipid bilayer. Depending upon the design of the peptide, it may adopt
either an -helical or a -sheet structure to achieve amphipathic character.
CD spectroscopy can be used to monitor the induction of defined structure in
peptides by introducing LUV to vary the peptide-to-lipid ratio.
Through the application of all of these techniques, it is possible to harvest
a wealth of information about the structure of antimicrobial peptides and the
molecular mechanisms by which they function.
2. Materials
2.1. Peptide Source and Preparation of Stock Solutions
1. Peptides are generally synthesized using Fmoc chemistry. The crude peptides are
purified by reverse-phase HPLC, and their purity is assessed by reverse-phase
HPLC, capillary electrophoresis, and electrospray mass spectrometry. The pure
peptides are lyophilized and stored at –20 °C. Many companies offer custom peptide
synthesis services.
2. To prepare stock peptide solutions, each lyophilized frozen sample is warmed to
room temperature; the desired amount is dissolved in purified water (dH2 O) to a
concentration of 3–4 mg/mL and then stored at –20 °C. These stock solutions are
thawed, vortexed, and diluted to obtain the peptide working solutions of the desired
concentration for each assay before usage (see Note 1).
2.2. Lipid Source and Preparation of Stock Solutions

1. All phospholipids are purchased from Avanti Polar Lipids, Inc. (Alabaster, AL)
and used without further purification. The primary lipids used in our studies are
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1-palmitoyl-2-oleoyl-
sn-glycero-3-[phospho-rac-(1-glycerol)] (sodium salt) (POPG), 1-palmitoyl-2-
oleoyl-sn-glycero-3-phosphoethanolamine (POPE), and E. coli polar lipid extract.
The lipids are stored at –20 °C. Stock solutions are prepared at a concentration of
10 mg/mL in freshly distilled chloroform and stored at –20 °C for up to a month.
Chloroform is considered hazardous and toxic; thus, care should be taken to avoid
contact and inhalation of vapors during handling and distillation.
2. Phosphorus-free detergent for washing glassware (Fisher Scientific, Pittsburgh, PA).
3. 16 × 125-mm disposable glass test tubes (Fisher Scientific, Pittsburgh, PA).
4. Phospholipid concentrations are determined using a total phosphorus assay (12)
modified by Avanti Polar Lipids, Inc. (see Note 2 for Web link). The following
reagents are required for this method:
a. 8.9 N sulfuric acid solution. Slowly add concentrated sulfuric acid (H2 SO4 ,
Fisher Scientific, Pittsburgh, PA) to dH2 O and allow the heat to dissipate. Store
in a sealed container at room temperature for up to 1 year. H2 SO4 is stored at
room temperature in a ventilated cabinet away from organic solvents and should
be treated as hazardous.
b. 2.5% (w/v) ammonium molybdate solution. Add ammonium molybdate (VI)
tetrahydrate ((NH4 )6 Mo7 O24 ·4H2 O, Fisher Scientific, Pittsburgh, PA) to dH2 O.
Store in an amber bottle at 4 °C for up to 1 month.
c. 10% (w/v) L-ascorbic acid solution. Add L-ascorbic acid (Fisher Scientific,
Pittsburgh, PA) to dH2 O. Store in an amber bottle at 4 °C for up to 1 month.
d. 0.65 mM phosphorus standard solution (Sigma-Aldrich, St. Louis, MO). Store
at 4 °C.
e. 30% hydrogen peroxide (H2 O2 ) solution, phosphorus-free (Fisher Scientific,
Pittsburgh, PA); store at 4 °C. H2 O2 is an oxidizer and irritant. Care should be
taken during handling.
2.3. Preparation of Large Unilamellar Vesicles (LUV)

2.3.1. Extruder Apparatus
1. An extruder apparatus, such as the Mini-Extruder (Avanti Polar Lipids, Inc.,
Alabaster, AL) or the LiposoFast-Basic (Avestin, Inc., Ottawa, Canada), is used
to produce LUV. The extruder is fitted with either 0.05 μm- or 0.10 μm-pore
polycarbonate filters in order to produce 50- or 100-nm-diameter LUV.
2. 2:1 Chloroform/methanol solution for cleaning the extruder. Chloroform is
considered hazardous and toxic; thus, care should be taken to avoid contact and
inhalation of vapors during handling. Methanol is a suspected health hazard and
should be handled with care.
2.3.2. LUV for Tryptophan Fluorescence and Acrylamide Quenching

Experiments
HEPES buffer: 50 mM HEPES, pH 7.4, 100 mM NaCl, 0.3 mM EDTA,
0.01% (w/v) NaN3 .
2.3.3. LUV for Circular Dichroism Experiments

5 mM KH2 PO4 , pH 7.0, sterile filtered and stored in 15 mL aliquots at 4 °C.
The phosphate buffer is brought to room temperature before use.
2.3.4. Calcein-Loaded LUV Preparation

1. Calcein-free HEPES buffer: 50 mM HEPES, pH 7.4, 100 mM NaCl, 0.3 mM EDTA,
0.01% (w/v) NaN3 . The buffer is degassed, capped, and stored at room temperature
for use with the gel filtration column (see Note 3).
2. Calcein-free HEPES buffer: 50 mM HEPES, pH 7.4, 100 mM NaCl, 0.3 mM EDTA,
0.01% (w/v) NaN3 . The buffer is stored at 4 °C and brought to room temperature
before use.
3. Calcein HEPES buffer is identical but also contains 80 mM calcein (Sigma-Aldrich,

St. Louis, MO). It is stored at 4 °C and brought to room temperature before use
(see Note 4).
4. A gel filtration column containing Sephadex G-50 (Sigma-Aldrich, St. Louis, MO).
Blue dextran (5 mg/mL, Sigma-Aldrich, St. Louis, MO) is used to determine the
void volume of the column.
2.4. ONPG Leakage Experiments

1. E. coli ML-35 bacterial stock is stored in 20% glycerol at –80 °C or streaked on
Mueller-Hinton agar plates.
2. Mueller-Hinton broth and agar are used to grow and maintain the E. coli ML-35
bacteria. The broth (autoclaved in 50 mL aliquots in 125 mL screw-cap Erlen-
meyer flasks and stored at 4 °C after autoclaving) is used for growing the bacteria
to mid-logarithmic phase for the experiment. Mueller-Hinton agar is used for
maintaining the bacteria at 4 °C. Agar plates are made monthly and stored inverted
at 4 °C.
3. ONPG buffer: 10 mM NaH2 PO4 ·H2 O, 100 mM NaCl, and 1.5 mM ONPG (Sigma-
Aldrich, St. Louis, MO). ONPG is stored at –20 °C and should be warmed to room
temperature prior to weighing. Adjust pH to 7.5, and store in an amber bottle at 4 °C.
ONPG buffer is warmed to room temperature prior to conducting the experiment
and is stable for a month.
4. A highly lytic peptide, such as mellitin (Sigma-Aldrich, St. Louis, MO), at a
concentration of 64 μg/mL, is used for the 100% leakage control. Mellitin is
cytotoxic and should be handled with care.
5. Glass or plastic semi-micro 1.5 mL 1-cm-pathlength cuvettes (Fisher Scientific,
Pittsburgh, PA).
2.5. Calcein Leakage Experiments

1. Calcein-free HEPES buffer (see Section 2.3.4).
2. A suspension of 100-nm-diameter LUV prepared in calcein HEPES buffer and
contained in the void volume of the gel filtration column. See Sections 2.3.4
and 3.3.4.
3. 96-Well white assay plates (Fisher Scientific, Pittsburgh, PA).
4. 0.1% Triton-X-100 (Fisher Scientific, Pittsburgh, PA) in dH2 O.
2.6. Tryptophan Fluorescence Experiments

1. HEPES buffer: 50 mM HEPES, pH 7.4, 100 mM NaCl, 0.3 mM EDTA, 0.01%
(w/v) NaN3 .
2. A suspension of 50-nm-diameter LUV in HEPES buffer. See Sections 2.3.2
and 3.3.2.
3. A 10 × 2-mm fluorescence cuvette (Type 52 from NSG Precision Cells,

Farmingdale, NY).
4. L-tryptophan (Sigma-Aldrich, St. Louis, MO) at a 3 mg/mL concentration is used
as a control.
2.7. Acrylamide Quenching of Tryptophan Fluorescence Experiments

In addition to the items listed in Section 2.6, a 3 M acrylamide stock
solution prepared in HEPES buffer. Acrylamide should be treated and stored
as a hazardous and toxic chemical. The acrylamide buffer is stored at room
temperature and is used to make a 0.3 M acrylamide working solution by
dilution with HEPES buffer.
2.8. Circular Dichroism Experiments

1. Phosphate buffer: 5 mM KH2 PO4 , pH 7.0.
2. A suspension of 50-nm-diameter LUV in phosphate buffer. See Sections 2.3.3
and 3.3.3.
3. Trifluoroethanol (TFE, Fisher Scientific, Pittsburgh, PA). This is flammable as a
liquid or vapor and should be treated and stored as a hazardous organic solvent.
4. Acetone and Chromerge cleaning solution (Fisher Scientific, Pittsburgh, PA) for
cleaning cuvettes. Chromerge is made in concentrated sulfuric acid according to
the directions on the bottle and should be treated and disposed of as a hazardous
chemical.
5. 0.4 ml Far-UV 1-mm-pathlength quartz cuvette (Spectrocell, Oreland, PA).
3. Methods
3.1. Preparation and Quantitation of Peptide Stock Solutions
1. The concentration of tryptophan-containing peptides is determined by measuring
the absorbance at 280 nm in a 1-cm-pathlength quartz cuvette (see Note 5). The
absorbance value can be converted to concentration using Beer’s law since the
molar absorptivity (or molar extinction coefficient) of tryptophan is 5500 M−1 cm−1
at 280 nm. The concentration of other peptides containing tryptophan, tyrosine,
and/or cysteine can also be determined by measuring the absorbance at 280 nm (see
Note 6).
2. For peptides lacking these residues or of unknown composition, a wide variety of
protein assays, such as bicinchoninic acid (BCA)-based protein assay or modified
Lowry protein assay, are available commercially (see Note 7).
3. The peptide concentration may also be determined by weight. Since peptides can be
quite hygroscopic; however, this method may be less accurate than those mentioned
above.
3.2. Quantitation of Lipid Solutions

1. To prepare the sample tubes, transfer each lipid sample in duplicate (containing
approximately 0.1 μmoles phosphorus) into the bottom of a test tube. Gently
remove any solvent from the tubes under a stream of N2 (see Note 8).
2. To prepare the five standard tubes, place the following quantities of phosphorus
standard into six separate tubes in duplicate: 0 μmoles (0 μL) blank, 0.0325 μmoles
(50 μL), 0.065 μmoles (100 μL), 0.114 μmoles (175 μL), 0.163 μmoles (250 μL),
and 0.228 μmoles (350 μL) using the 0.65 mM phosphorus standard solution. The
standard tubes are then heated in a 100 °C oven to evaporate the liquid.
3. In order to break down the lipid samples to liberate inorganic phosphate, add 0.45
mL of H2 SO4 to each of the standard tubes and sample tubes. Heat all tubes in an
aluminum block in the hood at 200–215 °C for 25 min. Important: The temperature
must remain above 200 °C (see Note 9).
4. Remove tubes from the block and allow them to cool for 5 min before adding 150
μL of the H2 O2 solution to the bottom of each tube.
5. Replace the tubes in the block and continue to heat at 200–215 °C for an additional
30 min. The samples should be colorless at this point (if any brown color persists,
add an additional 50 μL of H2 O2 solution to all cooled tubes and continue heating
tubes for 15 min). Cool tubes to room temperature.
6. Add 3.9 mL of dH2 O and 0.5 mL of ammonium molybdate solution to each tube,
and vortex each tube five times.
7. Add 0.5 mL of ascorbic acid solution to each tube, and vortex each tube five
times.
8. Cap each tube with a screw cap or put a marble on each tube to prevent evaporation.
Heat all tubes at 100 °C for 7 min. Cool the tubes to room temperature.
9. Measure the absorbance of each of the five standards at 820 nm using the 0 μmoles
standard as the reference.
10. Measure the absorbance of each sample at 820 nm.
11. Generate a calibration curve using the average of the standard duplicates, and
determine the concentration of phosphorus in the samples using a least-squares fit
of the calibration points.
3.3. Preparation of Large Unilamellar Vesicles (LUV)

3.3.1. Operation of Extruder Apparatus
1. The appropriate amount of stock lipid solution in chloroform is dried down under
nitrogen and then placed under a vacuum for at least 2 h.
2. The dried lipid is hydrated with the desired volume of appropriate buffer for
the desired experiment. (See Sections 3.3.2, 3.3.3, and 3.3.4 for specific assay
requirements.)
3. The hydrated lipid is vortexed and subjected to three freeze/thaw cycles (freezing
in liquid nitrogen or a dry ice–methanol bath) with vortexing after each thaw.
4. The extruder is then assembled according to the manufacturer’s instructions with the
appropriately sized polycarbonate membrane (see Sections 3.3.2, 3.3.3, and 3.3.4
for specific assay requirements) (see Note 10).
5. The lipid mixture is drawn into the syringe and pushed through the extruder for 10
cycles (over and back counts as one cycle). The final extrusion should fill the syringe
opposite to the syringe the sample was initially drawn up in, to minimize potential
contamination with larger particles that could not pass through the polycarbonate
membrane filter.
6. The extruded LUV are placed in a sealed tube and stored at room temperature.
7. An aliquot is removed for use in the phosphorus assay (detailed in Section 3.2) to
determine LUV concentration (see Sections 3.3.2, 3.3.3, and 3.3.4).
8. The extruder is disassembled and carefully washed with phosphorus-free detergent
and a 2:1 chloroform/methanol solution (see Note 11).
3.3.2. LUV for Tryptophan Fluorescence and Acrylamide Quenching

Experiments
1. 6 μmoles of lipid stock solution are dried down and hydrated in 1 mL of HEPES
buffer.
2. 50-nm-diameter LUV are prepared using a 0.05 μm-pore polycarbonate filter.
3. LUV are then diluted 1:10 in HEPES buffer, and a 50 μL aliquot is added to a
test tube and dried down in the 100 °C oven in duplicate for quantification in the
phosphorus assay, as detailed in Section 3.2.
4. LUV are stored at room temperature until use.
3.3.3. LUV for Circular Dichroism Experiments

1. 10 μmoles of lipid stock solution are dried down and hydrated in 1 mL of Phosphate
buffer.
2. 50-nm-diameter vesicles are prepared using a 0.05 μm-pore polycarbonate filter.
3. LUV are then diluted 1:10 in phosphate buffer, and a 50 μL aliquot is added to a
test tube and dried down in the 100 °C oven in duplicate for quantification in the
phosphorus assay, as detailed in Section 3.2 (see Note 12).
4. LUV are stored at room temperature until use.
3.3.4. Calcein-Loaded LUV for Calcein Leakage Experiments

1. A gel filtration column (we use a 1 × 30-cm burette fitted with a Teflon stopcock)
and a slurry containing 5 g of Sephadex G-50 in 50 mL of HEPES buffer are
required (see Note 13).
2. The Sephadex/HEPES slurry is heated without stirring in a beaker that is placed
in a water bath at 90 °C for 1 h (see Note 14). The slurry is cooled to room
temperature.
3. A water-saturated plug of glass wool is fitted into the column just above the
stopcock. The column is filled with a resin bed of about 24 mL. The cooled slurry
is carefully poured into the column to form the resin bed. It is necessary to ensure
that no air bubbles are trapped within the resin (see Note 15).
4. After the resin has settled to the appropriate column volume, the column is
equilibrated with 5 column volumes of degassed HEPES buffer (see Note 16).
5. 200 μL of a 5 mg/mL blue dextran solution are eluted through the column with
degassed HEPES buffer to ensure that the resin is evenly distributed and to
determine the void volume. The column is then washed and equilibrated.
6. 4 μmoles of lipid stock solution are dried down and hydrated in 300 μL calcein
HEPES buffer.
7. 100-nm-diameter LUV are prepared using the 0.1 μm-pore polycarbonate filter.
8. The extruded sample is centrifuged very briefly in a microcentrifuge tube (to
collect all the sample in the bottom of the tube) and then applied to the gel
filtration column in order to separate the calcein-loaded LUV from calcein in the
surrounding buffer, using degassed calcein-free HEPES buffer as the eluent (see
Note 17).
9. Calcein-loaded LUV are easily visible (deep-orange in color) and elute through the
column first (before the free calcein, which is yellow-green in color; see Note 18).
The calcein-loaded LUV fraction is collected, and the column is then washed to
remove the remaining free calcein and equilibrated with HEPES buffer for reuse.
10. A 100 μL aliquot of calcein-loaded LUV is added to a test tube and dried down
in the 100 °C oven in duplicate for quantification using the phosphorus assay, as
detailed in Section 3.2.
11. Calcein-loaded LUV are stored in a capped vial at 4 °C for up to a week or until
leakage is visible (see Note 19).
3.4. ONPG Leakage Experiments

1. Absorbance spectra are collected using a UV-visible spectrophotometer at 405 nm
over a period of 15 min. We monitor six samples simultaneously using 1-min cycles
in a 6-well changer at 37 °C.
2. First, the MIC value for each peptide against E. coli ML-35 bacteria must be
determined (see Note 20).
3. An inoculum of E. coli ML-35 (from a –80 °C frozen stock or a streak plate stock)
is added to 50 mL of Mueller-Hinton broth and permitted to grow for at least 12 h
in a 37 °C shaking incubator.
4. A 500 μL aliquot of this suspension is then transferred to a fresh 50 mL aliquot
of Mueller-Hinton broth and allowed to grow in a 37 °C shaking incubator to
mid-logarithmic phase (2 × 1011 CFU/mL; see Note 21). The bacterial culture
is then cooled to 0–4 °C throughout the remainder of the experiment to prevent
further growth.
5. Each peptide stock solution is diluted to make 1 mL of a working solution that is
20 times the MIC value. Serial dilutions are then made to obtain 500 μL of each of
the following concentrations: 20 × MIC, 10 × MIC, 5 × MIC, 2.5 × MIC, 1.25 ×

MIC, and 0.625 × MIC (see Note 22).
6. The temperature in the spectrophotometer is maintained at 37 °C throughout the
experiment. Six cuvettes are prepared for measurement in the 6-cell changer. The
rate of o-nitrophenol production is monitored at 405 nm for 15 min, with an
absorbance reading taken every minute for each of the 6 samples in the cell changer.
The experiment is performed in triplicate for the controls and in duplicate for each
peptide concentration.
7. After swirling the Erlenmeyer flask, a 100 μL aliquot of E. coli ML-35 suspension is
added to 700 μL of ONPG buffer in a disposable plastic 1-cm-pathlength microcu-
vette. Initial readings are recorded for each sample prior to the 200 μL addition of
control or peptide solutions. Upon addition, the contents are mixed by pipetting up
and down several times, and readings are recorded at 1-min intervals over 15 min.
dH2 O serves as the blank, and a highly lytic peptide known to induce complete
leakage, such as mellitin at 64 μg/mL, is used as the 100% control (see Note 23).
8. The percent maximal rate of ONPG cleavage is calculated by comparison of the
peptide-induced reaction rate to that of the 100% control (see Note 24).
3.5. Calcein Leakage Experiments

1. Fluorescence emission intensity is measured using a fluorescence spectrophotometer
with an excitation wavelength of 490 nm and an emission wavelength of 520 nm
over 4 min. The excitation and emission slit widths are 5 nm and 2.5 nm, respec-
tively. The experiment is conducted at room temperature, and the spectrophotometer
is equipped a 96-well plate accessory. The assays are performed by measuring 8
wells simultaneously. While it is possible to perform these experiments using a
single cuvette, a 96-well-plate accessory allows for efficient processing of a large
number of samples and conserves sample and reagents due to the small volume in
each well.
2. The calcein-loaded LUV stock suspension is diluted to a lipid concentration of 11
μM in 25 mL of HEPES buffer. A 180 μL aliquot of the diluted suspension is added
to each of the eight wells using a multi-channel pipette. This results in a final lipid
concentration of 10 μM in the final sample volume of 200 μL.
3. The lipid-to-peptide ratios that we tested are 2:1, 4:1, 8:1, 16:1, 32:1, 64:1, 128:1,
and 256:1. The peptide is diluted to achieve the desired concentrations (see Note 25).
4. For each assay, eight wells are measured simultaneously. The following aliquots
are added as follows: 20 μL of dH2 O are added to well 1 as the negative control;
20 μL of 0.1% Triton X-100 are added to well 2 as the 100% control; 20 μL of a
peptide solution are added to wells 3–5 and 6–8 to provide triplicate samples of two
different lipid-to-peptide ratios in each assay. This procedure is continued for all of
the remaining lipid-to-peptide ratios, with both negative and positive controls being
scanned in each set of eight wells (see Note 25). The multichannel pipette is used
to mix the contents of the eight wells using the cycle mode, and then data collection
begins. The spectrophotometer is programmed to monitor the fluorescence intensity

of each of the eight wells over the desired time period (usually, 4 min). Four
eight-well cycles are necessary to collect the data for all lipid-to-peptide ratios.
5. We constructed a Teflon tray to facilitate the pipetting procedure. Using the tray,
the eight pipette channels deliver the negative and positive controls and triplicate
aliquots of peptide solution for two of the lipid-to-protein ratios (see Note 26).
6. A data point is collected every 30 s for each well, and the emission intensity at
3 min is used for the analysis. The negative controls are averaged and subtracted
from the averaged values for the positive controls and each lipid-to-peptide ratio.
The % leakage for each lipid-to-peptide ratios is calculated by comparison to the
100% control to determine the percentage of leakage.
3.6. Tryptophan Fluorescence Experiments

1. Tryptophan fluorescence emission spectra are collected using a fluorescence
spectrophotometer from 320–375 nm at 1-nm increments using an excitation
wavelength of 280 nm, at a signal-to-noise ratio of 500. The excitation and emission
slit widths are 10 nm and 5 nm, respectively. The experiment is conducted at room
temperature, and the spectrophotometer is equipped with a polarizing filter.
2. Lipid-to-peptide ratios of 1:1, 5:1, 10:1, 15:1, 20:1, 30:1, and 50:1 are measured
at a constant peptide concentration of 10 μM. The lipid concentration in the LUV
suspension (see Section 3.3.2) is used to calculate the volume needed to achieve the
desired ratio. It is usually necessary to dilute the LUV suspension 100-fold for the
1:1 ratio, and 10-fold for the 5:1, 10:1, 15:1, and 20:1 ratios. The undiluted LUV
suspension is added directly for the 30:1 and 50:1 ratios (see Note 27). The total
volume in the cuvette is adjusted to 600 μL with the HEPES buffer. The cuvette is
covered with Parafilm and inverted several times to ensure thorough mixing before
being placed in the sample holder of the spectrophotometer.
3. A polarizing filter is set for cross polarization (with excitation vertical and emission
horizontal) in order to minimize artifacts from scattering by the LUV.
4. The 10 × 2-mm cuvette is placed in the spectrophotometer with the long axis facing
the excitation beam. The instrument should first be zeroed using the HEPES buffer
alone. The first scan for each peptide is peptide in the absence of LUV, followed
by each of the lipid-to-peptide ratios.
5. A correction factor for signal intensity attenuation due to scattering of light by LUV
is determined from a control experiment using tryptophan monomers in place of
the peptide.
6. The cuvettes are periodically cleaned with Chromerge to remove any lipid and
peptide residue (see Note 28).
7. The data are analyzed by determining the fluorescence emission intensity value at
330 nm for each spectrum and averaging the duplicate scans together. These values
are corrected for LUV-induced light-scattering effects at each lipid concentration
by using the ratio of intensities (I values) at 330 nm of 10 μM tryptophan (Trp) in

the absence and the presence of LUV, as shown in the following equation:
Icorrected = Imeasured · ITrp+buffer /ITrp+LUV (1)
8. Peptide interactions with LUV can be estimated by plotting the relative intensity at
330 nm as a function of the lipid-to-peptide ratio [2, 13] .
3.7. Acrylamide Quenching of Tryptophan Fluorescence Experiments

1. Tryptophan fluorescence emission spectra are collected using a fluorescence
spectrophotometer from 310–390 nm at 1-nm increments and an excitation
wavelength of 295 nm, at a signal-to-noise ratio of 500. The excitation and emission
slit widths are 10 nm and 5 nm, respectively, and the experiments are conducted at
room temperature.
2. A control experiment is performed for each peptide with increasing concentrations
of acrylamide to measure quenching on tryptophan emission in the absence of
LUV (see Note 29). It is necessary to dilute the peptides 10-fold to obtain the
desired concentration of 10 μM. An aliquot of 0.3 M acrylamide is added to
produce concentrations from 20 to 200 mM in 20-mM increments (see Note 30).
For each spectrum, the spectrophotometer is zeroed using the same concentration
of acrylamide in the absence of peptide. After the peptide and acrylamide solutions
are added, HEPES buffer is added so that the total volume in the cuvette is 600 μL.
The cuvette is covered with Parafilm and inverted several times to ensure proper
mixing before being placed in the spectrophotometer. For the first measurement,
the spectrophotometer should be zeroed on the HEPES buffer alone, followed by a
scan of buffer and peptide only.
3. We generally use a lipid-to-peptide ratio of 10:1. It is necessary to dilute the peptides
10-fold to obtain the desired 10 μM concentration, and the LUV are also diluted
10-fold to achieve this ratio. After the peptides, LUV, and acrylamide aliquots have
been added, the HEPES buffer is added to adjust the total volume in the cuvette
to 600 μL. For the first measurement, the spectrophotometer is zeroed using the
HEPES buffer alone, followed by a peptide and lipid control excluding acrylamide.
Then spectra are recorded at the 10 different acrylamide concentrations.
4. The cuvettes are periodically cleaned with Chromerge to remove any lipid and
peptide residue (see Note 28).
5. The data are analyzed by obtaining the maximum peak intensity value and gener-
ating a value for F 0 /F at each acrylamide concentration, where F0 is the tryptophan
emission intensity in the absence of acrylamide and F is the intensity in the presence
of acrylamide. A plot of F0 /F as a function of acrylamide concentration is used to
estimate the degree of accessibility to the quencher according to the Stern–Volmer
equation (see discussion and references in Section 1).
3.8. Circular Dichroism Experiments

1. We use a Jasco J-715 spectropolarimeter with J-700 software to collect CD spectra,
which are measured using a 1-mm-pathlength (0.4 mL) quartz cuvette and recorded
from 190–250 nm at a sensitivity of 100 mdeg, resolution of 0.2 nm, response
time of 8 s, bandwidth of 1.0 nm, and scan speed of 10 nm/min, and are averaged
over 2 accumulations. These parameters should be easily transferable to other
spectropolarimeters.
2. The peptide concentration in the cuvette of 20 μM remains the same for all measure-
ments. An aliquot of LUV is added to achieve the desired lipid-to-peptide ratio, with
final lipid concentrations of 20 μM, 100 μM, 200 μM, and 400 μM, corresponding
to lipid-to-peptide ratios of 1:1, 5:1, 10:1, and 20:1, respectively. The total volume
in the cuvette is 200 μL (see Note 27).
3. Before each experiment, the cuvette is first scanned with buffer alone to ensure that
peptide residue is present.
4. A peptide is first scanned with phosphate buffer alone, followed by 50% TFE in
phosphate buffer. The TFE acts as a positive control, since most peptides will form
an -helical structure in the presence of TFE. Then the peptide is scanned in the
presence of LUV at 1:1, 5:1, 10:1, and 20:1 lipid-to-peptide ratios. Duplicate scans
are collected, and a second set of data from a different LUV preparation with the
same lipid composition is collected for comparison.
5. The samples are prepared by addition of the appropriate volumes of peptide, LUV,
and buffer to the cuvette, covered with Parafilm, inverted several times to ensure
proper mixing, and placed in the sample holder of the spectropolarimeter.
6. It is important to note that, in order to calculate the correct molar ellipticity values,
the concentration is defined by the number of amide bonds present in the peptide
in units of molarity. For instance, a 20-residue peptide contains 19 amide bonds
(exclusive of any present in side-chain groups). Thus, if the peptide concentration
in the cuvette is 20 μM (2 × 10−5 M), the concentration of amide bonds used to
determine molar ellipticity is 3.8 × 10−4 M.
7. Cleaning the cuvette is critical for reproducible results. Cuvettes are cleaned by
rinsing with water and acetone, followed by drying with nitrogen. The next sample
can then be prepared in the clean cuvette and mixed immediately before being
scanned. If the sample contains TFE, it should be treated as hazardous waste. After
a complete set of scans has been collected for a peptide, the cuvette is cleaned with
Chromerge (see Note 28).
4. Notes
1. All solutions are prepared in distilled/de-ionized water (dH2 O) unless otherwise
noted.
2. For the total phosphorus assay procedure, see the Technical section of the
Avanti Polar Lipids, Inc. Web site: http://www.avantilipids.com/Technical
DeterminationOfTotalPhosphorus.asp?t=Total%20Determination%20Of%20Total
%20Phosphorus.
3. Buffers must be stored at room temperature following degassing.
4. Calcein will not dissolve easily at this concentration until the pH is adjusted to
7.4. Add 0.5 g calcein to 1 or 2 mL of HEPES buffer and add several mL of 1
M NaOH to reach pH 7.4. Adjust the volume to 10 mL using the HEPES buffer,
and store in a vial at 4 °C.
5. The peptides are generally diluted by 1:20 or 1:50 in dH2 O for absorbance
measurements. The dilution factor depends on both the peptide concentration of
the solution and the relative content of amino acid residues that absorb at 280 nm.
6. According to Beer’s law, A = ecl, where A is absorbance (no units), ? is the
wavelength-dependent molar absorptivity or molar extinction coefficient (with
units of M−1 cm−1 ), c is the concentration of the absorbing compound (expressed
in molarity), and l is the path length of the cuvette (in cm). A detailed
explanation of how to use the absorbance at 280 nm to measure the concen-
tration of peptides and proteins is provided on the Pierce Biotechnology, Inc.
Web site at: http://www.piercenet.com/files/TR0006dh5-Extinction-coefficients.
pdf#search=%22peptide%20absorbance%20extinction%22.
7. A description of a variety of protein assays that can be used to measure the concen-
tration of peptides and proteins is provided on the Pierce Biotechnology, Inc.
Web site at: http://www.piercenet.com/Proteomics/browse.cfm?fldID=BE219700-
9B95-43A1-A3DA-83800F1A0392.
8. We typically use 5 μL of a 10 mg/mL lipid stock solution.
9. Since the temperature must be maintained above 200 °C at all times, all test tubes
are preheated in the heating block for 5 min. The H2 SO4 is then added directly to
the tubes in the heating block.
10. We have used the following extruders to prepare LUV in our laboratory: the
Liposofast-Basic extruder (Avestin, Inc., Ottawa, Canada) and the Avanti Mini-
Extruder (Avanti Polar Lipids, Inc., Alabaster, AL). The Liposofast-Basic extruder
is assembled as follows. There is a central metal body with two nuts that screw
onto each end. Loosely screw a nut onto one end of the central metal body. Place
the rubber O-rings into the grooves of each of two Teflon inserts. One Teflon
insert is then placed in the metal assembly so that the O-ring faces toward the
center and the metal portion extends through the hole in the nut. A membrane
support filter is placed inside the O-ring. The appropriate pore-size polycarbonate
membrane is then placed over the O-ring and membrane support filter. It may be
necessary to remove static electricity at this point with a static gun in order to
seat the membrane properly. Another membrane support filter is placed on top of
the polycarbonate membrane, followed by the other Teflon insert with its O-ring
facing the polycarbonate membrane. Finally, the second nut is loosely screwed
onto the assembly, and then the two nuts are simultaneously tightened. Instructions
for the use of the Avanti Mini-Extruder are provided by the manufacturer.
11. After the extruder is completely disassembled, all pieces are soaked in a
phosphorus-free detergent bath for a few minutes and carefully rinsed with tap
water followed by a dH2 O rinse. It is important to clean the Teflon inserts
with a soap solution using a syringe and then thoroughly rinse with dH2 O.
It is also important to thoroughly clean the extruder components using a 2:1
chloroform/methanol solution to remove all traces of lipid. This is followed by an
aqueous rinsing, a phosphorus-free detergent soak, and a final rinsing in dH2 O.
The pieces are then allowed to air-dry.
12. It should be noted that although LUV for CD experiments are prepared in
phosphate buffer, the additional phosphorus contributed by the buffer is negli-
gible and does not introduce appreciable error during when measuring the LUV
concentration.
13. We find it useful to make 50% more than necessary to ensure that there is enough
available should any problems arise during column preparation.
14. Stirring introduces air bubbles into the resin and must therefore be avoided. It is
necessary to maintain the volume of the slurry by adding water during this time.
15. Adding the slurry continuously as the resin settles results in a more uniform
column bed. If necessary, the stopcock can be opened to speed the settling process.
16. It is imperative that the level of the buffer is always maintained above the top of
the resin in the column. Therefore, the buffer delivery must be closely monitored.
Cracks or air bubbles present within the resin bed indicate that the column is
defective and must be repoured. The column is washed and equilibrated by elution
with five column volumes of degassed HEPES buffer.
17. A volume of 300 μL of lipid suspension is extruded, and while some is lost during
the extrusion process due to the void volume in the apparatus, at least 200 μL of
extrusion product is recovered for application to the column.
18. Mounting a piece of white paper behind the column makes it easier to visualize the
calcein-loaded LUV entering the glass wool. A well-packed column will result in
2–3 in. of separation between the calcein-loaded LUV and the free calcein when
the LUV elute from the column.
19. Calcein-loaded LUV should be used within a week of preparation. POPC, in
particular, should be monitored for signs of leaky vesicles prior to a week. Best
results can be expected when the calcein-loaded LUV are freshly prepared.
20. Antimicrobial susceptibility testing against E. coli ML-35 is performed using a
modification of the National Committee for Clinical Laboratory Standards microdi-
lution broth assay. Mueller-Hinton broth is used for diluting the bacterial inoculum.
The inoculum is prepared from mid-log phase cultures at an approximate concen-
tration of 106 CFU/mL. Microtiter plate wells receive aliquots of 0.1 mL each of
the inoculum and peptide dilution. The final concentration of the peptide solution
ranges from 0.5 to 64 μg/mL in 2-fold dilutions. The microtiter plates are incubated
overnight at 37 °C. Minimum inhibitory concentration (MIC) is defined as the
lowest concentration that completely inhibits growth of the organism.
21. We measure the absorbance at 600 nm, using fresh Mueller-Hinton broth as the
blank, and calculate the bacterial concentration using a calibration curve that
correlates number of bacteria with absorbance. The bacteria are then either diluted
or allowed to incubate longer to achieve the desired bacterial concentration. Based
on our growth curve, this takes approximately 3 h.
22. Since the peptide undergoes a 1:5 dilution in the cuvette, the peptide concentrations
in the assay are 4 × MIC, 2 × MIC, 1 × MIC, 0.5 × MIC, 0.25 × MIC, and 0.125
× MIC.
23. The leakage values can be normalized to the peptide inducing the greatest leakage
if necessary.
24. The sample absorbances are averaged for each peptide concentration at 5 and 15
min, and the slope is calculated. The slope of the blank is subtracted from the
slope of the 100% control and peptide sample slopes. All of the values are then
divided by the 100% control slope to determine the percentage of ONPG leakage
for each peptide at each concentration tested. None of our peptides has shown any
direct effect upon -galactosidase activity. In all cases, our reaction rates have
been linear over the 15-min time course.
25. The stock peptide solution is diluted to 50 μM in 500 μL of dH2 O for the 2:1
lipid-to-peptide ratio. For the 4:1, 8:1, and 16:1 ratios, 100 μL, 50 μL, and 25 μL
of the 50 μM peptide solution are added to 100 μL, 150 μL, and 175 μL of dH2 O,
respectively. A 3.13 μM peptide solution is made by combining 30 μL of the 50
μM peptide solution with 450 μL of dH2 O for the 32:1 ratio. For the 64:1, 128:1,
and 256:1 ratios, 100 μL, 50 μL, and 25 μL of the 3.13 μM peptide solution are
added to 100 μL, 150 μL, and 175 μL of dH2 O, respectively.
26. A customized trough, machined from a Teflon block, was designed to allow a
multichannel pipette to simultaneously add 20 μL aliquots to an 8-well section
of the 96-well plate. With four rows, the trough will hold all of the dilutions
necessary to measure the entire range of lipid-to-peptide ratios for one peptide.
The first column of circular wells in the trough is filled with dH2 O for the negative
control. The second column of wells in the trough is filled with 0.1% Triton X-100
for the positive control. Each of the long rectangular wells, designed to accept
three pipette tips, is filled with 200 μL of the desired peptide dilution (see Note
25). Care must be taken to prevent air bubble formation during pipettings. After
the four rows in the trough have been assayed, the trough is cleaned with soap,
thoroughly rinsed with dH2 O, and allowed to dry. The diagram of the Teflon
trough is shown below.
OO
OO
OO
OO
27. These volumes and concentrations could be changed if necessary but will most
likely remain consistent throughout the experiments. We have set up an Excel
spreadsheet to calculate the appropriate volumes of lipid, peptide, and buffer that
are required for each ratio based on the lipid and peptide stock concentrations to
automate these calculations.
28. All cuvettes that routinely come into contact with LUV should be periodically
cleaned with Chromerge to remove any peptide and lipid residue. This procedure
should be carried out in the hood and done so carefully wearing chemical-resistant
gloves. The cuvettes should be filled with Chromerge solution and allowed to sit
for 2–3 min. The Chromerge should then be discarded into a beaker containing
sodium bicarbonate to neutralize the H2 SO4 , and the cuvettes should be rinsed
well with dH2 O.
29. As increasing amounts of acrylamide are added, the fluorescence emission intensity
of tryptophan decreases due to collisional quenching. If the peptide binds to LUV,
so that the tryptophan residues are less accessible to the solvent, the degree of
quenching is reduced in proportion to binding.
30. Varying concentrations of acrylamide used to zero the fluorescence spectropho-
tometer are prepared as follows:
0 mM = 600 μL of HEPES buffer,
20 mM = 40 μL of 0.3 M acrylamide and 560 μL of HEPES buffer,
180 mM = 360 μL of 0.3 M acrylamide and 240 μL of HEPES buffer, and
200 mM = 400 μL of 0.3 M acrylamide and 200 μL of HEPES buffer.
The 10μM peptide volume is added to each for the control experiments and the
HEPES buffer is decreased by that volume.
Acknowledgments
The authors would like to thank Dr. Renato Gennaro for providing the
E. coli ML-35 bacterial strain and Dr. Alexey Ladokhin for helpful discus-
sions concerning the fluorescence experiments. This work was supported by
NIH Grants AI-047165 and C06-RR-14575 by the Ohio University College of
Osteopathic Medicine.
References
1.
1 Blazyk, J., Wiegand, R., Klein, J., Hammer, J., Epand, R. M., Epand, R. F,
Maloy, W. L., and Kari, U. P. (2001) A novel linear amphipathic beta-sheet
cationic antimicrobial peptide with enhanced selectivity for bacterial lipids. J. Biol.
Chem. 276, 27899–27906.
2.
2 Jin, Y., Mozsolits, H., Hammer, J., Zmuda, E., Zhu, F., Zhang, Y., Aguilar, M. I.,
and Blazyk, J. (2003) Influence of tryptophan on lipid binding of linear amphipathic
cationic antimicrobial peptides. Biochemistry 42, 9395–9405.
3.
3 Jin, Y., Hammer, J., Pate, M., Zhang, Y., Zhu, F., Zmuda, E., and Blazyk, J. (2005)
Antimicrobial activities and structures of two linear cationic peptide families with
various amphipathic beta-sheet and alpha-helical potentials. Antimicrob. Agents
Chemother. 49, 4957–4964.
4.
4 Skerlavaj, B., Romeo, D., and Gennaro, R. (1990) Rapid membrane permeabi-
lization and inhibition of vital functions of Gram-negative bacteria by bactenecins.
Infect. Immun. 58, 3724–3730.
5.
5 Lakowicz, J. R. (1999) Protein fluorescence. In Principles of Fluorescence
Spectroscopy, 2nd ed. Kluwer Academic/Plenum Publishers, New York, pp.
445–486.
6.
6 Breukink, E., Van Kraaij, C., Van Dalen, A., Demel, R. A., Siezen, R. J.,
De Kruijff, B., and Kuipers, O. P. (1998) The orientation of nisin in membranes.
Biochemistry 37, 8153–8162.
7.
7 Schibli, D. J., Hwang, P. M., and Vogel, H. J. (1999) Structure of the antimicrobial
peptide tritrpticin bound to micelles: A distinct membrane-bound peptide fold.
8.
8 Ladokhin, A. S. (1999) Analysis of protein and peptide penetration into membranes
by depth-dependent fluorescence quenching: Theoretical considerations. Biophys.
J. 76, 946–955.
9.
9 Epand, R. F., Epand, R. M., Monaco, V., Stoia, S., Formaggio, F., Crisma, M.,
and Toniolo, C. (1999) The antimicrobial peptide trichogin and its interaction with
phospholipid membranes. Eur. J. Biochem. 266, 1021–1028.
10.
10 Hong, J., Oren, Z., and Shai, Y. (1999) Structure and organization of hemolytic and
nonhemolytic diastereomers of antimicrobial peptides in membranes. Biochemistry
38, 16963–16973.
11.
11 Campbell, I. D., and Dwek, R. A. (1984) Optical activity. In Biological
Spectroscopy. The Benjamin/Cummings Publishing Company, Inc., Menlo Park,
CA, pp. 255–277.
12.
12 Chen, P. S., Toribara, T. Y., and Warner, H. (1956) Microdetermination of
phosphorus. Anal. Chem. 28, 1756–1758.
13.
13 Ladokhin, A. S., Jayasinghe, S., and White, S. H. (2000) How to measure and
analyze tryptophan fluorescence in membranes properly, and why bother? Anal.
Biochem. 285, 235–245.
14
Flow Cytometry of Bacterial Membrane Potential

and Permeability
Howard M. Shapiro
Summary
This chapter describes reliable flow cytometric methods for assessment of two important
physiologic characteristics of bacteria, membrane potential and membrane permeability, which
can provide indications of the effects of antimicrobial agents on microorganisms.
Key Words: bacteria; cyanine dyes; flow cytometry; membrane permeability; membrane
potential.
1. Introduction
Although Leeuwenhoek’s microscopes introduced science to the microbial
world at the single-cell level in the 17th century, most analyses of microbial
growth and metabolism done in modern laboratories are still accomplished
using bulk measurements of large numbers of cells, limiting the degree to
which microbial behavior can be understood, especially with regard to detecting
heterogeneity within populations. The technology of cytometry (1–5) now
makes it possible to carry out detailed studies of the physiology of microor-
ganisms. Perturbations resulting from the action of physical and chemical agents
can be examined at the single-cell level, using much smaller inocula and smaller
amounts of reagents. This permits results to be obtained in a shorter period
of time and could thus potentially play a useful role in antimicrobial drug
development.

175
176 H. M. Shapiro
Cytometry is the measurement of physical or chemical characteristics of

cells. In flow cytometry (1), measurements are made while the cells or particles
pass, preferably in single file, through the measuring apparatus in a fluid stream.
Although optical cytometry and microscopy may employ similar components,
flow cytometers and low-resolution image cytometers collect little or no
morphologic information, instead measuring optical properties of whole cells.
The intensity of light scattered at small angles (0–5°) to the illuminating
beam (forward scatter) provides a rough indication of cell size, but cannot
reliably relate sizes of different types of cells; the intensity of light scattered
at larger angles (15–135°) (side scatter) gives an indication of the complexity
of cells’ internal structures. Much more specific information can be extracted
from measurements of fluorescence of intrinsic cellular constituents and/or of
externally applied reagents, often referred to as probes. Among the probes
commonly used in flow cytometry are labeled antibodies and oligonucleotides,
fluorogenic enzyme substrates, dyes that quantify nucleic acids, and indicators
of physiologic state, e.g., intracellular pH and membrane potential.
In modern flow cytometry, it is commonplace to make multiparameter
measurements, using light-scattering signals to grossly characterize one or
several cell populations. In addition, two or more fluorescence signals are
employed for more precise discrimination between populations and/or better
determination of specific chemical constituents or of physiologic states.
Although the most complex instruments now available can measure fluores-
cence in 18 spectral bands, using as many as 5 laser beams for fluorescence
excitation, most flow cytometry done on microorganisms to date has been
restricted to analyses of 4 or fewer fluorescence signals.
In principle, one can use a flow cytometer to measure the same param-
eters in bacteria or even viruses, as are commonly measured in eukaryotic
cells. However, the size, mass, nucleic acid, and protein content of bacteria are
approximately 1/1,000 the magnitude of the same parameters in mammalian
cells. Thus, whereas hundreds of thousands of probe molecules may be bound to
appropriately stained eukaryotic cells, individual bacteria often contain no more
than a few tens of thousands of molecules. The resulting low-intensity fluores-
cence signals typically exhibit large variances due to photoelectron statistics;
some microbial constituents may thus be undetectable or measurable with only
limited precision.
Bacteria also tend to behave differently from eukaryotes in terms of their
interaction with reagents used in cytometry. Uptake and efflux of dyes, drugs,
and other reagents by and from bacteria are affected by the structure of the cell
wall and by the presence of pores and pumps that may or may not be analogous
Flow Cytometry of Bacterial Membrane Potential and Permeability 177
to those found in eukaryotes. Moreover, the outer membrane of Gram-negative

bacteria (6) excludes most lipophilic or hydrophobic molecules, including
reagents such as cyanine dyes. Although chemicals such as ethylene diamine
tetraacetic acid (EDTA) may be used to permeabilize the outer membrane
to lipophilic compounds with at least transient retention of some metabolic
function (7,8), the characteristics of the permeabilized bacteria are distinct from
those of organisms in the native state.
Gram-positive organisms may take up a somewhat wider range of reagents
without additional chemical treatment, but are no more predictable. Walberg
et al. (9) found substantial variability in patterns of uptake of different nucleic
acid binding dyes by Gram-positive species. Mycobacteria, which readily take
up lipophilic compounds, may resist penetration by some hydrophilic molecules.
As one might guess, it is difficult to design multiparameter staining protocols
that will work, unmodified, across a wide range of bacterial genera and species.
Although the methods described here for assessment of bacterial membrane
potential and permeability have been successfully applied to both Gram-
negative organisms and Gram-positive organisms, with Mycobacteria included
among the latter, there are no guarantees.
1.1. Defining Bacterial “Viability”: Membrane Permeability

vs. Metabolic Activity
Characterizing microorganisms as viable or nonviable at the single-cell level is
essential in determining effects of antimicrobial agents or other adverse environ-
mental conditions. A number of criteria for “viability” have been suggested;
impermeability of the membrane to nucleic acid dyes such as propidium is
one, and the presence of metabolic activity, as indicated by the production
and retention of fluorescent product from a nonfluorescent enzyme substrate or
by maintenance of a membrane potential, is another. However, until recently,
relatively few investigators had reported making flow cytometric measurements
of more than one of these characteristics in the same cells at the same time.
Propidium (usually available as the iodide [PI]) and ethidium (usually
available as the bromide [EB]) are structurally similar nucleic acid dyes.
Both contain a phenanthridinium ring, and both bind intercalatively to double-
stranded nucleic acids, increasing fluorescence yield approximately 30 times
when bound. Ethidium has only a single positive charge, delocalized over the
ring; the side chain on its ring nitrogen is an ethyl group. Ethidium and other
dyes with a single delocalized positive charge are membrane-permeant; i.e., they
cross intact prokaryotic and eukaryotic cytoplasmic membranes, although the
dyes may be pumped out by efflux pumps.
178 H. M. Shapiro
Propidium bears a double positive charge because its ring nitrogen side chain
is an iso-propyl group with a quaternary ammonium substituent. Like a number
of other dyes that also bear quaternary ammonium groups and more than one
positive charge [e.g., TO-PRO-1, TO-PRO-3, and Sytox Green, all from Invit-
rogen/Molecular Probes (Eugene, OR)], propidium is generally believed to be
membrane-impermeant; i.e., excluded by prokaryotic and eukaryotic cells with
intact cytoplasmic membranes. Cells that take up propidium and other multiply
charged dyes are usually considered to be nonviable, although transient perme-
ability to these dyes can be induced by certain chemical and physical treat-
ments, e.g., electroporation, with subsequent recovery of membrane integrity
and viability. Thus, staining (or, more properly, the lack thereof) with propidium
is the basis of a so-called dye exclusion test of viability. Acid dyes, such as
trypan blue and eosin, are also membrane-impermeant and are used in dye
exclusion tests.
A variation on the dye exclusion test employs a nonfluorescent, membrane-
permeant substrate for an intracellular enzyme, which crosses intact or damaged
cell membranes and which is then enzymatically cleaved to form a fluorescent,
impermeant (or slowly permeant) product. The product is retained in cells
with intact membranes and quickly lost from putatively nonviable cells with
damaged membranes. One commonly used substrate is diacetylfluorescein,
also called fluorescein diacetate (FDA), which yields the slowly permeant
fluorescein. Nonfluorescent esters of some other fluorescein derivatives are
better for dye exclusion tests because their products are less permeant (10).
Another substrate is 5-cyano-2,3-ditolyl tetrazolium chloride (CTC) (2). This is
reduced by intracellular dehydrogenases to a fluorescent formazan and provides
an indication of respiratory activity as well as of membrane integrity.
Bacteria normally maintain an electrical potential gradient (membrane
potential, ) of over 100 mV across the cytoplasmic membrane, with the
interior side negative. Charged dyes that are sufficiently lipophilic to pass
readily through the lipid bilayer portion of the membrane partition across the
membrane in response to the potential gradient. Positively charged lipophilic
dyes, such as cyanines, are concentrated inside cells that maintain , while
negatively charged lipophilic dyes, such as oxonols, are excluded. Thus, if two
cells of the same volume, one with a transmembrane potential gradient and one
without, were equilibrated with a cyanine dye, the cell with the gradient would
contain more dye than the one without. If the cells were equilibrated with an
oxonol dye, the cell without the gradient would contain more dye. However,
cells with different volumes may contain different amounts of dye, irrespective
of their s, because it is the concentration of dye, rather than the amount
of dye, in the cell that reflects . The flow cytometer measures the amount,
not the concentration.
When the cyanine dye 3,3 -diethyloxacarbocyanine iodide (DiOC2 (3))
(typically excited at 488 nm) is added to cells at much higher concentrations
than are normally used for flow cytometric estimation of , it is possible
to detect red (∼610 nm) fluorescence in addition to the green (∼525 nm)
fluorescence normally emitted by this dye (11). The red fluorescence is likely
due to the formation of dye aggregates. At high dye concentrations, the green
fluorescence is dependent on cell size but independent of , whereas the red
fluorescence is both size- and potential-dependent. The ratio of red and green
fluorescence, which is largely independent of size, provides a more accurate
and precise measurement of bacterial than can be obtained from simple
fluorescence measurements.
In addition, the protocol described here uses the far-red (>695 nm) fluores-
cence of TO-PRO-3, excited by a red He-Ne (633 nm) or diode (635-640 nm)
laser, to demonstrate membrane permeability. Dividing the TO-PRO-3 fluores-
cence signal by the green DiOC2(3) fluorescence signal produces a normalized
indicator of permeability that provides better discrimination between cells with
impermeable and permeable membranes than can be obtained from TO-PRO-3
fluorescence alone (12).
2. Materials
Note: All aqueous solutions should be made with de-ionized distilled water
(dH2 O) and filtered through a filter with a pore size no larger than 0.22 μm.
Dye solutions should be stored in the dark.
2.1. For DiOC2 (3)/TO-PRO-3 Staining

1. Diethyloxacarbocyanine iodide (DiOC2 (3)) (Molecular Probes) (FW 460.31):
a. Stock and working solution: 3 mM in DMSO; store at 4 °C.
b. Final concentration: 30 μM.
2. TO-PRO® -3 iodide (Molecular Probes) (FW 671.42):
a. Stock and working solution: 1 mM in DMSO (supplied in this form); store
at 4 °C.
b. Final concentration: 100 nM.
3. Carbonyl cyanide m-chlorophenylhydrazone (CCCP) (Sigma-Aldrich) (FW 204.6):
180 H. M. Shapiro
4. Nisin (Sigma-Aldrich) (FW 3354): The preparation sold by Sigma-Aldrich contains

2.5% nisin, with the rest NaCl and dissolved milk solids; filtered aqueous suspension
must be diluted to achieve a final concentration of 25 μg/mL.
5. Valinomycin (Sigma-Aldrich) (FW 1111):
6. Mueller-Hinton broth (GibcoTM Invitrogen Corporation, Carlsbad, CA) with 50
mg/L Ca++ (MHBc).
3. Methods
3.1. Measurement of and Permeability Using DiOC2 (3)
and TO-PRO-3 (See Note 1)
3.1.1. Sample Preparation (see Note 2)
1. Dilute samples in MHBc to a target concentration of 106 –107 cells/mL.
2. Add dyes: 30 μM DiOC2 (3) and 100 nM TO-PRO-3.
3. Keep the samples at room temperature (∼25 ºC) for 5 min before running on the
flow cytometer.
3.1.2. Flow Cytometry and Data Analysis

1. Use an instrument with 488 nm (argon ion or solid-state laser) and red (633 nm
from a He-Ne laser or ∼635 nm from a diode laser) excitation beams.
2. Use forward or side scatter as the trigger signal. A software gate may be set to
exclude low-level scatter signals produced by noise and debris.
3. DiOC2 (3) is excited at 488 nm; its green fluorescence is detected through a
525–530-nm bandpass filter with ∼20 nm bandwidth, and its red fluorescence is
detected through a 610-nm bandpass filter with ∼20 nm bandwidth.
4. TO-PRO-3™ is excited by the red laser, and its far-red fluorescence is detected
through one or two 695-nm-long pass color glass filters or through a bandpass
interference filter centered at 660–680 nm and blocked to O.D. 5.5 or higher below
650 nm.
In instruments in which data are collected using logarithmic amplifiers, a
quantity proportional to the ratio of [DiOC2 (3) red fluorescence]/[DiOC2 (3)
green fluorescence] is calculated by adding a constant to the red fluorescence
channel log value and subtracting the green fluorescence channel log value (11).
The addition of a constant value is necessary to keep values of the calculated
parameter on the same scale as is used for the raw fluorescence measurements.
For a 256-channel logarithmic scale, with 64 channels per decade, a constant
value of 96 is convenient; the calculated parameter, which serves as a measure
of , then represents the log of (103/2 × [red fluorescence/green fluores-

cence]). A normalized permeability value, based on the ratio of [TO-PRO-3
fluorescence]/[DiOC2 (3) green fluorescence], is derived in the same manner. If
high-resolution linear data are available, ratios may be calculated directly by
division and multiplied by appropriate scaling constants.
Different mechanisms for perturbing and permeability are incorporated
into control samples. After 5–15 min of incubation, CCCP (15 μM) reduces
to zero but does not affect permeability; nisin (25 μg/mL) reduces
of Gram-positive organisms to zero and also renders organisms permeable to
TO-PRO-3.
Measurements of using DiOC2 (3) may be calibrated by controlled
application of valinomycin in the presence of different external potassium ion
concentrations (11). The red-to-green fluorescence ratio is measured for cells
in a range of buffers containing 5 μM valinomycin and various concentrations
of potassium; the concentration of sodium ion is adjusted to keep the combined
molarity of potassium and sodium at 300 mM.
3.1.3. Typical Results
Figure 1 shows measurements of and permeability in Mycobacterium
smegmatis. The upper and lower panels on the left side plot the red (y-axis)
and green (x-axis) fluorescence of DiOC2 (3); histograms of the calculated -
values appear at the upper right. Membrane permeability histograms are shown
at the lower right. The broad distributions of raw fluorescence reflect the fact
that the organism grows in clumps; fluorescence distributions from organisms
such as Staphylococcus aureus are similarly broad.
Figure 2 shows the response of an INH-resistant, ethambutol-sensitive mutant
of M. smegmatis (kindly provided by Dr. William Jacobs, Howard Hughes
Medical Institute, Albert Einstein College of Medicine, Bronx, NY) to INH
and ethambutol. After 8–24 h of exposure, ethambutol-treated cultures lose
and become permeable to TO-PRO-3. INH acts similarly on wild-type
M. smegmatis but has little or no effect on either the or the permeability
of the resistant mutant.
Figure 3 plots of amoxicillin-treated Staphylococcus aureus against
permeability. The strain of S. aureus used was amoxicillin-sensitive; aliquots
were exposed to concentrations of amoxicillin above (1 μg/mL) and below
(0.5 μg/mL) the minimal inhibitory concentration (MIC). In cultures treated
with either dose, at time zero, most cells show low values of permeability
and relatively high values of , appearing in the lower right quadrant of
the display. After 2 h at an amoxicillin concentration above MIC (top panel),
182 H. M. Shapiro
Fig. 1. DiOC2 (3)/TO-PRO-3 staining to determine and permeability of

Mycobacterium smegmatis.
Fig. 2. and permeability of an INH-resistant, ethambutol-sensitive mutant of

M. smegmatis after 24 h of exposure to INH or ethambutol (ETH).
Fig. 3. Response of Staphylococcus aureus exposed to different concentrations of

amoxicillin for different lengths of time. is plotted against membrane permeability.
many cells have lost completely, and most have lost to some extent
(lower and upper left quadrants); over 58% of the total have become permeable
(upper left quadrant). By 4 h, some regrowth has occurred; about 17% of the
events measured show normal and no permeability. The situation is quite
different at a sub-MIC amoxicillin concentration (bottom panel). At 2, 3, and
even 4 h, a substantial fraction of events (as high as 28%) are in the upper
right quadrant, indicating a greater than zero with permeability to TO-
PRO-3. By 4 h, most cells (over 79%) have regained normal and lost
permeability. Bacterial counts over this time period rule out the accumulation
of a high- , impermeable population by expansion of the small population
of such cells present after 2 h. Although some intermediate- , permeable
events may represent aggregates of high- , impermeable viable cells and
permeable, low- dead cells, many of these events appear to be accounted for
by TO-PRO-3 uptake into viable cells. This, parenthetically, suggests a novel
approach to antimicrobial therapy (1,3,13,14). Recent work by others (15,16)
also suggests that propidium, which, like TO-PRO-3, is widely regarded as a
“nonviability” indicator, may be taken up by metabolically and reproductively
viable cells.
184 H. M. Shapiro
Measurement of and permeability is particularly useful in delineating

between agents that affect membrane potential without substantial mechanical
damage to the cell membrane and those that induce membrane lysis. The former
class would include daptomycin (17) and, presumably, the new diarylquinoline
antimycobacterial drug R207910 (18), which genetic evidence indicates acts
on the proton pump of ATP synthase.
4. Notes
1. DiOC2 (3)/TO-PRO-3 staining. This method has been used in instruments with 488
nm and red illuminating beams separated in space; it is not known whether it
will work in instruments with collinear 488 nm and red beams. Both DiOC2 (3)
and TO-PRO-3 adhere to the tubing used in most flow cytometers, and the high
concentration of cyanine dye used in this protocol may necessitate replacement of
some tubing if repeated cleaning with dilute chlorine bleach, ethanol, or detergents
still leaves dye in the system. Some bacterial types (e.g., S. aureus) may be grown
in culture following exposure to 30 μM DiOC2 (3). The ratiometric measurement
can be done without the permeability measurement, using DiOC2 (3) without TO-
PRO-3, in an instrument with a single 488-nm illuminating beam. In this instance,
measurement of DiOC2 (3) red fluorescence through a 660–680-nm bandpass or
long-pass filter can give satisfactory results.
2. Dye concentrations and incubation times given are for Staphylococcus aureus and
other Gram-positive species, e.g., Enterococcus and Streptococcus. Both of the latter
typically show low membrane potentials. The concentration of DiOC2 (3) and the
dye incubation time may need to be adjusted for other species. For Mycobacterium
smegmatis, 20 μM of dye and a 20–25 min incubation time appear optimal, and
supplemented Middlebrook 7H9 broth is used as the medium. The method has also
been used with some Gram-negative species, e.g., E. coli, with 5–10 mM of EDTA
added to staining solutions, and delineates cells with various apparent values of
as well as discriminating those that do and do not take up TO-PRO-3. However,
Gram-negative bacteria appear to be damaged by the calibration buffers used with
Gram-positive organisms, and it has not been possible to derive calibration curves
for the former. A buffer containing 100 mM of Tris-HCl, pH 8.0, 50 mM of NaCl,
5mM of KCl, and 10 mM of EDTA can be used for work with a number of
Gram-negative organisms, including Enterobacter cloacae, Klebsiella pneumoniae,
Proteus mirabilis, and Pseudomonas aeruginosa.
Acknowledgments
The author thanks Dave Novo, Nancy Perlmutter, and Jared Silverman, who
have played vital roles in the development and application of the methods
described here.
References
1.
1 Shapiro, H. M. (2003) Practical Flow Cytometry, 4th ed. Wiley-Liss, Hoboken, NJ
(available online at http://probes.invitrogen.com/products/flowcytometry/practi-
calflowcytometry.html).
2.
2 Davey, H. M., and Kell, D. B. (1996) Flow cytometry and cell sorting of heteroge-
neous microbial populations—The importance of single-cell analyses. Microbiol.
Rev. 60, 641–696.
3.
3 Shapiro, H. M. (2000) Microbial analysis at the single-cell level: Tasks and
techniques. J. Microbiol. Meth. 42, 3–16. (Note: The full text of this paper
may be downloaded without charge from http://www1.elsevier.com/homepage/
sah/mimet/speciss/1368.pdf.)
4.
4 Brehm-Stecher, B., and Johnson, E. A. (2004) Single-cell microbiology: Tools,
technologies, and applications. Microbiol. Mol. Biol. Rev. 68, 538–559.
5.
5 Nebe-von-Caron, G., Stephens, P. J., Hewitt, C. J., Powell, J. R., and
Badley, R. A. (2000) Analysis of bacterial function by multi-colour fluores-
cence flow cytometry and single cell sorting. J. Microbiol. Meth. 42, 97–114.
(Note: The full text of this paper may be downloaded without charge from
http://www1.elsevier.com/homepage/sah/mimet/speciss/1378.pdf.)
6.
6 Nikaido, H. (2003) Mechanisms of bacterial outer membrane permeability
revisited. Microbiol. Mol. Biol. Rev. 67, 593–656.
7.
7 Leive, L., and Kollin, V. (1967) Controlling EDTA treatment to produce permeable
Escherichia coli with normal metabolic processes. Biochem. Biophys. Res. Comm.
28, 229–236.
8.
8 Vaara, M. (1992) Agents that increase the permeability of the outer membrane.
Microbiol. Rev. 56, 395–411.
9.
9 Walberg, M., Gaustad, P., and Steen, H. B. (1999) Uptake kinetics of nucleic acid
targeting dyes in S. aureus, E. faecalis and B. cereus: A flow cytometric study. J.
Microbiol. Meth. 35, 167–176.
10.
10 Haugland, R. P. (ed.) (2005) The Handbook: A Guide to Fluorescent Probes
and Labeling Technologies, 10th ed. Invitrogen/Molecular Probes, Eugene, OR
(updated Web edition online at http://probes.invitrogen.com/handbook).
11.
11 Novo, D., Perlmutter, N. G., Hunt, R. H., and Shapiro, H. M. (1999) Accurate
flow cytometric membrane potential measurement in bacteria using diethyloxacar-
bocyanine and a ratiometric technique. Cytometry 35, 55–63.
12.
12 Novo, D. J., Perlmutter, N. G., Hunt, R. H., and Shapiro, H. M. (2000) Multi-
parameter flow cytometric analysis of antibiotic effects on membrane potential,
membrane permeability, and bacterial counts of Staphylococcus aureus and Micro-
coccus luteus. Antimicrob. Agents Chemother. 44, 827–834.
13.
13 Shapiro, H. M. (2001) Multiparameter flow cytometry of bacteria: Implications
for diagnostics and therapeutics. Cytometry 43, 223–226.
14.
14 Shapiro, H. M. (2003) Method for overcoming bacterial antibiotic resistance.
U. S. Patent No. 6,562,785, issued May 13, 2003.
186 H. M. Shapiro
15.
15 Gelle, M. P., Jacquelin, L. F., and Choisy, C. (2003) [Compared viability of
planctonic bacteria and bacteria in biofilms by flowcytometry] [Article in French]
Ann. Pharm. Fr. 61, 243–252.
16.
16 Spiers, A. J., and Rainey, P. B. (2005) The Pseudomonas fluorescens SBW25
wrinkly spreader biofilm requires attachment factor, cellulose fibre and LPS inter-
actions to maintain strength and integrity. Microbiology 151, 2829–2839.
17.
17 Silverman, J. A., Perlmutter, N. G., and Shapiro, H. M. (2003) Correlation of
daptomycin bactericidal activity and membrane depolarization in Staphylococcus
aureus. Antimicrob. Agents Chemother. 47, 2538–2544.
18.
18 Andries, K., Verhasselt, P., Guillemont, J., Gohlmann, H. W., Neefs, J. M.,
Winkler, H., Van Gestel, J., Timmerman, P., Zhu, M., Lee, E., Williams, P., de
Chaffoy, D., Huitric, E., Hoffner, S., Cambau, E., Truffot-Pernot, C., Lounis, N.,
and Jarlier, V. (2005) A diarylquinoline drug active on the ATP synthase of
Mycobacterium tuberculosis. Science 307, 223–227.
15
Bacterial Efflux Pump Inhibitors
Barbara J. Kamicker, Michael T. Sweeney, Frank Kaczmarek,

Fadia Dib-Hajj, Wenchi Shang, Kim Crimin, Joan Duignan,
and Thomas D. Gootz
Summary
Infections caused by multidrug-resistant Gram-negative pathogens play a major role in the
morbidity and mortality of hospitalized patients. The rise of resistance to current antibiotic
therapies has made the discovery of new agents urgent. One of the major antibiotic resistance
mechanisms utilized by more than 15 species of Gram-negative bacterial cells is the Resistance
Nodulation Division (RND) efflux pump, which eliminates several classes of antibiotics such as
penicillins and cephalosporins, macrolides, aminoglycosides, fluoroquinolones, and tetracyclines.
Here we describe a multistep process to identify compounds that inhibit the RND-type efflux
pumps. This involves measuring the inhibition of accumulation of ethidium bromide in E. coli or
Haemophilus influenzae cells and confirming that the inhibition is specific for the efflux pumps
by using genetic constructs and biochemical methods to measure nonspecific inhibition due to,
e.g., intrinsic antibacterial activity or membrane disruption. In whole bacterial cells, synergism,
antagonism, or indifference of the combination of an antibiotic with the putative inhibitor is
determined, and this is then confirmed by quantitating viable bacterial cells in liquid culture
over 24 h.
Key Words: bacterial efflux pump inhibitor; antibiotic resistance; Haemophilus influenzae;
E. coli; Pseudomonas aeruginosa; Resistance Nodulation Division (RND) efflux pump.
1. Introduction
Haemophilus influenzae is a prominent Gram-negative pathogen of the upper
respiratory tract. This organism and several pathogenic Gram-negative Enter-
obacteriaceae and Pseudomonas aeruginosa share a common mechanism of

187
188 B. Kamicker et al.
removing antibiotics through an efflux mechanism using Resistance Nodulation

Division (RND)-type efflux pumps (e.g., AcrAB or MexAB) (1). H. influenzae
has proven useful in work on understanding efflux pumps because it contains
only one type of pump, unlike organisms such as P. aeruginosa and E. coli,
which have multiple pumps. Striking advances in understanding the structure of
these efflux pumps have been made in recent years (2–7). The major antibiotic
classes that are known to be effluxed by the RND-type pumps are macrolides,
-lactams and -lactam inhibitors, fluoroquinolones, oxazolidinones, and
fourth-generation cephems. P. aeuruginosa is a worrisome cause of nosocomial
infections in intensive care units in the United States because resistance to
several key antibiotic classes is 30% for third-generation cephalosporins, 33%
for quinolones, and 22% for imipenem (8). Therefore, the ability to circumvent
this type of efflux will restore clinical utility to some older compounds and
provide increased potency and the potential to avoid resistance development
in others that are in the discovery and development phases. Emphasis in our
screening paradigm was placed on finding inhibitors that, in combination with
new macrolides or oxazolidinones, lowered the MIC to levels observed in
deletion mutants of H. influenzae Rd acrB and E. coli EC-1763 (acrAB,
acrEF, emrE, and emrD). Such an inhibitor in combination with a novel
antibiotic would set a new standard of therapy for bacterial infections.
The methods described below outline the in vitro assays used to discover
an efflux pump inhibitor (EPI). The H. influenzae and E. coli strains used
to identify a successful inhibitor either contained or had eliminated known
chromosomally encoded efflux pumps that are responsible for most of the
bacterial efflux. The steps to find an EPI start with measuring ethidium bromide
accumulation in a bacterial cell containing active efflux pumps. Ethidium
bromide is efficiently effluxed and will only accumulate in cells in the presence
of an efflux pump inhibitor. The next step is susceptibility testing of any
compound shown to prevent efflux, to eliminate synergy due to antibacterial
activity. Ideally, an EPI will not have intrinsic antibacterial activity. Those
compounds that have no intrinsic antibacterial activity are further tested for
synergy with a range of concentrations of antibiotics against a single concen-
tration of inhibitor, in strains containing active efflux pumps. Any compound
that has synergy by an eight-fold or more reduction in minimum inhibitory
concentration (MIC) in combination with a single concentration of EPI is further
tested by the more robust fractional inhibitory concentration (FIC) method. This
method can distinguish whether two compounds together are demonstrating
synergy, indifference, or antagonism to the bacteria. This is followed by the
protonophore assay, which uses an E. coli strain that allows radiolabeled lactose
Bacterial Efflux Pump Inhibitors 189
to accumulate in the cell via the proton motive force (i.e., both the membrane
potential and the pH gradient). Any potential EPI that also disrupts the proton
motive force is not working through efflux pump mechanisms and is excluded
as a potential EPI. Finally, kill kinetic studies over 24 h give a dynamic picture
of the effect of the EPI on the bacterial killing of strains containing efflux
pumps in the presence of antibiotic alone, and in combination with the EPI. This
test is the final in vitro step in the search for a successful efflux pump inhibitor.
2. Materials
2.1. Bacterial Culture
1. LB agar containing 100 μg/mL of ampicillin (Molecular Toxicology, Boone, NC).
2. LB agar (Molecular Toxicology, Boone NC).
3. Chocolate agar (Hardy Diagnostics, Santa Maria, CA).
4. HTM (Haemophilus test medium) agar (Oxoid LTD, Basingstoke, UK).
5. Tryptic Soy Agar containing 5% sheep blood (Hardy Diagnostics, Santa Maria, CA).
6. 20 μg/mL of kanamycin (U.S. Pharmacopeia, Rockville, MD).
7. E. coli strains EC1763, EC1764, EC1639, and EC1763 were used in these studies
(see Note 1).
8. H. influenzae utilizes acrAB as its major efflux pump to confer antibiotic resistance.
H. influenzae strain 54A1116 is the parent strain, and the corresponding efflux
pump knockout was designated 54A1115. 54A1116 was grown on chocolate agar
plates, and 54A1115 was grown on HTM agar containing 20 μg/mL of kanamycin.
9. E. coli JL467 (B500:pBR/lacY) was especially constructed for the protonophore
assay. It was grown on LB agar or LB broth containing 100 μg/mL of ampicillin.
2.2. Ethidium Bromide Accumulation Assay

1. 100 μM ethidium bromide.
2. 1 M sodium formate.
3. 1 M glucose.
4. 100 μg/mL ampicillin.
5. 100 mM CCCP (Carbonyl Cyanide m-chlorophenylhydrazone) (Calbiochem, San
Diego, CA).
6. LB broth.
7. Supplemented Brain-Heart-Infusion broth (BHI).
8. Preparation of 50 mM of sodium phosphate buffer, pH 7.0:
a. Dissolve 4.26 g of sodium phosphate dibasic in 600 mL of water = 50 mM.
b. Dissolve 2.4 g of sodium phosphate monobasic in 400 mL of water = 50 mM.
c. Combine phosphates = 1000 mL at 50 mM.
d. Add 5.84 g of sodium chloride to 1000 mL of buffer = 100 mM NaCl.
e. Bring pH to 7.0 with 1 N sodium hydroxide. Filter-sterilize, and store at 4°C.
9. Falcon 96-well white opaque tissue culture plates, flat bottom with lid (BD,
Franklin Lakes, NJ).
10. Dimethyl sulfoxide (DMSO).
11. Potential efflux pump inhibitors (Pfizer, New York, NY).
2.3. Susceptibility Testing

1. Azithromycin (Pfizer, New York, NY).
2. Linezolid (Pfizer, New York, NY).
3. Potential efflux pump inhibitors (Pfizer, New York, NY).
4. DMSO (JT Baker, Phillipsburg, NJ).
5. Haemophilus Test Media (HTM) base (Molecular Toxicology, Boone, NC). Before
first use, dissolve one 10 mg vial of -Nicotinamide adenine dinucleotide reduced,
(-NAD) sodium salt (Sigma, St. Louis, MO), in 2 mL of sterile H2 O. Filter-sterilize
with a 0.22 μm Millex-GS filter unit (Millipore, Bedford, MA). Add 1.5 mL of
filtered -NAD to 500 mL of HTM base. Swirl to mix. Adjust pH to 7.2–7.4 if
necessary. Store media at 4°, no longer than 2 weeks.
6. Cation Adjusted Mueller Hinton Broth (CAMHB) (Molecular Toxicology,
Boone, NC).
7. 96-well U-bottom polystyrene plates (Becton Dickinson, Franklin Lakes, NJ).
8. Flat-bottom glass tubes containing 5 mL of saline (Becton Dickinson, Franklin
Lakes, NJ).
2.4. MIC Synergy Testing in the Presence of EPI

The materials are the same as those used in Section 2.3 for susceptibility
testing.
2.5. Fractional Inhibitory Testing (FIC)

1. 96-well deep-well plates of 2 mL volume (Beckman-Coulter, Fullerton, CA).
2. 1% Alamar Blue (Trek Diagnostics, Westlake, OH). Alamar Blue is a colorimetric
redox indicator used as an aid for the visual reading of FIC plates and had no effect
on organism growth (9).
2.6. Protonophore Assay

1. LB agar with 100 μg/mL of ampicillin (Molecular Toxicology Inc., Boone, NC).
2. LB broth (Gibco, Invitrogen, Carlsbad, CA) containing 100 μg/mL of ampicillin
(Roche, Nutley, NJ).
3. Potential efflux pump inhibitors (EPI) (Pfizer, New York, NY).
4. CCCP (Carbonyl Cyanide m-chlorophenylhydrazone) (Calbiochem, San
Diego, CA).
5. Cycloserine (Sigma, St. Louis, MO).
6. Stop solution was prepared by dissolving 1.74 g of potassium phosphate dibasic

and 0.42 g of LiCl in a final volume of 100 mL. pH was adjusted to 5.5. Stop
solution was stored at 4°.
7. 14 C-lactose was prepared by diluting 0.25 mL of D-glucose-1-[14 C]lactose in
2.75 mL of LB broth. [D-glucose-1-14 C]lactose (56 mCi/mmol) (Amersham
Biosciences, Burkinghamshire, UK).
8. Potassium phosphate dibasic KH2 PO4 (Sigma, St. Louis, MO).
9. LiCl (Sigma, St. Louis, MO).
10. Microscint 20 liquid scintillation counter cocktail (Packard, Meriden, CT).
11. 96-well flat-bottom plate (Becton Dickinson, Franklin Lakes, NJ).
12. 96-well Unifilter GF/B plate (Packard, Meriden, CT).
2.7. Kill Kinetic Studies

1. Azithromycin (Pfizer, New York, NY).
2. Potential efflux pump inhibitors (proprietary Pfizer compounds, Pfizer, New
York, NY).
3. 24-well flat-bottom plate with lid (Corning, Corning, NY).
4. 96-well flat-bottom plate (Becton Dickinson, Franklin Lakes, NJ).
5. CAMHB (Molecular Toxicology, Boone, NC).
6. Tryptic soy agar plates (Hardy Diagnostics, Santa Maria, CA).
7. Dulbecco’s Phosphate buffered saline (PBS) (Sigma, St. Louis, MO).
3. Methods
3.1. Bacterial Strains
1. H. influenzae strains were streaked for single colonies from frozen culture onto
chocolate agar plates, HTM agar plates containing 20 μg/mL of kanamycin, or a
loop full of frozen culture was added to supplemented BHI broth and incubated
at 37°, 5% CO2 overnight. E. coli strains were streaked for single colonies from
frozen culture onto either Tryptic soy agar with 5% sheep blood, LB agar, LB agar
containing 100 μg/mL of ampicillin, or a loopful of frozen culture was added to
LB broth containing 100 μg/mL of ampicillin, and incubated at 35°, ambient air,
overnight.
2. Except for JL467, single colonies from agar plates were passed onto fresh agar
plates and incubated a second night before testing.
3.2. Ethidium Bromide Accumulation Assay

Strains used for the ethidium bromide accumulation assay Part I were
EC1764 and 54A1116, strains that contain only acrAB pumps. A test compound
will be considered active if, in the ethidium bromide accumulation study Part I,
it causes ethidium bromide to accumulate to levels that are 2 to 3 times the
Fig. 1. Example of results from the ethidium bromide accumulation assay using
E. coli strain K1764, two control compounds (CCCP and DMSO), and an active
compound A at 50 μM.
standard deviation or more above the negative control, DMSO (Fig. 1). CCCP
is used as a positive control. To ensure that the ethidium bromide accumulation
is dependent on pump inhibition alone, the ethidium bromide accumulation
assay Part II is employed. Strains EC1763 and 54A1115, which contain no
pumps, will accumulate levels of ethidium bromide that are the same as the
negative control, DMSO, in the presence or absence of a true pump inhibitor.
Any decrease in ethidium bromide accumulation in such strains in the presence
of a test compound will be a signal that the test compound is working by a
pump-independent mechanism. Compounds are tested on three separate days,
with fresh inoculum each day, and a test compound must be active for at least
two of the three days tested.
Part I
3.2.1. Preparation of cultures
1. From a frozen culture, inoculate 10 mL of supplemented BHI with a 10 μL loop
of 54A1116 and incubate overnight at 37°, 5% CO2 , with shaking. Also, streak a
chocolate agar plate to check for sterility after overnight incubation. From a frozen
culture, inoculate 10 mL of LB broth containing 100 μg/mL of ampicillin with

a 10 μL loop of EC1764, and incubate overnight at 37°, 5% CO2 , with shaking.
Also, streak a Tryptic soy blood agar plate to check for sterility after overnight
incubation.
2. In the morning, dilute 5 mL of overnight culture with 45 mL of fresh medium;
incubate at 37°, with shaking, for 4 h.
3. Transfer the culture to a 50-mL centrifuge tube and spin at 4000X g for 10 min.
4. Pour off media and resuspend cells in 50 mL of phosphate buffer.
5. Spin cells at 4000X g for 10 min.
6. Pour off phosphate buffer and resuspend cells in phosphate buffer to an OD600 = 0.5.
7. For every 49.5 mL of adjusted H. influenzae cells, add 0.5 mL of 1 M glucose.
8. For every 47.5 mL of adjusted E. coli cells, add 2.5 mL of 1 M sodium formate.
9. Start cells growing from frozen culture as described above for the second and third
days of testing.
3.2.2. Prepare EPI master plates

1. Add 80 μL of 100% DMSO to all wells of a 96-well white opaque tissue culture
plate.
2. Dissolve test compounds and CCCP to 10 mM in 100% DMSO.
3. Add 20 μL of each test compound to a designated well in columns 1–10. One plate
can hold 80 test compounds.
4. Add 20 μL of 10 mM CCCP to wells A11, B11, and C11.
5. Add 20 μL of 100% DMSO to wells D11 through H11, and to all wells in column 12.
3.2.3. Prepare EPI daughter plates

1. Add 20 μL of 100 μM ethidium bromide to each well of each daughter plate.
2. Add 2 μL (for H. influenzae) or 5 μL (for E. coli) of compound from master plate
into corresponding well of daughter plate. Each master plate makes three daughter
plates, one for every day of the test. Make plates on day 1 of test, store other plates
at –20 °, and thaw on the subsequent test days.
3.2.4. Inoculation and reading of plates

1. Add 175 μL of adjusted bacterial cells containing glucose or sodium formate to
each well of one daughter plate.
2. Immediately place plate in SpectraMax Gemini Fluorescence plate reader
(Molecular Devices, Sunnyvale, CA) and read fluorescence of the accumulated
ethidium bromide for 5 min at excitation = 530 nm and emission = 600 nm.
3. Inoculate remaining plates one at a time, reading for 5 min each before inoculating
the next.
3.2.5. Calculate the velocity

1. A 2.5-min window from the 5-min assay run was used to calculate the initial velocity
of each test compound, CCCP, and DMSO (Fig. 1). The statistical software program
Kinan (Kinetics Analysis Program, Norman D. Young, Laboratory Automation
Group, Pfizer) was used to analyze the plate and calculate the initial velocity. The
mean and standard deviation of DMSO on each plate were used as the negative
control. A compound was considered active in Part I if its initial velocity was more
than 2 standard deviations above DMSO, for at least 2 of the 3 days tested (see
Note 2).
Part II
Part II of this assay tests for nonspecific membrane disruption of E. coli
with presumptive positive compounds from Part I. Repeat procedure using
strains EC1763 (acrAB, acrEF, emrE, and emrD) and 54A1115. Read
plates in a SpectraMax Gemini for 5 min. Calculate the initial velocity of
each test compound, CCCP, and DMSO. An active compound was eliminated
in Part II if its initial velocity was more than 3 standard deviations different
from DMSO.
3.3. Susceptibility Testing

The MIC for each potential efflux pump inhibitor and azithromycin and
linezolid were determined by broth microdilution according to the standards of
the Clinical and Laboratory Standards Institute (10).
Strains used for MIC testing were EC1639, EC1763, EC1764, 54A1116, and
54A1115.
1. Compounds to be tested were dissolved in DMSO to 10 mM.
2. Compounds were then further diluted to 1 mM in HTM if tested in H. influenzae
strains, and in CAMHB if tested in E. coli.
3. Compounds were tested in 96-well U-bottom plates. One plate holds a maximum
of eight compounds, using one organism per plate. Plates were filled with 50 μL of
the appropriate media in all wells.
4. 50 μL of each 1 mM drug stocks were added to each well A1–H1. Drugs were
serially diluted 1:2 through 11 dilutions by a Biomek 2000 (Beckman Coulter,
Fullerton, CA). The remaining 50 μL was discarded. Column 12 served as growth
control wells, containing broth and organism but no drug.
5. When the 96-well drug plates were ready, several colonies of each strain were added
to a 5-mL flat-bottom saline tube and mixed for 5 s. If needed, more colonies were
added until the optical density reached an OD of 0.5 as measured in a Crystalspec
nephelometer (Becton Dickinson, Franklin Lakes, NJ). This gave a cell density of
approximately 1 × 108 CFU/mL.
6. Each inoculum was diluted 1:100 in HTM or CAMHB.

7. 50 μL of diluted inoculum were added to each well, one organism per plate, for a
final organism density of 5 × 105 CFU/mL, and a final compound concentration of
250 μM drug in column 1, in a final volume of 100 μL.
8. 96-well plates were incubated at 35°, ambient air, for 22 h and then read by eye.
MIC is defined as the lowest concentration of drug required to inhibit growth of the
organism as seen by the unaided eye (11). Potential efflux pump inhibitors were
to have no intrinsic antibacterial activity, so compounds that had MICs >125 μM
by broth MIC were next tested for synergy with azithromycin and linezolid by one
concentration synergy tests.
3.4. MIC Synergy Testing in the Presence of EPI

In strains containing efflux pumps, a successful EPI, in combination with
azithromycin or linezolid, will allow the antibiotic in an in vitro susceptibility
test to have a lower MIC than in the absence of the inhibitor. This test measures
the change in MIC due to the presence of a constant concentration of EPI.
Strains used for this test were EC1639, EC1764, and 54A1116, all strains
containing the acrAB efflux pump. One 96-well U-bottom plate was used for
two efflux pump inhibitors at 50 μM in combination with azithromycin and
linezolid in a range of two-fold concentrations above and below the MICs
determined in the previous study.
1. As described above, strains were grown from frozen stocks on the appropriate agar
plates, for 2 nights before use, with passage of each strain onto a fresh agar plate
after one night.
2. Using the appropriate media for the organism, each 96-well plate was filled with
190 μL of media in wells A1–H1. The remaining wells were filled with 95 μL of
media.
3. Antibiotic at a concentration that was 20X the final concentration needed in the
first well was dissolved in DMSO. The final concentration of antibiotic should be
1 to 2 dilutions above the actual MIC for that compound with that organism.
4. Ten μL of the 20X azithromycin were added to wells A1 and E1. Ten μL of the
20X linezolid were added to wells B1 and F1. Ten μL of DMSO were added to
wells C1, D1, G1, and H1.
5. 1:2 serial dilutions of 100 μL from column 1 to column 11 were performed by a
Biomek 2000, removing the last 100 μL from the plate. Column 12 received only
95 μL of media and served as the growth control wells. Plates now contained 95
μL of antibiotic at 1X the final concentration in two-fold serial dilutions.
6. The density of a bacterial culture was adjusted to an OD625 of 0.1, as read on
a spectrophotometer, and then diluted 1:10. A multichannel pipette was used to
inoculate the plates with 5 μL of this diluted culture for a final organism concen-
tration of approximately 5 × 105 CFU/mL. One organism inoculated rows A–D,
while a second organism inoculated rows E–H.
7. Added to the inoculum was the test EPI at a concentration of 10 mM. 38 μL of
EPI at 10 mM were added to 340 μL of 1:10 diluted inoculum, and then 5 μL of
inoculum were added to the 95 μL in the plate, for a 200-fold dilution of EPI. The
final concentration of EPI in the well was 50 μM.
8. The plates were incubated at 35°C, ambient air, for 18 ± 2 h.
9. MICs of antibiotic in the presence of 50 μM of EPI were read by eye. Any compound
that had an eight-fold or larger decrease in the MIC of the antibiotic in the presence
of inhibitor compared to the MIC of the antibiotic alone, in at least one of the three
strains tested, was further tested by FIC testing.
3.5. FIC Testing

The most frequently used method to test antibiotic combinations in vitro
is the fractional inhibitory concentration (FIC) method, also known as the
checkerboard method. The checkerboard method is so named because of the
pattern of wells formed by multiple dilutions of two compounds being tested, at
concentrations above, at, and below their MICs (12). The results of a checker-
board test after 22 h of incubation provide a static view of the inhibition
of growth of the organism in the presence of antibiotic in combination with
the EPI. These results can demonstrate synergy, indifference, or antagonism
between the two compounds. Each potential EPI was tested in combination with
azithromycin or linezolid at concentrations starting at two or three dilutions
above each compound’s MIC in a 96-well plate. The FIC for each drug is
derived by dividing the lowest concentration of that drug in combination that
inhibits growth, the MIC, by the MIC of that drug alone. Calculations from the
MICs of each combination in a row of the plate gave an FIC index. The FIC
index is the sum of the two FICs for each drug in combination (12). Synergy
is defined as an FIC index less than or equal to 0.5, indifference is defined as
an FIC index between 0.5 and 4.0, and antagonism is defined as an FIC index
greater than 4.0.
Strains used for FIC testing were EC1639, EC1764, and 54A1116.
1. As described above, strains were grown from frozen stocks on the appropriate
agar plates, for two nights before use, with passage of each strain onto a fresh
agar plate after one night.
2. One 96-well U-bottom plate was used for each efflux pump inhibitor/antibiotic
combination. Each 96-well plate was filled with 25 μL of media, appropriate for
the organism, in wells A1–H8. This 8 × 8 grid will contain the two compounds
in combination.
3. A11 through H11 and A12 through H12 were filled with 50 μL of media. These
wells will determine the MIC of the inhibitor and the antibiotic alone, on the same
plate as the compounds in combination.
4. Test compounds were dissolved at 40 mg/mL in DMSO.
5. Compound stocks were further diluted in the appropriate media to 4X and 8X the
final maximum concentration in the plate.
6. 50 μL of the EPI, at 4X the final concentration, were added to well A11, and 50
μL of the antibiotic, at 4X the final concentration, were added to well A12.
7. Wells A11 and A12 were serially diluted 1:2 through wells H11 and H12 by a
Denley Wellpro (Progroup Inc, St. Louis, MO), with the remaining 50 μL removed
from the plate.
8. 25 μL of the EPI at 8X the starting concentration was added to wells A1 through
H1. The drug was serially diluted 1:2 through column 8, with the remaining 25
μL removed from the plate.
9. The antibiotic was made at 4X the starting concentration in 10 mL of media.
10. Seven 1:2 serial dilutions in 5 mL were made.
11. Using an 8-channel pipette, 25 μL of the highest concentration of antibiotic were
added to wells A1–A8.
12. The next-highest concentration was added to wells B1–B8, etc. The final volume
of drug was 50 μL in each well, at a concentration of 2X the final concentration
(Table 1).
13. To inoculate a plate, several colonies of each strain were added to a 5-mL flat-
bottom saline tube and mixed for 5 s, to an OD of 0.5 measured in a Crystalspec
nephelometer. This gave a cell density of approximately 1 × 108 CFU/mL.
14. Each inoculum was diluted 1:100 in HTM or CAMHB.
15. 50 μL of diluted inoculum were added to each well, for a final organism density
of 5 × 105 CFU/mL, in a final volume of 100 μL, and a drug concentration of 1X
the final concentration.
16. The 96-well plates were incubated at 35°, ambient air, for 22 h and read by eye.
17. FIC indexes were determined by the following formula: (MIC of antibiotic in
combination/MIC of antibiotic alone) + (MIC of EPI in combination/MIC of
EPI alone).
18. An alternative method of making checkerboard plates is described in Section 3.8.
3.6. Protonophore Assay

Any active EPI that demonstrated synergy by FIC was tested in the
protonophore assay to rule out that its activity was due to disruption of the
proton motive force (PMF). Protonophores disrupt cell membrane potentials
and therefore dissipate the PMF across the membranes, depriving the efflux
pumps of energy. The constructed E. coli strain JL467 will accumulate 14 C-
lactose within its cells, unless the PMF is disrupted by a test compound. CCCP,
Table 1
Example of Drug Concentrations (μg/mL) in a 96-Well Plate Alone and in Combination
EPI/ 1 2 3 4 5 6 7 8 9 10 EPI Antibiotic

Antibiotic
A 64/8 32/8 16/8 8/8 4/8 2/8 1/8 0.5/8 — — 64 8

B 64/4 32/4 16/4 8/4 4/4 2/4 1/4 0.5/4 — — 32 4
C 64/2 32/2 16/2 8/2 4/2 2/2 1/2 0.5/2 — — 16 2
D 64/1 32/1 16/1 8/1 4/1 2/1 1/1 0.5/1 — — 8 1
E 64/0.5 32/0.5 16/0.5 8/0.5 4/0.5 2/0.5 1/0.5 0.5/0.5 — — 4 0.5
F 64/0.25 32/0.25 16/0.25 8/0.25 4/0.25 2/0.25 1/0.25 0.5/0.25 — — 2 0.25
G 64/0.125 32/0.125 16/0.125 8/0.125 4/0.125 2/0.125 1/0.125 0.5/0.125 — — 1 0.125
H 64/0.0625 32/0.0625 16/0.0625 8/0.0625 4/0.0625 2/0.0625 1/0.0625 0.5/0.0625 — — 0.5 0.0625
a known proton motive force inhibitor, and cycloserine, which has no effect
on membranes, are included in the assay to validate the assay conditions. LB
broth serves as a positive control, allowing full uptake of the radiolabel. Any
EPI tested at 3X the MIC that had less than 50% 14 C-lactose accumulation after
30 min, compared to LB broth alone, was eliminated.
1. A 10 μL loop JL467 frozen stock was grown in LB broth containing 100 μg/mL of
ampicillin at 37°C, in ambient air, overnight. Overnight culture was diluted 1:100
in LB broth containing 100 μg/mL of ampicillin. This culture was grown for 3 h,
until the OD600 read on a spectrophotometer equaled 1.0.
2. One 96-well flat-bottom plate can test 15 compounds at three concentrations,
1X, 2X, and 3X the MIC of that compound, in duplicate. Also included on the
plate is CCCP, at 5 μg/mL final concentration, cycloserine, at 50 μg/mL final
concentration, and two wells that contain the positive control, LB broth.
3. In Eppendorf tubes, 100 μL of each compound at 12X the final concentration
were prepared in LB broth. Also, prepared were 100 μL of CCCP in LB broth at
60 μg/mL and 100 μL of cycloserine in LB broth at 600 μg/mL.
4. Compound was added to 96-well flat-bottom plates in duplicate by adding 25 μL
of the highest concentration of compound 1 to wells A1 and B1, the second-highest
concentration in wells A2 and B2, and the lowest concentration of compound in
wells A3 and B3. The remaining wells were filled similarly with compounds 2
through 15. 25 μL CCCP were added to wells G10 and H10, 25 μL of cycloserine
were added to wells G11 and H11, and 25 μL of LB broth were added to wells
G12 and H12.
5. 25 μL of 14 C-lactose in LB broth were added to all wells.
6. Following the 3-h incubation of cells, to an OD600 = 1.0, 200μL cells were added
to each well.
7. The plate was incubated at 37°C for 30 min.
8. The reaction was stopped by transferring the entire volume of each well to a
GF/B filter plate and filtering the contents by a Filtermate harvester (PerkinElmer,
Boston, MA). The plate was washed 3 times with 200 μL of cold stop solution.
9. The plate was air-dried overnight.
10. The bottom of plate was covered, and 25 μL of liquid scintillation cocktail were
added to each well. The top of the plate was covered, and the plate was counted
for 14 C in 1-min intervals in a Wallac Trilux liquid scintillation counter (EG&G
Wallac, Gaithersburg, MD).
11. Use the counts from the wells containing only LB broth as 100% uptake, and
normalize all other counts to percent uptake compared to LB broth. As an active
protonophore, CCCP will have less than 50% uptake. Cycloserine will have
>80% uptake. At a concentration that is 3X the MIC, a potential EPI that is not
protonophore-like will have more than 60% uptake of 14 C-lactose.
3.7. Kill Kinetic Studies

Kill kinetic studies are used to demonstrate the rate of killing of an antibiotic
over time. An effective inhibitor would increase the rate of killing if it inhibited
the efflux pumps and allowed the antibiotic to stay in the cell. EPIs were
tested at 50 and 25 μM along with an untreated control against azithromycin at
concentrations above and below the MIC for azithromycin in that strain, over
24 h. Cell counts at each time point were plotted in log scale versus time to look
for a synergistic killing effect of the EPI in combination with azithromycin,
compared to the rate of killing of azithromycin alone. Synergy is defined as
more than 2 logs greater killing after 24 h compared to the best compound
alone (10). Strains used for kill kinetics were EC1639 and EC1764.
1. Strains were grown as previously described on Tryptic soy agar plates overnight.
Colonies were scraped off plates, transferred to 5 mL of CAMHB in 15-mL tubes,
and incubated at 35°C the second night. In the morning, strains were diluted to
OD625 of 0.12, and then diluted 1:100 in CAMHB, for a starting cell concentration
of 1 × 106 CFU/mL.
2. Stock concentration of azithromycin was made in CAMHB to 1 mg/mL.
Azithromycin was further diluted in CAMHB to 8.0 μg/mL, 4X the final concen-
tration needed in the plate. Four 4-fold dilutions of the 8.0 μg/mL stock were made
in CAMHB, in a final volume of 1 mL.
3. Each EPI at 100 mM, and 50 mM, 2X the final concentration in the plate, were
made in CAMHB, to a volume of 1 mL.
4. One 24-well plate was used for each inhibitor/azithromycin/strain combination. 250
μL of the highest concentration of azithromycin were added to wells A1, B1, and
C1. Each of the four additional dilutions of azithromycin was added to all wells in
columns 2–5, respectively. Column 6 received 250 μL of CAMHB.
5. All wells in row A received 250 μL of inhibitor at the highest concentration. All
wells in row B received the lower concentration of inhibitor. Row C received
250 μL of CAMHB. Row D was not used.
6. 500 μL of the diluted bacteria were added to all wells, A1–C6. The final
volume in each well was 1.0 mL, the final concentration of azithromycin in
column 1 was 2.0 μg/mL, and the final concentration of inhibitor in row 1 was
50 mM.
7. 24-well plates were incubated at 37°C, ambient air, for 24 h. At 0, 2, 4, 6, and 24
h, samples from each well were taken to determine colony counts. A 20-μL sample
from each well was added to the first row of a 96-well plate previously filled with 45
μL of PBS in all wells except row 1. Row 1 was reserved for undiluted sample. Five
μL of the undiluted sample were serially diluted to row 8. Two 96-well plates were
needed to dilute the 18 different inocula in each 24-well plate. Using an 8-channel
multichannel pipette, 10 μL from wells 1–8 from each column were pipetted onto
an LB agar plate, in duplicate on the same plate, across a range of 102 to 109
CFU/mL. Plates were allowed to sit for 10 min on the bench before incubating at
37°C, ambient air, overnight. Colonies at each dilution were counted and plotted
on a log scale versus incubation time for each antibiotic/inhibitor combination.
3.8. Alternative Method of FIC Testing Using Alamar Blue

For each EPI-antibiotic combination tested, rows A2 through H8 of one
96-well deep-well plate were filled with 400 μL of CAMHB broth containing
1% Alamar Blue by the Multidrop instrument (Labsystems, Helsinki, Finland).
1. Efflux pump inhibitors were dissolved in DMSO at 2.56 mg/mL. Compounds
were further diluted to 16X the final concentration needed in CAMHB or HTM.
Each potential efflux pump inhibitor was tested in combination with azithromycin
or linezolid at concentrations starting at two or three dilutions above each
compound’s MIC.
2. 800 μL of the EPI were added to wells A1–H1. Two-fold serial dilutions from
column 1 to column 7 of each deep-well mother plate were performed by the
Biomek 2000 instrument (Beckman-Coulter). The remaining 400 μL were removed
from the plate. Column 8 contained no EPI drug.
3. The antibiotic was made at 16X the starting concentration in 10 mL of media.
4. Six 1:2 serial dilutions of the antibiotic in 5 mL were made.
5. 400 μL of the highest concentration of the antibiotic were then added to wells A1–
A8 of each deep-well plate containing a specific EPI. 400 μL of the next-highest
concentration of antibiotic were added to wells B1–B8, etc., through row G. Well
H8 served as the growth control well.
6. There is now 800 μL total volume in each well. Wells A1 through G8 contain
the EPI-antibiotic combination at 8X the final concentrations. Wells H1 through
H7 contain the EPI only at 8X the final concentrations, and wells A1 through A8
contain the antibiotic only at 8X the final concentration (Table 2).
7. 25 μL were transferred by the Multimek 96 instrument (Beckman-Coulter) from
each well of each mother plate to a daughter plate containing 165 μL of medium.
Twelve daughter plates could be created from each mother plate. This was an
eight-fold dilution of compound after the inoculum was added.
8. Strains were grown as described above. The Biomek instrument was used to
inoculate the daughter plates with 10 μL of a 1:10-diluted culture equal to an OD625
of 0.1 as read on a spectrophotometer (approximately 1 × 108 CFU/mL), for a
final organism concentration of approximately 5 × 105 CFU/mL. The plates were
incubated at 35°C, ambient air, for 18 ± 2 h.
9. The plates were read visually by observing a reduction (a color change from blue to
purple or pink, indicating organism growth) or no reduction [a blue color, indicating
no growth of organism due to inhibition by a drug(s)]. FICs were determined by
the following formula: (MIC of antibiotic in combination/MIC of antibiotic alone)
+ (MIC of EPI in combination/MIC of EPI alone).
Table 2
Example of Drug Concentrations (μg/mL) in a 96-Well Plate Alone and in Combination, Alternative Method
EPI/Antibiotic 1 2 3 4 5 6 7 8 9 10 11 12
A 64/8 32/8 16/8 8/8 4/8 2/8 1/8 8 — — — —

B 64/4 32/4 16/4 8/4 4/4 2/4 1/4 4 — — — —
C 64/2 32/2 16/2 8/2 4/2 2/2 1/2 2 — — — —
D 64/1 32/1 16/1 8/1 4/1 2/1 1/1 1 — — — —
E 64/0.5 32/0.5 16/0.5 8/0.5 4/0.5 2/0.5 1/0.5 0.5 — — — —
F 64/0.25 32/0.25 16/0.25 8/0.25 4/0.25 2/0.25 1/0.25 0.25 — — — —
G 64/0.125 32/0.125 16/0.125 8/0.125 4/0.125 2/0.125 1/0.125 0.125 — — — —
H 64 32 16 8 4 2 1 Growth — — — —
4. Notes
1. Because E. coli has multiple antibacterial efflux pumps, two strains, EC1763 and
EC1764, derived from parent strain EC1639, were constructed by Keith Poole
(Queens University, Kingston, Ontario) to examine the effect of inhibiting only
the acrAB pump. E. coli strain EC1763 had four chromosomally encoded efflux
pumps knocked out as well as waaP (quad strain—acrAB, acrEF, emrE,
emrD—with a waaP deletion). waaP is a kinase in the outer membrane of E. coli
that is responsible for adding the LPS component to the outer membrane. Deletion
of this kinase increases the outer membrane permeability of this strain, allowing
potential efflux pump inhibitor compounds to more readily reach the efflux pumps.
EC1763 was transformed with a plasmid vector encoding ampicillin resistance and
the structural genes for acrAB and the new strain containing only acrAB was
designated EC1764. EC1764 was grown on LB agar containing 100 μg/mL of
ampicillin. The other related E. coli strains, EC1639 and EC1763, were grown on
LB agar or Tryptic soy agar without added antibiotic.
2. Previous tests found the largest data variation occurred from inocula made on
separate days. Therefore, replicates were run over three days instead of three plates
on one day or three wells in one plate on a single day.
Acknowledgments
We acknowledge the work of numerous former colleagues at Pharmacia who
started this research program: D. E. Decker, M. P. Sheets, S. E. Buxser, M. R.
Barbachyn, R. Gadwood, G. Zurenko, J. Bourdage, G. F. Hess, J. K. Gibson,
A. G. Morgan, J. E. Mott, et al. We also thank Keith Poole and colleagues at
Queens University in Kingston, Ontario, for E. coli strain constructs.
References
1.
1 Li, X.-Z., and Nikaido, H. (2004) Efflux-mediated drug resistance in bacteria.
Drugs 64, 159–204.
2.
2 Yu, E. W., McDermott, G., Zgurskaya, H., Nikaido, H., and Koshland, D. E. Jr.
(2003) Structural basis of multiple drug-binding capacity of the AcrB multidrug
efflux pump. Science 300, 976–980.
3.
3 Yu, E. W., Aires, J. R., and Nikaido, H. (2003) AcrB multidrug efflux pump
of Escherichia coli: Composite substrate-binding cavity of exceptional flexibility
generates its extremely wide substrate specificity. J. Bacteriol. 185, 5657–5664.
4.
4 Yu, E. W., Aires, J. R., McDermott, G., and Nikaido, H. (2005) A periplasmic
drug-binding site of the AcrB multidrug efflux pump: A crystallographic and
site-directed mutagenesis study. J. Bacteriol. 187, 6804–6815.
5.
5 Murakami, S., Nakashima, R., Yamashita, E., and Yamaguchi, A. (2002) Crystal
structure of bacterial multidrug efflux transporter AcrB. Nature 419, 587–593.
6.
6 Murakami, S., Nakashima, R., Yamashita, E., Matsumoto, T., and Yamaguchi, A.
(2006) Crystal structures of a multidrug transporter reveal a functionally rotating
mechanism. Nature 443, 173–179.
7.
7 Higgins, M. K., Bokma, E., Koronakis, E., Hughes, C., and Koronakis, V. (2004)
Structure of the periplasmic component of a bacterial drug efflux pump. Proc.
Natl. Acad. Sci. USA 101, 9994–9999.
8.
8 Anonymous (2003) National nosocomial infections surveillance (NNIS) system
report, data summary from January 1992 through June 2003, issued August 2003.
Amer. J. Infect. Control 31, 481–498.
9.
9 Baker, C. N., Banerjee, S. N., and Tenover, F. C. (1994) Evaluation of alamar
colorimetric MIC method for antimicrobial susceptibility testing of Gram-negative
bacteria. J. Clin. Microbiol. 32, 1261–1267.
10.
10 Clinical and Laboratory Standards Institute. (2006) Methods for Dilution Antimi-
crobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved
Standard – Seventh Edition. CLSI Document M7-A7.
11.
11 Amsterdam, D. (1996) Susceptibility testing of antimicrobials in liquid media. In
Antibiotics in Laboratory Medicine, 4th ed. (V. Lorian, ed.). The Williams and
Wilkins Co., Baltimore, MD, pp. 52–111.
12.
12 Eliopoulos, G. M., and Moellering, R. C. Jr. (1996) Antimicrobial combination.
In Antibiotics in Laboratory Medicine, 4th ed. (V. Lorian, ed.). The Williams and
Wilkins Co., Baltimore, MD, pp. 330–396.
16
Mycobacterium tuberculosis -Ketoacyl Acyl Carrier

Protein Synthase III (mtFabH) Assay: Principles
and Method
Sarbjot Sachdeva and Kevin A. Reynolds
Summary
Fatty acid biosynthesis is one of the relatively newer targets in antibacterial drug discovery.
The presence of distinct fatty acid synthases (FAS) in mammals and bacteria and the fact that most
bacterial FAS enzymes are essential for viability make this a very attractive antimicrobial drug
target. The enzyme -ketoacyl ACP synthase (KASIII or FabH) is the key enzyme that initiates
fatty acid biosynthesis in a type II dissociated FAS. This enzyme catalyzes the condensation
of acyl CoA and malonyl ACP (acyl carrier protein) to form a -ketoacyl ACP product, which
is further processed to form mature fatty acids that are involved in various essential cellular
processes and structures like phospholipid biosynthesis, cell wall formation, etc. Herein we
describe a new assay for the Mycobacterium tuberculosis FabH (mtFabH) enzyme involved in a
key initiation step in the synthesis of mycolic acids, which are an integral component of the cell
wall. The assay eliminates the need for the cumbersome washing steps or specialty scintillation
proximity assay beads and the preparation of acyl carrier proteins required in other assay
formats. This discontinuous assay involves the reduction of radiolabled long-chain -ketoacyl
CoA product to its dihydroxy derivative, which partitions into a nonpolar phase for quantitation,
while the reduced radiolabeled substrate derivative remains in the aqueous phase.
Key Words: FAS; fatty acid biosynthesis; lipid metabolism; mtFabH; -ketoacyl ACP
synthase; KASIII; fatty acid condensing enzymes.
1. Introduction
Bacterial fatty acid biosynthesis is an essential cellular process and has
recently gained interest as a relatively unexplored drug target. In mammals, this

205
206 S. Sachdeva and K. A. Reynolds
process is carried out by a single large polypeptide (a type I FAS) containing

catalytic domains for all of the reactions and an integral acyl carrier protein
(ACP) that ferry the substrates and products between them. Conversely, bacteria
and plants use a type II FAS in which each reaction is carried out by separate
enzymes. This distinct difference in mammalian and bacterial FAS systems
suggests the possibility of agents that selectively inhibit only one process.
Indeed, a number of antibacterial agents that target the type II FAS have been
discovered (for comprehensive reviews, see Refs, 1–3).
The enzymes involved in bacterial and plant type II FAS system and their
known inhibitors are shown in Fig. 1. FabH catalyzes the first condensation
reaction between an acyl CoA and malonyl ACP (MACP). Typically, this
enzyme uses acetyl CoA or other short-chain acyl CoA substrates to initiate the
biosynthesis of palmitoyl CoA and related fatty acids. In Mycobacterium tuber-
culosis, these long-chain fatty acids are generated by a type I FAS. A type II
FAS elongates them further to form very long fatty acid chains (>C54 ), which are
Fig. 1. Roles of individual enzymes in a type II fatty acid synthase. Enzymes

inhibited by triclosan, cerulenin, isoniazid, and TLM (thiolactomycin) are indicated
(wavy lines).
mtFabH Assay: Principles and Method 207
then elaborated to mycolic acids, a key structural component and permeability

barrier of the M. tuberculosis cell wall. Accordingly, the M. tuberculosis FabH
(mtFabH) has a different and unusual specificity for longer acyl CoA substrates.
Convenient assays for this enzyme permit discovery and development of
selective inhibitors and a potential new treatment for tuberculosis.
1.1. Assay Overview and Principles

The most commonly used FabH assay involves the use of radioactive
acyl CoA and MACP to form a radioactive -ketoacyl-ACP product. This
radioactive protein (ACP) product can be precipitated with acid, washed, and
counted, while the radioactive substrate stays in aqueous phase. The accuracy
of the assay requires extensive time-consuming washing steps. Nonetheless,
this general approach has been used to assay FabH from various pathogenic
microorganisms such as E. coli, E. faecalis, H. influenzae, S. pyogenes, and
S. aureus (4,5). Unfortunately, this method cannot be used to assay mtFabH,
because the long-chain acyl CoA substrates utilized by mtFabH have poor
solubility and are not readily resolved from the -ketoacyl–ACP product by
the acid precipitation and extensive washing steps. Other assay formats such as
a scintillation proximity assay (SPA) (6) and a filter disk (7) assay have been
described and can successfully be used for mtFabH. However, these assays
involve either tedious preparation of a biotinylated malonyl ACP substrate
(SPA) or numerous washing steps (filter disk assay). Recently, Brown et al. (8)
developed an alternative method similar to an assay used originally by Garwin
et al. (9) for FabF/FabB enzymes. This assay (Fig. 2) involves the reduction of
the assay mixture after reaction completion to produce radioactive substrate and
product derivatives that differ dramatically from each other in terms of polarity.
This difference permits a simple separation of the two and quantitation of the
radioactive product. The assay uses FabD to produce radioactive 2-14 C MACP
in situ from holo-ACP and malonyl CoA. The mtFabH catalyzes a decar-
boxylative condensation of this MACP with the long-chain acyl CoA substrate
(specificity ranging from hexanoyl CoA to arachidonoyl CoA; see Table 1)
to form a long-chain -ketoacyl ACP. Reduction of this product by NaBH4
gives the corresponding radioactive long-chain alkyl-1, 3-diol product with a
14
C label at C2. This product derivative can be partitioned into non-aqueous
phase, whereas the radioactive propane-1,3-diol obtained by reduction of the
radioactive malonyl thioesters stays in an aqueous phase. As described below,
this assay can be simplified by using malonyl CoA directly as a substrate,
instead of MACP (see Fig. 2).
Fig. 2. Schematic of mtFabH assay. The principle of separation of radioactive

substrate and product is described in Section 1.2. The radioactive center is shown by
the asterisk *. R’ can be either CoA or ACP.
A slower reaction rate for mtFabH is observed when malonyl CoA is used in
place of a MACP substrate (8) (see Table 1). Dodecanoyl CoA is the preferred
substrate for assays using either malonyl CoA or ecMACP (generated from the
Escherichia coli ACP). With this acyl CoA substrate, the reaction rate is about
four-fold slower with malonyl CoA than with ecMACP or mtMACP (generated
from the M. tuberculosis ACP). Catalysis of longer-chain acyl CoA substrates
by the mtFabH is markedly reduced using either ecMACP or malonyl CoA, but
not mtMACP. One advantage of this modified assay is that all the substrates
are commercially available. There is no need to obtain a purified ACP, or to
convert it to either the corresponding MACP or biotinylated MACP, leading to
significant savings in both time and cost. The direct utilization of radioactive
malonyl CoA in the assay also maximizes the use of this substrate for the
assay, avoiding the inevitable losses associated with conversion to malonyl
ACP. The assay also uses lower concentrations of malonyl CoA (12.5 μM
vs. the 50 μM typically used in other formats (7,8), decreasing the amount of
material and potentially increasing the range of the assay to include both poor
Table 1
Specific Activity of mtFabH with Malonyl
CoA (in Place of MACP) Using a Range of
Different Acyl CoA Substrates
Acyl CoA Primer Specific Activity

Chain Length mtFabH
(nMoles/min/mg)
C6 0.38 +/- 0.064

C8 0.69 +/- 0.18
C10 0.758 +/- 0.095
C12 1.77 +/- 0.041
C14 0.3528 +/- 0.0269
C16 0.128 +/- 0.086
C18 0.036 +/- 0.0009
C20 0.155 +/- 0.0133
and good competitive inhibitors. A final advantage of this new assay format is
an excellent 60:1 signal-to-noise ratio (compared with 10:1 in the scintillation
proximity assay (6)).
2. Materials
1. Lauroyl CoA or other long-chain acyl CoA (Sigma)—Make a stock solution of
100 mM or 10 mM in aqueous hydrochloric acid, pH 3.5, then dilute to 100 μM
working concentration and aliquot into appropriate working volumes (see Note 1).
Store at –80 °C.
2. Radioactive [2-14 C] Malonyl CoA (1.8 mM; specific activity, 55 mCi/mmol,
American Radiolabeled Chemicals, Inc.). Dilute approximately 7.2 times in aqueous
hydrochloric acid solution (pH 3.5) and aliquot the resulting 250 μM solution into
appropriate working volumes (see Note 2). Store at –80 °C.
3. mtFabH expression in E coli and purification has been described previously (6).
4. Sodium phosphate buffer: 100 mM sodium phosphate, pH 7.0, in double-distilled
(DD) water or enzyme grade water.
5. Tetrahydrofuran (THF)—reagent grade.
6. Reducing reagent: 5 mg of NaBH4 to 1 mL of a 70% 100 mM K2 HPO4 , 100mM
KCl, 30% THF solution. This solution is prepared fresh and kept on ice until used
(10) (see Note 3).
7. Screw-cap microcentrifuge tubes.
8. Scintillation cocktail—EcoScint A (National Diagnostics).
9. Scintillation vials—Wheaton Science; high-density polyethylene (HDPE).
3. Methods
The reaction is carried out in 20 μL (total volume). This low volume
using a minimum of the commercial radioactive malonyl CoA sample with an
unchanged specific activity balances a high signal-to-noise ratio with a low
cost. Larger-volume assays would require either additional radioactive malonyl
CoA (increased cost) or the addition of unlabeled malonyl CoA (decreasing
the specific activity and signal-to-noise ratio). The concentrations of various
components in a typical assay are shown in Table 2. These volumes permit
determination of an IC50 value for mtFabH inhibitor but can be modified to
perform the other enzyme studies by replacement with an additional 2 μL of
buffer.
1. Thaw the desired number of lauroyl CoA, malonyl CoA, and mtFabH aliquots and
keep at 4 °C.
2. In a screw-cap microcentrifuge tube, add 2.5 μL of 100 μM lauroyl CoA solution
(final concentration, 12.5 μM lauroyl CoA), 1 μL of the 250 μM [2-14 C] malonyl
CoA solution (approx. 31,000 counts; final concentration, 12.5 μM), and 2 μL
of 10X inhibitor concentration (for inhibitor IC50 studies). Add 0.1 M of sodium
phosphate buffer, pH 7.0, to make up the volume to 18 μL.
3. Initiate the reaction by addition of 2 μL of mtFabH (0.2–0.4 μg) solution in 0.1 M
of sodium phosphate buffer, pH 7.0. Cap the microcentrifuge tube and keep at 37
°C for a designated time (typically, 30–90 min). Under these assay conditions, a
linear reaction rate was observed over a 2-h assay period (Fig. 3).
4. Add 0.5 mL of the reducing solution to the assay mixture, cap the vials, and shake
vigorously. Incubate the mixture at 37 °C for 15 min (see Note 4).
5. Add 500 μL of toluene to the mixture, mix the solution vigorously, and allow to
separate at room temperature (see Note 5).
6. Remove 320 μL of the upper phase (toluene), and combine with approximately 3
mL of scintillation cocktail.
Table 2
List of Various Components of a Typical mtFabH Assay
Component Stock Conc. Volume Used (μL) Final Conc./Amount
Lauroyl CoA 100 μM 2.5 12.5 μM

Malonyl CoA 250 μM 1 12.5 μM
Inhibitor (if any) 10X 2 1X
mtFabH 2 μg/μL 2 0.2 μg
Sodium phosphate, pH 7.0 100 mM 12.5 72 mM
Total volume 20
10000
8000
Counts
6000
14C
4000
2000
0
0 20 40 60 80 100 120
Time in minutes
Fig. 3. Linearity of mtFabH activity with time. Enzyme is incubated with substrates
at 37 °C for the specified time, and product formation is quantitated as described above.
7. Determine the radioactivity of the toluene extract with a scintillation counter,

and double this value to obtain the actual radioactivity in non-aqueous phase
(see Note 6).
4. Notes
1. As acyl CoA substrates are unstable at neutral and higher pH, the solutions are
made in acidic pH (aqueous hydrochloric solutions at pH 3.5) and stored in aliquots
at –80 °C in working volumes (avoiding the need to repeatedly thaw and refreeze
the solutions and the associated increased degradation).
2. Malonyl CoA from this source comes in 1800-μM solution. It is diluted to a final
concentration of 250 μM and stored at –80 °C at pH 3.5. The manufacturer’s
technical data sheet states that under these conditions the rate of decomposition
is approximately 2% over the first six months. A very important factor in this
particular assay is the purity of the commercially available radioactive malonyl CoA.
Radioactive malonyl CoA is prepared by the reaction of monothiophenylmalonate
[malonyl-2-14 C] and coenzyme A, and the [2-14 C] malonyl CoA product is purified
by column chromatography. The radioactive reactant is relatively nonpolar and, if
present in the [2-14 C] malonyl CoA sample, can lead to a high background during
the assay and a substantially reduced signal-to-noise ratio.
3. Divalent cations like Mg2+ and Mn2+ catalyze the decomposition of sodium borohy-
dride (NaBH4 ), preventing effective reduction of the 3-ketoacyl CoA product. Thus,
the use of distilled water free of divalent ions is used in both the assay and the
preparation of the reducing reagent solution (10).
4. Sodium borohydride produces significant effervescence when mixed with aqueous
solutions. There is thus a potential for loss of the radioactive material from the vial at
this point. A screw-cap microcentrifuge tube should be used and tightened carefully
before shaking the sample. Reduction of long-chain acyl CoA is quantitative within
10 min. If inconsistent results are obtained, the reduction reaction can be carried
out for a longer time. The THF in the reducing solution decreases the time required
to quantitatively reduce the acyl thioesters (from 2 h to 10 min) (10). The buffer
can be stored at room temperature, and NaBH4 should be added just before use.
This reduction solution can be used for up to 2 h if kept on ice but potentially can
lead to a loss of consistency with the assay results.
5. The volume of toluene solution increases to about 640 μL due to partitioning of
THF into toluene.
6. Solvents used to deliver inhibitors have a predictable inhibitory effect on the activity
on mtFabH. The effect of various concentrations of dimethylsulfoxide (DMSO) and
methanol is shown in Fig. 4. This figure demonstrates that the concentrations of
solvent should ideally be at or below 1% in the final assay volume. The order of
substrate and inhibitor components can be changed to perform the assays with or
without the enzyme-inhibitor preincubation. While this assay uses malonyl CoA
(with the associated advantages discussed above), it can also be used with MACP.
120
DMSO
100 MeOH
% mtFabH Activity
80
60
40
20
0
0.01 0.1 1 10
% Solvent
Fig. 4. Effect of solvent concentrations of dimethylsulfoxide (DMSO) and methanol

(MeOH) on mtFabH activity.
References
1.
1 Heath, R. J., White, S. W., and Rock, C. O. (2001) Lipid biosynthesis as a target
for antibacterial agents. Prog. Lipid Res. 40, 467–497.
2.
2 Rock, C. O., and Jackowski S. (2002) Forty years of bacterial fatty acid synthesis.
Biochem. Biophys. Res. Comm. 292(5), 1155–1166.
3.
3 Heath, R. J., White, S. W., and Rock, C. O. (2002) Inhibitors of fatty acid synthesis
as antimicrobial chemotherapeutics. Appl. Microbiol. Biotechnol. 58, 695–703.
4.
4 Nie, Z., Perretta, C., Lu, J., Su, Y., Margosiak, S., Gajiwala, K. S., Cortez, J.,
Nikulin, V., Yager, K. M., Appelt, K., and Chu, S. (2005) Structure-based design,
synthesis, and study of potent inhibitors of -ketoacyl-acyl carrier protein synthase
III as potential antimicrobial agents. J. Med. Chem. 48, 1596–1609.
5.
5 Tsay, J. T., Oh, W., Larson, T. J., Jackowski, S., and Rock, C. O. (1992) Isolation
and characterization of the -ketoacyl-acyl carrier protein synthase III gene (fabH)
from Escherichia coli K-12. J. Biol. Chem. 267, 6807–6814.
6.
6 Scarsdale, J. N., Kazanina, G., He, X., Reynolds, K. A., and Wright, H. T. (2001)
Crystal structure of the Mycobacterium tuberculosis -ketoacyl-acyl carrier protein
synthase III. J. Biol. Chem. 276, 20516–20522.
7.
7 Choi, K. H., Kremer, L., Besra, G. S., and Rock, C. O. (2000) Identification and
substrate specificity of -ketoacyl (acyl carrier protein) synthase III (mtFabH)
from Mycobacterium tuberculosis. J. Biol. Chem. 275, 28201–28207.
8.
8 Brown, A. K., Sridharan, S., Kremer, L., Lindenberg, S., Dover, L. G.,
Sacchettini, J. C., and Besra, G. S. (2005) Probing the mechanism of the
Mycobacterium tuberculosis -ketoacyl-Acyl carrier protein synthase III mtFabH;
factors influencing catalysis and substrate specificity. J. Biol. Chem. 280(37),
32539–32547.
9.
9 Garwin, J. L., Klages, A. L., and Cronan, J. E. Jr. (1980) Structural, enzymatic, and
genetic studies of -ketoacyl-acyl carrier protein synthases I and II of Escherichia
coli. J. Biol. Chem. 255(24), 11949–11956.
10.
10 Barron, E. J., and Mooney, L. A. (1968) Determination of acyl-thiolesters by
gas-liquid chromatography of their sodium borohydride reduction products. Anal.
Chem. 40(11), 1742–1744.
17
Screening for Compounds That Affect the Interaction

Between Bacterial Two-Component Signal Transduction
Response Regulator Protein and Cognate Promoter DNA
Matthew G. Erickson, Andrew T. Ulijasz, and Bernard Weisblum
Summary
Bacterial signal transduction systems can be used as drug targets. The signal transduction
targets fall into two groups—sensor kinases and response regulators. Previously reported studies
describe hits that were thought to inactivate sensor kinases but on closer examination were
found to act elsewhere instead; a possible reason for this is that full-length sensor kinases are
integral membrane proteins whose activity might reflect interaction with the cell membrane or
with membrane components. We describe a model system that instead is based on the interaction
between a test compound and a response regulator in a homogeneous phase reaction. In this
system, response regulator-DNA complex formation and its inhibition by a test compound are
measured by fluorescence polarization. The model system should be readily adaptable to drug
discovery based on other bacterial two-component s transduction systems.
Key Words: fluorescence polarization; signal transduction; sensor kinase; response

regulator.
1. Introduction
Two-component signal transduction (TCST) systems mediate adaptive
changes in bacteria. The key participants are a sensor kinase and a response
regulator. The response regulator protein is phosphorylated by its cognate
activated sensor kinase and acts as transcription factor by binding to the promoter
region of the gene(s) whose function it regulates. For reviews, see the studies
by Hoch and Silhavy (1), Stock et al. (2), and West and Stock (3). Genetic

215
216 M. G. Erickson et al.
studies have shown that several TCST systems are essential for virulence or
infectivity, suggesting that TCST systems may be suitable targets for screening
compounds with anti-infective activity. Examples include (1) Streptococcus
pneumoniae CiaRH (4) and RR489 (5), which control cephalosporin resis-
tance and lung infectivity, respectively; (2) Mycobacterium tuberculosis MtrA,
which is needed for infectivity (6); (3) Listeria monocytogenes CesRK, which
regulates tolerance to ß-lactam antibiotics (7); and (4) Enterococcus faecium
VanRS, which specifies inducible vancomycin resistance (8).
Bacterial antibiotic resistance has become a problem that severely limits the
clinical effectiveness of many of our commonly used antibiotics. One conse-
quence has been the need for new antibiotics, which, in turn, has led to the search
for new drug targets. One example of a group of potential drug targets is the
TCST systems of bacteria. These systems generally consist of a sensor kinase
and its cognate response regulator in which the kinase is associated with the
cell membrane and serves as a specific environmental sensor and, in response to
environmental changes, auto-phosphorylates and transfers its phosphoryl group
to its cognate response regulator. The phosphorylated response regulator, thus
activated, binds to a cognate promoter(s) enhancing transcription of a particular
gene, or group of genes. Several studies (9–14) have reported the discovery of
lead compounds that inhibit kinase activity of TC His kinases. A reevaluation
of these findings later noted some of the compounds as acting at other (unspec-
ified) targets (15). In retrospect, the enzymatic activity of His kinases in vivo
might be affected by (1) perturbing the cell membrane or, alternatively, (2) the
activity of kinase-response regulator pairs might also include cross-talk effects
(see Note 1). Assay development based on the interaction between a response
regulator and its cognate DNA binding site avoids both mitigating circumstances.
We describe a fluorescence polarization assay based on the VanRS TCST
system that regulates vancomycin resistance in Enterococcus faecium. Assay
development utilizing this system has provided a model system that quantifies
the binding between DNA promoter segments and their cognate response
regulator protein. Using the VanRS TCST system, we demonstrate inhibition of
response regulator protein-promoter segment binding with a known inhibitor.
Observed binding constants were comparable to those reported in surface
plasmon resonance measurements and gel shift measurements (16).
2. Materials
2.1. Promoter DNA Fragment
1. 5 -Fluorescein-tagged double-stranded 18-mer oligonucleotide promoter segment
H2 based on the vanH promoter studies of Holman et al. (8) was used (see Fig. 1).
Two-Component Signal Transduction Assays 217
Fig. 1. The vanRS and vanH promoters (R1 and H1 + H2, respectively). Expression
of vanH is upregulated by binding of VanR∼P to H1 + H2. VanR also binds to its
own promoter R1 regulating its own transcription. The promoter segment used in these
studies was based on H2. Coordinates are numbered with respect to both the vanR and
vanH transcription start sites as reported by Holman et al. (8).
The two individual strands, H2 Forward and H2 Reverse, were chemically synthe-
sized, with H2 Forward arbitrarily selected to carry the 5 -fluorescein:
H2 Forward 5 Z − TTT TCT TAG GAA ATT AAC

H2 Reverse 5 − GTT AAT TTC CTA AGA AAA
where Z = fluorescein.
2. The two single-stranded samples were dissolved in de-ionized water at a concen-
tration of 8 μM and stored at –20 °C. Prior to use, they were annealed by mixing
equal volumes of the forward and reverse strands and heated in a thermal cycler at
80 °C for 10 min, followed by slow cooling to room temperature.
2.2. Response Regulator Protein

1. The VanR response regulator protein was overexpressed as a GST-fusion protein in
Escherichia coli BL21 DE3 using the full-length vanR sequence inserted between
NdeI and HindIII in the multiple cloning site of plasmid pGEX-2TK (Amersham
Pharmacia Biotech) as described previously (17). GST-VanR was stored in 1X gel
shift buffer (GSB).
2. 1X gel shift buffer (GSB): 20 mM HEPES, pH 7.2, 5 mM MgCl2 , 0.5 mM Ca Cl2 ,
0.1 mM Na2 EDTA, and 10% glycerol (see Note 2).
2.3. Compound A
1. The inhibitory action of compound A (2-(2,3,4-trifluorphenyl)-2,3-
dihydroisothiazole-3-one) (Maybridge Chemical Co., KM-04537) on signal
transduction was originally reported by Roychoudhury et al. (18) as part of a
search for inhibitors of alginate biosynthesis, a virulence factor in Pseudomonas
aeruginosa (see Note 3).
2. Compound A was dissolved at a concentration of 1 mM in water and stored
at –20 °C.
3. Methods
3.1. FP Measurements
1. Binding reactions were run in black 384-well black microtiter plates (Corning).
2. All fluorescence polarization experiments were performed using a Model #1420
fluorometer (Wallac, Turku, Finland) with a measurement time of 1 s per well.
Fluorescein was excited at 485 nM, and its emission was measured at 515
nM. Measurements were made at ambient temperature, approximately 25 °C. The
microtiter plate was allowed to equilibrate for 30 min at room temperature prior to
recording fluorescence polarization measurements.
3. The solutions needed to measure GST-VanR-DNA complex formation were
prepared as follows:
a. Gel shift buffer (GSB) was prepared as in Section 2.2.
b. A dilution series GST-VanR in GSB, 20-μL scale, was prepared by seven
successive 3.16-fold dilutions beginning with the highest concentration, 6 μM
(see Fig. 2).
c. Fluoroscein-labeled H2 DNA was dissolved at 130 nM in GSB.
Fig. 2. Fluorescence polarization (FP) analysis of GST-VanR-PvanH2 complex

formation, effect of CpdA. FP was used to measure the concentrations of complexes
formed between fluorescein-labeled PvanH2 DNA and GST-VanR. The reaction
mixtures contained 13 nM 5-fluorescein-labeled PvanH2, DNA oligomer, and
increasing amounts of GST-VanR, as indicated on the abscissa. The structure of CpdA
is inserted in the figure. Three test curves were run using 0, 2.5, and 5.0 μM CpdA.
Kd for the control reaction was 30 nM. The addition of 5 μM CpdA increased Kd by a
factor greater than 50-fold (see Note 7). (Data shown are based on Erickson et al. (22)
with permission of Sage Publications Inc.)
d. 20, 10, and 6 μM stock solution of CpdA in GSB (see Note 4).
4. Using the solution described in Section 3.1.3, the binding reaction contained, in a
volume of 40 μL:
a. GSB sufficient to adjust the total volume to 40 μL.
b. GST-VanR, 20 μL of each dilution in the test series.
c. H2 DNA, 4 μL (see Note 5).
d. Test compound, 4 μL. The highest concentration of CpdA used was 5 μM. Other
compounds should be tested at higher concentrations (see Note 6).
5. The G factor was obtained by collecting parallel and perpendicular components of
fluorescence from a 40-μL sample containing 8 nM of fluorescein in water with
water as the blank. A blank reaction containing 40 μL of 1.0 μM GST-VanR in 1X
GSB was used to obtain a correction factor to subtract from the raw-intensity data.
4. Notes
1. Thus far, TCST sensor kinases have been tested as possible drug targets, but
studies reported to date have failed to produce anti-infective leads (9–14). TCST
kinases may be less suitable targets than their cognate response regulators due to
phosphorylation by a promiscuous kinase from another system or to nonspecific
phosphorylation from small phosphoryl group donors in the cytosolic fraction. This
suggests that pharmacological intervention aimed at response regulators would be
more difficult to circumvent.
2. GSB was used in the gel mobility retardation experiments as described by Ulijasz
et al. (17) at –80 °C.
3. Compound A was shown previously to inhibit phosphoryl transfer from VanS∼P
to VanR by its action on VanR (19). The resultant accumulation of VanS∼P was
reversed by supplementing the reaction mixture with additional VanR, but additional
VanS had no effect.
4. Compound A inhibits the binding of VanR and VanR∼P to its DNA promoter
site. This has been demonstrated by both surface plasmon resonance studies and
agarose gel electrophoresis mobility retardation, suggesting a wider scope of action
involving the VanR protein DNA binding domain as well (17). The regulatory
regions of vanRS and vanHAX contain response-regulator-binding sequences desig-
nated R1, H1, and H2, as shown in Fig. 1.
5. The promoter DNA functionally serves as a surrogate ligand. The effect is allosteric,
unlike other assays that are crafted on the basis of a competitive interaction at the
enzyme active site.
6. As shown in Fig. 2, compound A inhibits the binding of PvanH2 to GST-VanR.
The Kd for the control reaction was 30 nM. This result is comparable to promoter-
response regulator interaction values reported by Mattison and Kenney (20) for the
OmpR bacterial TCST. It is also comparable to the value of 40 nM reported for
the binding of VanR∼P to the vanHAX promoter by gel shift measurement (8), and
to the value of approximately 150 nM reported for the binding of GST VanR∼P
to each of the three promoter segments in the previously reported SPR study (16).
Compound A at 1.5, 2.5, and 5.0 μM increased the apparent Kd to 35 nM, 150 nM,
and 500 nM. This compares with the four- to five-fold increase reported for the
apparent Kd for the GST-VanR∼ P promoter segment interactions reported (16).
7. Z’ is a number calculated according to the formula
Z = 1 − 3SD1 + SD2/μ1 − μ2
where SD1 and SD2 are the standard deviations in the experimental and control
values, and μ1 and μ2 are the means of the experimental and control values (21).
A Z value between 0.5 and 1 is considered “an excellent assay.” Assuming a
difference of 150 mP units between the two signals, Fig. 2, we can calculate that
for Z = 0.8, SD1 + SD2 would have to be less than 10.
Acknowledgments
We thank F. M. Hoffmann for access to a fluorometer, supported by the
University of Wisconsin Clinical Cancer Center.
References
1.
1 Hoch, J. A., and Silhavy, T.J. (eds.) (1995) Two-Component Signal Transduction.
ASM Press, Washington, DC.
2.
2 Stock, A. M., Robinson, V. L., and Goudreau, P. N. (2000) Two-component signal
transduction. Ann. Rev. Biochem. 69, 183–215.
3.
3 West, A. H., and Stock, A. M. (2001) Histidine kinases and response regulator
proteins in two component signaling systems. Trends Biochem. Sci. 26, 369–376.
4.
4 Giammarinaro, P., Sicard, M., and Gasc, A. M. (1999) Genetic and physiological
studies of the CiaH-CiaR two-component signal-transducing system involved in
cefotaxime resistance and competence of Streptococcus pneumoniae. Microbiology
145, 1859–1869.
5.
5 Throup, J. P., Koretke, K. K., Bryant, A. P., Ingraham, K. A., Chalker, A. F.,
Ge, Y., Marra, A., Wallis, N. G., Brown, J. R., Holmes, D. J., Rosenberg, M., and
Burnham, M. K. (2000) A genomic analysis of two-component signal transduction
in Streptococcus pneumoniae. Mol. Microbiol. 35, 566–576.
6.
6 Zahrt, T. C., and Deretic, V. (2001) Mycobacterium tuberculosis signal trans-
duction system required for persistent infections. Proc. Natl. Acad. Sci. USA 98,
12706–12711.
7.
7 Kallipolitis, B. H., Ingmer, H., Gahan, C. G., Hill, C., and Sogaard-Andersen, L.
(2003) CesRK, a two-component signal transduction system in Listeria monocy-
togenes, responds to the presence of cell wall-acting antibiotics and affects beta-
lactam resistance. Antimicrob. Agents Chemother. 47, 3421–3429.
8.
8 Holman, T. R., Wu, Z., Wanner, B. L., and Walsh, C. T. (1994) Identification of the
DNA-binding site for the phosphorylated VanR protein required for vancomycin
resistance in Enterococcus faecium. Biochemistry 33, 4625–4631.
9.
9 Barrett, J. F., Goldschmidt, R. M., Lawrence, L. E., Foleno, B., Chen, R.,
Demers, J. P., Johnson, S., Kanojia, R., Fernandez, J., Bernstein, J., Licata, L.,
Donetz, A., Huang, S., Hlasta, D. J., Macielag, M. J., Ohemeng, K., Frechette, R.,
Frosco, M. B., Klaubert, D. H., Whiteley, J. M., Wang, L., and Hoch, J. A. (1998)
Antibacterial agents that inhibit two-component signal transduction systems. Proc.
Natl. Acad. Sci. USA 95, 5317–5322.
10.
10 Barrett, J. F., and Hoch, J. A. (1998) Two-component signal transduction as a
target for microbial anti-infective therapy. Antimicrob. Agents Chemother. 42,
1529–1536.
11.
11 Stephenson, K., and Hoch, J. A. (2002) Two-component and phosphorelay signal
transduction systems as therapeutic targets. Curr. Opin. Pharmacol. 2, 507–512.
12.
12 Kanojia, R. M., Murray, W., Bernstein, J., Fernandez, J., Foleno, B. D., Krause, H.,
Lawrence, L., Webb, G., and Barrett, J. F. (1999) 6-oxa isosteres of anacardic
acids as potent inhibitors of bacterial histidine protein kinase (HPK)-mediated
two-component regulatory systems. Bioorg. Med. Chem. Lett. 9, 2947–2952.
13.
13 Macielag, M. J., Demers, J. P., Fraga-Spano, S. A., Hlasta, D. J., Johnson, S. G.,
Kanojia, R. M., Russell, R. K., Sui, Z., Weidner-Wells, M. A., Werblood, H.,
Foleno, B. D., Goldschmidt, R. M., Loeloff, M. J., Webb, G. C., and Barrett, J. F.
(1998) Substituted salicylanilides as inhibitors of two-component regulatory
systems in bacteria. J. Med. Chem. 41, 2939–2945.
14.
14 Weidner-Wells, M. A., Ohemeng, K. A., Nguyen, V. N., Fraga-Spano, S.,
Macielag, M. J., Werblood, H. M., Foleno, B. D., Webb, G. C., Barrett, J. F., and
Hlasta, D. J. (2001) Amidino benzimidazole inhibitors of bacterial two-component
systems. Bioorg. Med. Chem. Lett. 11, 1545–1548.
15. Hilliard, J. J., Goldschmidt, R. M., Licata, L., Baum, E. Z., and Bush, K. (1999)
15
Multiple mechanisms of action for inhibitors of histidine protein kinases from
bacterial two-component systems. Antimicrob. Agents Chemother. 43, 1693–1699.
16.
16 Smith, E. A., Erickson, M. G., Ulijasz, A. T., Weisblum, B., and Corn, R. M. (2003)
Surface plasmon resonance imaging of transcription factor proteins: Interactions
of bacterial response regulators with DNA Arrays on gold films. Langmuir 19,
1486–1492.
17.
17 Ulijasz, A. T., Kay, B. K., and Weisblum, B. (2000) Peptide analogues of the
VanS catalytic center inhibit VanR binding to its cognate promoter. Biochemistry
39, 11417–11424.
18. Roychoudhury, S., Zielinski, N. A., Ninfa, A. J., Allen, N. E., Jungheim, L. N.,
18
Nicas, T. I., and Chakrabarty, A. M. (1993) Inhibitors of two-component signal
transduction systems: Inhibition of alginate gene activation in Pseudomonas aerug-
inosa. Proc. Natl. Acad. Sci. USA 90, 965–969.
19.
19 Ulijasz, A. T., and Weisblum, B. (1999) Dissecting the VanRS signal transduction
pathway with specific inhibitors. J. Bacteriol. 181, 627–631.
20.
20 Mattison, K., and Kenney, L. J. (2002) Phosphorylation alters the interaction of
the response regulator OmpR with its sensor kinase EnvZ. J. Biol. Chem. 277,
11143–11148.
21.
21 Zhang, J. H., Chung, T. D., and Oldenburg, K. R. (1999) A simple statistical
parameter for use in evaluation and validation of high throughput screening assays.
J. Biomol. Screen. 4, 67–73.
22.
22 Erickson, M. G., Ulijasz, A. T., and Weisblum, B. (2005) Bacterial 2-component
signal transduction systems: A fluorescence polarization screen for response
regulator-protein binding. J. Biomol. Screen. 10, 270–274.
18
The Activity of rRNA Resistance Methyltransferases

Assessed by MALDI Mass Spectrometry
Stephen Douthwaite, Rikke Lind Jensen, and Finn Kirpekar
Summary
Resistance to antibiotics that target the bacterial ribosome is often conferred by methylation at
specific nucleotides in the rRNA. The nucleotides that become methylated are invariably key sites
of antibiotic interaction. The addition of methyl groups to each of these nucleotides is catalyzed
by a specific methyltransferase enzyme. The Erm methyltransferases are a clinically prevalent
group of enzymes that confer resistance to the therapeutically important macrolide, lincosamide,
and streptogramin B (MLSB ) antibiotics. The target for Erm methyltransferases is at nucleotide
A2058 in 23S rRNA, and methylation occurs before the rRNA has been assembled into 50S
ribosomal particles. Erm methyltransferases occur in a phylogenetically wide range of bacteria
and differ in whether they add one or two methyl groups to the A2058 target. The dimethylated
rRNA confers a more extensive MLSB resistance phenotype. We describe here a method using
matrix-assisted laser desorption/ionization (MALDI) mass spectrometry to determine the location
and number of methyl groups added at any site in the rRNA. The method is particularly suited to
studying in vitro methylation of RNA transcripts by resistance methyltransferases such as Erm.
Key Words: rRNA methylation; ribosomal antibiotic resistance; RNA mass spectrometry.
1. Introduction
Many clinically important antibiotics inhibit the growth of bacteria by
blocking protein synthesis on the ribosomes (1–3). These antibiotics bind to
regions of the ribosome that are concerned with essential steps in protein
synthesis such as peptide bond formation, GTP hydrolysis, and mRNA
decoding. The main contact sites for the antibiotics are on the rRNA, rather
than on the ribosomal protein components (4), which is consistent with the

223
224 S. Douthwaite et al.
view that the rRNA carries out the primary functions of the ribosome, including
formation of the peptide bond (5,6). Not surprisingly therefore, changes in
the ribosome structure that confer antibiotic resistance are mainly to be found
in the rRNA and consist of nucleotide methylations or base substitutions (4).
There are indeed cases of ribosomal protein (r-protein) mutations that confer
resistance to ribosome-targeting antibiotics. However, these mutations tend to
confer resistance in an indirect manner by influencing the conformation of
adjacent rRNA structures that make contact with the antibiotic (7,8).
In pathogenic bacteria with multiple rRNA (rrn) operons, resistance to
ribosome-targeting drugs is most commonly conferred through modification
of the rRNA by specific methyltransferase enzymes (9,10). All the rRNA
resistance methyltransferases studied to date use S-adenosyl-L-methionine
(AdoMet) as the methyl group donor and contain conserved motifs involved in
AdoMet binding (11) and have distinct similarity to Rossmann-fold structures
found in proteins that bind other adenosine-based cofactors such as ATP and
NAD (12). In other parts of their structures, the rRNA methyltransferases are
largely heterogeneous, and these differences presumably enable the enzymes
to distinguish their specific target nucleotides.
Target nucleotides in 16S rRNA tend to be methylated after assembly of the
30S subunit. The methyltransferases Grm and KamA function in this manner
by methylating the assembled 30S subunit at nucleotides G1405 and A1408,
respectively, and thereby confer resistance to aminoglycoside antibiotics (13,14)
(Escherichia coli rRNA nucleotide numbering is used throughout). These target
nucleotides are displayed at the decoding region on the subunit interface sites
on the mature 30S subunit (15,16). For methylation to occur, the nucleotides
are not only required to be accessible on the surface of the small subunit, but
also need to be presented in higher-order structures that are absent in the free
16S rRNA. In contrast, the free 23S rRNA is generally the preferred substrate
for methylation prior to its complete assembly with r-proteins to form 50S
subunits. Examples include nucleotide G748, the target for the tylosin resis-
tance methyltransferase RlmAII (TlrB) (17); nucleotide A1067, the target for
the thiostrepton resistance methyltransferase Tsr (18,19); nucleotide A2058, the
target for the MLSB (macrolide, lincosamide, and streptogramin B antibiotic)
resistance methyltransferase Erm (20,21); and nucleotides G2470, U2479, and
G2535 that are respectively targeted by the orthosomycin resistance methyl-
transferases EmtA (22), AviRb, and AviRa (23). In addition to methylating the
free 23S rRNA substrate, these methyltransferases also specifically recognize
their targets within short RNA transcripts, making them ideal for the type of
in vitro studies described here.
MALDI-MS Analysis of RNA Methylation 225
The most pervasive of the resistance methyltransferases are those belonging

to the Erm family. All Erm methyltransferases specifically methylate the N6 -
position of nucleotide A2058 in 23S rRNA, but differ as to whether they
monomethylate or dimethylate this nucleotide (20,24). Erm monomethyltrans-
ferases are found predominantly in drug-producing actinomycetes species and
confer the MLSB type I phenotype with high resistance to lincosamides, low
to moderate resistance to macrolide and streptogramin B antibiotics (24,25),
but no resistance to the latest generation of macrolides, the ketolides (26). Erm
dimethyltransferases confer the MLSB type II phenotype with high resistance
to all macrolide, lincosamide, and streptogramin B antibiotics (24,27) including
ketolides (26). Type II MLSB resistance with dimethylation of the rRNA is the
more common mechanism in bacterial pathogens.
Nucleotide A2058 is situated in the peptidyl transferase loop of 23S rRNA.
This region is inaccessible to Erm methyltransferases in assembled 50S subunit
particles, although precursor particles can serve as substrates for ErmC (28).
Nucleotide A2058 is methylated by Erm(E) (29) and Erm(S) (30) when
displayed in small in vitro RNA transcripts of 26 to 48 nucleotides. However,
methylation is much more efficient in slightly larger RNA transcripts that
maintain the structure of the peptidyl transferase loop (Fig. 1); such substrates
are methylated as efficiently as the intact 23S rRNA and are thus well-
suited for studying Erm methyltransferase activity. Methylation activity can
be determined by a number of techniques including the use of radiolabeled
AdoMet (30), primer extension with reverse transcriptase (29), and matrix-
assisted laser desorption/ionization mass spectrometry (MALDI-MS) (17,23).
Each method has its own strengths and weaknesses, and one of the advantages
with the MALDI-MS approach is the ability to distinguish between mono- and
dimethylation at the Erm target nucleotide A2058. Here we describe the prepa-
ration of the dimethyltransferase Erm(E) for in vitro activity studies on RNA
transcripts (Fig. 1) followed by MALDI-MS analysis of methylation. Detection
of singly methylated A2058 by MALDI-MS is demonstrated using the Erm(N)
monomethyltransferase (formerly TlrD) (27).
2. Materials
1. Lauria Bertani (LB) broth (32) was used as the rich medium for bacterial cultures.
Single-distilled water was used for media, as well as for gels and running buffers;
double-distilled water was used for all other buffers and solutions.
2. TMN: 50 mM Tris-HCl, pH 7.8, 10 mM MgCl2 , 100 mM NH4 Cl.
3. Buffer A: 20 mM Tris-HCl, pH 7.5, 10 mM MgCl2 , 1 M NH4 Cl, 10% glycerol,
6 mM -mercaptoethanol. Buffer B: 20 mM Tris-HCl, pH 7.5, 10 mM MgCl2 ,
Fig. 1. In vitro RNA transcripts representing the peptidyl transferase loop of 23S
rRNA. The structures are based on the E. coli 23S rRNA sequence, although the
majority of nucleotide positions are highly conserved and thus identical in most bacteria
(43). Helices 73, 74, 89, and 90 have been shortened in the in vitro transcripts, and
the missing sequences have been replaced with stable tetraloops (except for helix 89).
The 3´- and 5´-ends of the structures are positioned in helix 89; this ensures that helix
73 will be stably formed and maintain the structure at the target nucleotide A2058. In
structure B, helices 73 and 89 have been shortened further, and the tetraloop capping
helix 74 has been altered to give a unique RNase T1 fragment containing the A2058
target (AAAG). Testing with Erm(E) and Erm(N) shows that RNA structures such as
these, which contain the complete peptidyl transferase loop and most of helix 73, are
methylated as efficiently as intact 23S rRNA.
6 mM -mercaptoethanol. Buffer C: 20 mM Tris-HCl, pH 7.5, 10 mM MgCl2 ,

100 mM NH4 Cl, 10% glycerol, 6 mM -mercaptoethanol.
4. Sodium dodecyl sulphate (SDS) gels were used to check the size and purity of
the Erm methyltransferase. The stacking gel was 4% and the separation gel 12%
polyacrylamide (19:1 acrylamide: bis-acrylamide, electrophoresis grade); protein
bands were stained with Coumassie Blue.
5. T7 RNA polymerase (Promega), RNAguard (Amersham), and enzymes for DNA
manipulations (New England Biolabs) were used according to the suppliers’
recommendations. Buffers were obtained from the enzyme suppliers.
6. TSC buffer (5X concentrated): 200 mM Tris-HCl, pH 7.9, 30 mM MgCl2 , 50 mM
dithiothreitol, 20 mM spermidine.
7. NTP mix: 2.5 mM each of ATP, GTP, UTP, and CTP, pH 7.5.
8. Phenol was distilled and equilibrated with water; stored at –20 °C.
9. Gels for checking RNA transcripts were 10% polyacrylamide (19:1 acrylamide:
bis-acrylamide, electrophoresis grade) containing 90 mM Tris-borate, pH 8.3,
and 1 mM EDTA. Samples were loaded with 1/5 volume of 10% Ficoll 400
containing 0.05% xylene cyanol and 0.05% bromophenol blue marker dyes. After
electrophoresis, gels were stained by soaking for 1 h in 5% acetic acid containing

0.1% toluidine blue, and then destained in 5% acetic acid.
10. RNase A was from Sigma-Aldrich, and RNase T1 was from US Biochemicals.
11. 3-Hydroxypicolinic acid (3-HPA; from Sigma-Aldrich) was dissolved in a 1:1
mixture of HPLC-grade acetonitrile and HPLC-grade water to a concentration of
0.5 M. As well as being used for MALDI matrix preparation, the 3-HPA solution
also serves as an excellent RNA denaturing agent for the RNase digestion steps.
12. Poros 50R3 chromatography resin (Applied Biosystems) was suspended in HPLC-
grade methanol to approximately 0.2 g/mL.
13. Triethylammonium acetate solution (used at 1 M concentration, pH 7.0) was from
Merck.
14. Dowex AG 50W-X8 cation exchange material (acid form) was from BioRad. The
material was converted to its ammonium form by five repeated incubations with
two volumes of 10 M ammonium acetate, followed by five repeats of washing with
two volumes of HPLC-grade water. The cation exchange material was resuspended
in approximately two volumes of HPLC-grade water.
3. Methods
3.1. Preparation of Erm(E) Methyltransferase
1. Add 0.5 mL of an overnight culture of E. coli cells harboring a plasmid such as
pJEK47 encoding erm(E) (see Notes 1 and 2) to 200 mL of LB broth, containing
100 μg/mL of ampicillin, in a 1 L flask. Shake at 100 rpm in incubator at 37 °C,
and measure the optical density (A450 ) every 30 min. Draw a semi-log curve to
follow the cell growth. Place the cells on ice when they reach an A450 of 0.4. All
the buffers, tubes, and centrifuge rotors should be between 0 °C and 4 °C for the
rest of this section.
2. Harvest the cells by centrifugation at 10,000X g for 10 min in a Beckman JA14 rotor,
or equivalent. Carefully pour off the supernatant. Wash the cells by resuspending
in 200 mL of cold TMN buffer and repeating the centrifugation step. Pour off the
supernatant, and resuspend the cells in 20 mL of TMN buffer. Transfer the cell
suspension to suitably sized polyethylene tubes (JA20 tubes) on ice.
3. The cell walls are lyzed by sonication, keeping the tube on ice. Wear gloves and
ear protection; rinse the sonicator probe with ethanol, and dry before and after
use. Sonicate with four bursts at approximately 150 W for 30 s (with a 30-s pause
between each burst, or longer if the probe begins to heat up).
4. The cell debris is removed by centrifuging at 30,000X g for 10 min. Transfer
the supernatant, containing ribosomes and the Erm(E) methyltransferase, to fresh,
cold JA20 tubes. Centrifuge again, to remove any remains of cell walls and cell
membranes, and transfer the supernatant to cold Ti50 ultracentrifuge tubes. Fill and
balance tubes with cold TMN buffer, and centrifuge at 100,000X g for 3 h at 4
°C in an ultracentrifuge. This, and the following, ultracentrifugation step can be
carried out at 20,000X g overnight if the timing is more convenient (see Note 3).
5. Pour off the supernatant. Keep the tubes on ice while redissolving the ribosome
pellets by gentle pipetting in 2.5 mL of buffer A. Allow to stand on ice between 2
and 5 h to wash off the methyltransferase.
6. Centrifuge at 100,000X g for 3 h at 4 °C in Ti50 ultracentrifuge tubes. The ribosomes
will pellet leaving the methyltransferase in the supernatant. Collect the supernatant
and transfer to a dialysis tube. Seal the tube, excluding air. Dialyze against 200 mL
of buffer B in a cold room (4 °C) with stirring; change the buffer every hour (four
times in all).
7. Transfer the dialyzed supernatant to Eppendorf tubes. Pellet the methyltransferase
by spinning at full speed in an Eppendorf centrifuge (15, 0000 to 20, 000 rpm) for
20 min at 4 °C. Remove the supernatant, keep 15 μL for SDS gel analysis, and
discard the rest. Gently redissolve each pellet in 50 μL of buffer C (see Note 3).
Take out a total of 15 μL for SDS gel analysis for size (see Note 2) and purity (see
Note 4). The rest of the methyltransferase can be stored at –20 °C.
3.2. Transcription of RNA Methylation Substrate

1. The DNA templates for transcription of the RNA methylation substrates (Fig. 1)
have been assembled from oligodeoxynucleotides, which have then been cloned into
a pGEM plasmid after a T7 RNA polymerase promoter. A restriction site sequence
(in this case BamHI) has been incorporated at the 3´-end of the template sequence
to facilitate run-off transcription.
2. Double-stranded plasmid DNA containing one of these sequences (Fig. 1) is
prepared by standard methods. To 10 μg plasmid DNA in an Eppendorf tube add:
10 μL of 10X Bam HI digestion buffer; H2 O to bring the total volume to 100 μL;
and 10 U of BamHI enzyme. Leave overnight at 37 °C in a warm air incubator.
3. Add 200 μL of 0.25 M sodium acetate followed by 750 μL 96% ethanol. Leave in
a –20 °C freezer for 1 h. Spin at full speed in an Eppendorf centrifuge (15, 0000 to
20, 0000 rpm) for 20 min at 4 °C. Remove supernatant and wash pellet with 100
μL 70% ethanol. Remove supernatant, dry pellet, and redissolve in 50 μL of H2 O
(see Note 5). Check 1 μL of the restricted DNA on a 1% agarose gel alongside 0.1
to 0.2 μg of the uncut DNA.
4. For the T7 transcription reaction, add the following to an Eppendorf tube: 20 μL of
5X TSC buffer; 25 μL of NTP mix; 49 μL of BamHI-cut DNA; 50 U (2.5 μL) of
T7 RNA polymerase; and 100 U (3.2 μL) of RNA guard. Incubate at 37 °C for at
least 2 h (see Note 6). Stop the transcription by adding 200 μL of H2 O and 300 μL
of phenol; vortex 30 s. Recover the RNA by centrifuging the phenol mixture for
1 min and taking the aqueous (upper) phase to a fresh tube. Repeat the extraction
procedure with 300 μL of phenol/chloroform (1:1, vol:vol) and then with 300 μL
of chloroform.
5. Add 0.1 volume of 2.5 M sodium acetate followed by 2.5 volumes of ethanol to
the recovered aqueous phase. Leave in the –20 °C freezer for at least 1 h. Spin
at full speed in an Eppendorf centrifuge (15, 0000 to 20, 0000 rpm) for 20 min
at 4 °C. Remove supernatant and wash the pellet with 100 μL of 70% ethanol.
Remove supernatant, dry the pellet, and redissolve in 50 μL of H2 O (see Note
5). The transcript can be checked by running 1 μL on a 10% polyacrylamide gel
alongside RNA markers to give a rough estimation of the transcript concentration
and size. Stain the gel with toluidine blue after the gel run.
3.3. Methylation of RNA by Erm(E)

1. Each methylation reaction contains 5 μL of the RNA transcript, 24 μL of buffer C
containing 1 mM S-adenosylmethionine (AdoMet), and 1 μL of Erm(E). Incubate
for 45 min at 30 °C (see Notes 7 and 8).
2. Reactions are stopped by extraction with 1 volume of phenol, then 1 volume of
phenol/chloroform, and finally 1 volume of chloroform (as described in Step 4 of
Section 3.2). Precipitate the RNA, wash the pellet with ethanol, and redissolve in 6
μL of H2 O as described in Step 5 of Section 3.2.
3. The RNA samples are now ready for analysis by MALDI mass spectrometry (see
Note 9).
3.4. Analysis of Methylation by MALDI Mass Spectrometry

1. The methylated RNA substrates are to be digested with RNase A or RNase T1 to
produce oligonucleotides of a size suitable for MALDI mass spectrometry analysis
(see Note 10). Samples of rRNA (2.5 pmol) are mixed with 0.5 μL of 3-HPA (0.5 M
in 50% acetonitrile), 0.1 μg of RNase A, or 10 units of RNase T1 (see Note 11)
and H2 O to a final volume of 5 μL and are digested for 2.5 h at 37 °C.
2. Purify the digested fragments on Poros 50R3 columns (see Note 12) as follows:
A GelLoader tip (Eppendorf) is flattened at the tip of the extended outlet with
forceps, reducing the inner diameter to less than 50 μm. 50 μL of methanol are
filled into the GelLoader tip, and 1 μL of the precipitate of Poros 50R3 material
in methanol is added. Mount the GelLoader tip onto a 1-mL syringe, and press the
methanol through to form a column. The column is washed once with 50 μL of
methanol and equilibrated by adding 50 μL of 10 mM triethyl ammonium acetate
(TEAA), pH 7.0. Load the RNA digestion in 0.3 M TEAA onto the microcolumn,
and wash with 50 μL of 10 mM TEAA and elute with 10 μL of 10 mM TEAA/25%
acetonitrile (see Note 13). Dry the eluate and dissolve in water to 1–2 pmol/μL.
3. Prepare samples for MALDI mass spectrometry by mixing on the target 1 μL of the
purified RNA digest, 0.5 μL of 3-HPA matrix (see Note 14), and a small volume
(∼0.1 μL) of the ammonium-loaded cation exchange material. Leave to air-dry, and
remove as much cation exchange material as possible under a microscope using a
pipette tip. Sample preparation for MALDI tandem mass spectrometry is performed
the same way.
4. The oligonucleotides are analyzed using a Voyager STR MALDI mass spectrometer
(Applied Biosystems) in delayed extraction reflector time-of-flight mode detecting
positive ions (see Note 15). Spectra can be smoothed and calibrated using the Data
Explorer software supplied with the mass spectrometer (see Note 16).
5. The exact nucleotide position of a modification can be located by tandem mass
spectrometry (23). This can be carried out on a MicroMass MALDI Q-TOF Ultima
mass spectrometer in positive ion mode (see Note 17). Generally, the window for
parent ion selection is set at 2 m/z units, and the collision energy varies between
40 and 100 eV, depending on the mass of the parent ion. When required, spectra
can be smoothed and calibrated using the MassLynx software supplied by the
manufacturer.
4. Notes
1. The entire erm(E) gene from Saccharopolyspora erythraea, the producer of the
macrolide antibiotic erythromycin, has been cloned into R1-derivative plasmids
such as pJEK47 (21) and pJEK48 (33). These plasmids are suitable for expression
of large amounts of active Erm(E) in E. coli.
2. With its overall length of 385 amino acids, Erm(E) is significantly longer than most
other members of the Erm family. Alignments with other Erm methyltransferases
(24,27) show that they are generally 10 to 35 amino acids shorter at their N-termini
and approximately 90 amino acids shorter at their C-termini. In one recombinant
version of Erm(E), expressed from plasmid pSDdiv (26), we removed the C-
terminal 89 amino acids and added a histidine-tag without any apparent loss of
methylation activity (see Note 4).
3. The Erm(E) methyltransferase associates with ribosomes under low- to moderate-
salt conditions (here, up to 100 mM NH4 Cl) and is released by washing with a
high-salt buffer (buffer A with 1 M NH4 Cl) (20,21). The solubility of Erm(E) is
reduced in the absence of monovalent ions (buffer B), but the enzyme becomes
readily soluble again on increasing the salt concentration (buffer C).
4. Fairly high Erm(E) purity (about 80%) is achieved by this procedure. A higher
purity (>95%) can be obtained on Ni-NTA resin (Qiagen) after a histidine-tag has
been added to the C-terminal of Erm(E). The activity of Erm(E) and other orthologs
we have tried, such as Erm(N), remain unaffected by a C-terminal histidine-tag.
However, we observed a reduction in Erm(E) activity with N-terminal tags (34).
5. It is important not to excessively dry nucleic acid pellets, as they can be difficult
to redissolve. DNA and RNA pellets are best dried by removing all visible traces
of 70% ethanol using a micropipette and then leaving the tubes with the lids open
on the bench at ambient temperature for 30 min to allow any remain traces of
ethanol to evaporate.
6. Slightly higher yields of in vitro transcripts can be obtained by extending the
incubation up to a maximum of 16 h (overnight). Longer times yield diminishing
returns, probably due to RNA breakdown.
7. As discussed in the Introduction, members of the Erm family are either mono- or
dimethyltransferases, and addition of two methyl groups to the A2058 target by
the latter type confers the more severe resistance phenotype. All Erm methyltrans-
ferases have but a single AdoMet binding site, and thus dimethylation proceeds in
a two-step manner (35) requiring recharging of the enzyme with a new cofactor
molecule. Under both in vivo and in vitro conditions, Erm(E) is an extremely
effective dimethyltransferase adding the second methyl group very rapidly, and it
is rare that we find a trace of the monomethylated RNA intermediate. Other Erm
dimethyltransferases we have studied, including the streptococcal Erm(B) (36) and
the mycobacterial Erm(38) (37), are distinctly less efficient at adding the second
methyl group to A2058. The effects of Erm dimethyltransferase inhibitors might
first become evident as an accumulation of monomethylated product. In Fig. 2, we
have used a recombinant version of the monomethyltransferases Erm(N) (histidine-
tagged at the C-terminus; see Note 4) to demonstrate MALDI-MS detection of the
monomethylated product.
8. Potential methyltransferase inhibitors can be added in buffer C, while maintaining
the total volume reaction at 30 μL of buffer C. It will be necessary to stop
reactions at a series of time points if IC50 values of potential inhibitors are to be
estimated.
9. A rapid and accurate estimate of A2058 dimethylation can be obtained by primer
extension with reverse transcriptase (21). Primer extension requires appreciably
less RNA than MALDI mass spectrometry (about 10% the amount) but has the
disadvantage that it cannot detect monomethylation at the N6 of A2058.
10. Masses of the RNase digestion fragments can be calculated using the Mongo
Oligo Mass Calculator (http://www-medlib.med.utah.edu/masspec/mongo.htm).
Digestion products smaller than trinucleotides are unsuited for MALDI time-of-
flight mass spectrometry, because the lower m/z range is crowded with numerous
signals including those from the matrix and buffers (31).
11. The RNase T1 digestion products will predominantly harbor 2´-3´ cyclic
phosphates under the conditions described here. Increasing the digestion time or
enzyme concentration will result in a greater proportion of digestion products with
a 3´-phosphate (31); these are heavier by 18.01 Da (monoisotopic mass).
12. Commercial cartridges ready-packed with reverse-phase chromatography material
are available from various suppliers including Waters (ZipTip cartridges) and
Proxeon (StageTip cartridges).
13. Size fractionation of digestion fragments can be obtained by stepwise elution with
increasing concentrations of acetonitrile (38); all the fragments (Figure 2B and
2C) will be eluted by 25% acetonitrile.
14. Other matrices that yield higher sensitivity and/or resolution have been reported
for oligonucleotide analysis by MALDI mass spectrometry (39,40). However, we
prefer the 3-HPA matrix for this type of application, because it discriminates less
between digestion fragments, i.e., nearly all fragments are detected regardless of
their nucleotide composition or sequence.
15. The resolution of the delayed extraction, reflector time-of-flight mass analyzer
is required to resolve the approximately 1 Da mass difference between U- and
C-nucleotides. The instrument may also be operated in negative ion mode with
(a)
(b) RNase A MH+ Sequence

fragment
115-117 982.16 AAC
16-18 999.14 GAU
53-55 999.14 AGU
123-125 999.14 GAU
8-10 1014.15 GGC
22-24 1014.15 GGC
28-30 1014.15 GGC
86-88 1014.15 GGC
58-60 1015.14 GGU
1-3 1255.04 pppGGU
118-121 1343.21 AGGC
129-132 1344.19 GGAU
32-35 1360.19 GGGU
74-77 1360.19 GGGU
38-42 1656.26 AGAAC
89-93 1656.26 AAGAC
48-52 1672.26 GAGAC
94-101 2675.41 GGAAAGAC
105-114 3366.49 GAAAGGGGAU
Fig. 2. (continued)
(c) RNase T1 MH+ Sequence

fragments
116-118 879.17 AUC-OH
17-19 975.13 UCG
27-29 975.13 CUG
41-43 975.13 UCG
79-81 998.16 ACG
14-16 999.14 AUG
52-55 1281.16 UUCG
37-40 1327.21 AACG
48-51 1327.21 ACAG
75-78 1327.21 CAAG
83-86 1351.22 AAAG
21-25 1586.20 CUUCG
32-36 1611.19 UUUAG
67-72 1891.24 CCUUCG
7-13 2219.31 CACCUCG
108-114 2242.34 CACACCG
100-106 2291.34 AUAACAG
87-95 2853.40 ACCCCUACG
57-66 3137.38 UCCCUAUCUG
Fig. 2. (a) MALDI mass spectrum of fragments derived from RNase A digestion
of structure A (Fig. 1). The fragment containing the A2058 target nucleotide
(GGAAAGAC) runs at m/z 2675.40 (monoisotopic mass; see expanded region in box,
and Note 18). Detection of a single methyl group is illustrated by the new signal 14
Da larger that appears in samples treated with the monomethyltransferase Erm(N);
the methylation reaction with Erm(N) was stopped before it had run to completion.
(b) Theoretical monoisotopic masses of the singly protonated RNase A fragments match
the empirical masses to within 0.1 Da (see Note 10). All digestion fragments have
5´-OH and 3´-phosphate unless otherwise noted. The 94-101 fragment (italics) corre-
sponds to the 23S rRNA nucleotides 2056 to 2063 and harbors the Erm target at A2058.
(c) Theoretical monoisotopic masses of the singly protonated RNase T1 fragments
derived from structure B (Fig. 1). The AAAG fragment at 83-86 (italics) corresponds
to 23S rRNA nucleotides 2058 to 2061. This fragment is unique in structure B (but not
in structure A) and gives a better resolved and more intense MS peak than the larger
RNase A fragment containing nucleotide A2058.
similar or even better sensitivity, but instrument stability may be compromised by

ion polarity switching if the ion source is contaminated.
16. We first perform an external calibration using appropriate oligodeoxynucleotides;
this generally decreases the mass error below 0.5 Da. An internal calibration of
the spectrum is subsequently performed using RNase digestion fragments, which
are not modified by the methyltransferase.
17. Descriptions of the fragmentation behavior of singly protonated RNA in a MALDI
Q-TOF instrument can be found in (41). The predominant sequence ions are of the
c- and y-type; for the nomenclature of nucleic acid fragment ions, see McLuckey
et al. (42).
18. The natural isotopic distribution of 12 C and 13 C (approximately 99:1) leads to
multiple signals at 1 Da increments, and this is visible upon closer inspection
of the MS peaks. The multiplicity is more pronounced for larger oligonucleotide
fragments due to the binomial distribution of the carbon isotopes.
Acknowledgments
We thank Birte Vester and Lykke Haastrup Hansen for discussions. Support
from the Danish Research Agency (FNU Grants #21-04-0505 and #21-04-
0520), the Nucleic Acid Center of the Danish Grundforskningsfond, and CDC
funds are gratefully acknowledged.
References
1.
1 Gale, E. F., Cundliffe, E., Reynolds, P. E., Richmond, M. H., and Waring, M. J.
(1981) The Molecular Basis of Antibiotic Action. John Wiley and Sons, London.
2.
2 Vázquez, D. (1979) Inhibitors of Protein Biosynthesis. Springer-Verlag, Berlin.
3.
3 Poehlsgaard, J., and Douthwaite, S. (2005) The bacterial ribosome as a target for
antibiotics. Nat. Rev. Microbiol. 3, 870–881.
4.
4 Cundliffe, E. (1990) Recognition sites for antibiotics within rRNA. In The
Ribosome: Structure, Function and Evolution (W. E. Hill, A. Dahlberg, R. A.
Garrett, P. B. Moore, D. Schlessinger, and J. R.Warner, eds.). American Society
for Microbiology, Washington DC, pp. 479–490,
5.
5 Green, R., and Noller, H. F. (1997) Ribosomes and translation. Ann. Rev. Biochem.
66, 679–716.
6.
6 Nissen, P., Hansen, J., Ban, N., Moore, P. B., and Steitz, T. A. (2000) The structural
basis of ribosome activity in peptide bond synthesis. Science 289, 920–930.
7.
7 Gregory, S. T., and Dahlberg, A. E. (1999) Erythromycin resistance mutations in
ribosomal proteins L22 and L4 perturb the higher order structure of 23S ribosomal
RNA. J. Mol. Biol. 289, 827–834.
8.
8 Gabashvili, I. S., Gregory, S. T., Valle, M., Grassucci, R., Worbs, M., Wahl, M. C.,
Dahlberg, A. E., and Frank, J. (2001) The polypeptide tunnel system in the
ribosome and its gating in erythromycin resistance mutants of L4 and L22. Mol.
Cell 8, 181–188.
9.
9 Vester, B., and Douthwaite, S. (2001) Macrolide resistance conferred by base
substitutions in 23S rRNA. Antimicrob. Agents Chemother. 45, 1–12.
10.
10 Douthwaite, S., Fourmy, D., and Yoshizawa, S. (2005) Nucleotide methylations in
rRNA that confer resistance to ribosome-targeting antibiotics. In Fine-Tuning of
RNA Functions by Modification and Editing (H. Grosjean, ed.), Vol. 12. Springer,
New York, pp. 287–309.
11.
11 Kagan, R. M., and Clarke, S. (1994) Widespread occurrence of three motifs in
diverse S-adenosylmethionine-dependent methyltransferases suggests a common
structure for these enzymes. Arch. Biochem. Biophys. 310, 417–427.
12.
12 Schubert, H. L., Blumenthal, R. M., and Cheng, X. (2003) Many paths to methyl-
transfer: A chronicle of convergence. Trends Biochem. Sci. 28, 329–335.
13.
13 Skeggs, P. A., Thompson, J., and Cundliffe, E. (1985) Methylation of 16S
ribosomal RNA and resistance to aminoglycoside antibiotics in clones of Strepto-
myces lividans carrying DNA from Streptomyces tenjimariensis. Mol. Gen. Genet.
200, 415–421.
14.
14 Thompson, J., Skeggs, P. A., and Cundliffe, E. (1985) Methylation of 16S
ribosomal RNA and resistance to the aminoglycoside antibiotics gentamicin and
kanamycin determined by DNA from the gentamicin-producer, Micromonospora
purpurea. Mol. Gen. Genet. 201, 168–173.
15.
15 Wimberly, B. T., Brodersen, D. E., Clemons, W. M. J., Morgan-Warren, R. J.,
Carter, A. P., Vonrhein, C., Hartsch, T., and Ramakrishnan, V. (2000) Structure
of the 30S ribosomal subunit. Nature 407, 327–339.
16.
16 Schlünzen, F., Tocilj, A., Zarivach, R., Harms, J., Gluehmann, M., Janell, D.,
Bashan, A., Bartels, H., Agmon, I., Franceschi, F., and Yonath, A. (2000) Structure
of functionally activated small ribosomal subunit at 3.3 Angstroms resolution. Cell
102, 615–623.
17.
17 Liu, M., Kirpekar, F., van Wezel, G. P., and Douthwaite, S. (2000) The tylosin
resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that
targets G748 in 23S rRNA. Mol. Microbiol. 37, 811–820.
18.
18 Thompson, J., Schmidt, F., and Cundliffe, E. (1982) Site of action of a
ribosomal RNA methylase conferring resistance to thiostrepton. J. Biol. Chem. 257,
7915–7917.
19.
19 Bechthold, A., and Floss, H. G. (1994) Overexpression of the thiostrepton-
resistance gene from Streptomyces azureus in Escherichia coli and characterization
of recognition sites of the 23S rRNA A1067 2’-methyltransferase in the guanosine
triphosphatase center of 23S ribosomal RNA. Eur. J. Biochem. 224, 431–437.
20.
20 Skinner, R., Cundliffe, E., and Schmidt, F. J. (1983) Site of action of a ribosomal
RNA methylase responsible for resistance to erythromycin and other antibiotics.
J. Biol. Chem. 258, 12702–12706.
21.
21 Vester, B., and Douthwaite, S. (1994) Domain V of 23S rRNA contains all the
structural elements necessary for recognition by the ErmE methyltransferase. J.
Bacteriol. 176, 6999–7004.
22.
22 Mann, P. A., Xiong, L., Mankin, A. S., Chau, A. S., Mendrick, C. A.,
Najarian, D. J., Cramer, C. A., Loebenberg, D., Coates, E., Murgolo, N. J.,
Aarestrup, F. M., Goering, R. V., Black, T. A., Hare, R. S., and McNicholas, P. M.
(2001) EmtA, a rRNA methyltransferase conferring high-level evernimicin resis-
tance. Mol. Microbiol. 41, 1349–1356.
23.
23 Treede, I., Jakobsen, L., Kirpekar, F., Vester, B., Weitnauer, G. A. B., and
Douthwaite, S. (2003) The avilamycin resistance determinants AviRa and AviRb
methylate 23S rRNA at the guanosine 2535 base and the uridine 2479 ribose. Mol.
Microbiol. 49, 309–318.
24.
24 Weisblum, B. (1995) Erythromycin resistance by ribosome modification.
25.
25 Zalacain, M., and Cundliffe, E. (1990) Methylation of 23S ribosomal RNA due to
carB, an antibiotic-resistance determinant from the carbomycin producer, Strepto-
myces thermotolerans. Eur. J. Biochem. 189, 67–72.
26.
26 Liu, M., and Douthwaite, S. (2002) Activity of the ketolide antibiotic telithromycin
is refractory to Erm monomethylation of bacterial rRNA. Antimicrob. Agents
Chemother. 46, 1629–1633.
27.
27 Roberts, M. C., Sutcliffe, J., Courvalin, P., Jensen, L. B., Rood, J., and Seppälä,
H. (1999) Nomenclature for macrolide and macrolide-lincomycin-streptogramin B
resistance determinants. Antimicrob. Agents Chemother. 43, 2823–2830.
28.
28 Champney, W. S., Chittum, H. S., and Tober, C. L. (2003) A 50S ribosomal subunit
precursor particle is a substrate for the ErmC methyltransferase in Staphylococcus
aureus cells. Curr. Microbiol. 46, 453–460.
29.
29 Vester, B., Nielsen, A. K., Hansen, L. H., and Douthwaite, S. (1998) ErmE
methyltransferase recognition elements in RNA substrates. J. Mol. Biol. 282,
255–264.
30.
30 Kovalic, D., Giannattasio, R. B., Jin, H. J., and Weisblum, B. (1994) 23S rRNA
domain V, a fragment that can be specifically methylated in vitro by the ErmSF
(TlrA) methyltransferase. J. Bacteriol. 176, 6992–6998.
31.
31 Kirpekar, F., Douthwaite, S., and Roepstorff, P. (2000) Mapping posttranscrip-
tional modifications in 5S ribosomal RNA by MALDI mass spectrometry. RNA 6,
296–306.
32. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning:
32
A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor,
New York.
33.
33 Vester, B., Hansen, L. H., and Douthwaite, S. (1995) The conformation of 23S
rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase.
RNA 1, 501–509.
34.
34 Vilsen, I. D., Vester, B., and Douthwaite, S. (1999) ErmE methyltransferase rocog-
nizes features of the primary and secondary structure in a motif within domain V
of 23S rRNA. J. Mol. Biol. 286, 365–374.
35.
35 Denoya, C., and Dubnau, D. (1989) Mono- and dimethylating activities and kinetic
studies of the ermC 23 S rRNA methyltransferase. J. Biol. Chem. 264, 2615–2624.
36.
36 Douthwaite, S., Jalava, J., and Jakobsen, L. (2005) Ketolide resistance in Strepto-
coccus pyogenes correlates with the degree of rRNA dimethylation by Erm. Mol.
Microbiol. 58, 613–622.
37.
37 Madsen, C. T., Jakobsen, L., and Douthwaite, S. (2005) Mycobacterium smegmatis
Erm(38) is a reluctant dimethyltransferase. Antimicrob. Agents Chemother. 49,
3803–3809.
38.
38 Mengel-Jorgensen, J., Jensen, S. S., Rasmussen, A., Poehlsgaard, J., Iversen, J. J.,
and Kirpekar, F. (2006) Modifications in Thermus thermophilus 23S ribosomal
RNA are centered in regions of RNA-RNA contact. J. Biol. Chem. 281, 22108–
22117.
39.
39 Asara, J. M., and Allison, J. (1999) Enhanced detection of oligonucleotides in UV
MALDI MS using the tetraamine spermine as a matrix additive. Anal. Chem. 71,
2866–2870.
40.
40 Zhu, Y. F., Chung, C. N., Taranenko, N. I., Allman, S. L., Martin, S. A.,
Haff, L., and Chen, C. H. (1996) The study of 2,3,4-trihydroxyacetophenone and
2,4,6-trihydroxyacetophenone as matrices for DNA detection in matrix-assisted
laser desorption/ionization time-of-flight mass spectrometry. Rapid Comm. Mass
Spectrom. 10, 383–388.
41.
41 Kirpekar, F., and Krogh, T. N. (2001) RNA fragmentation studied in a matrix-
assisted laser desorption/ionisation tandem quadrupole/orthogonal time-of-flight
mass spectrometer. Rapid Comm. Mass Spectrom. 15, 8–14.
42.
42 McLuckey, S. A., Van Berkel, G. J., and Glish, G. L. (1992) Tandem mass
spectrometry of small multiply charged oligonucleotides. J. Amer. Soc. Mass
Spectrom. 3, 60–70.
43.
43 Cannone, J. J., Subramanian, S., Schnare, M. N., Collett, J. R., D’Souza, L. M.,
Du, Y., Feng, B., Lin, N., Madabusi, L. V., Müller, K. M., Pande, N., Shang, Z.,
Yu, N., and Gutell, R. R. (2002) The Comparative RNA Web (CRW) Site: An
online database of comparative sequence and structure information for ribosomal,
intron, and other RNAs. BMC Bioinformatics 3, 2.
19
Assays for -Lactamase Activity and Inhibition
Thammaiah Viswanatha, Laura Marrone, Valerie Goodfellow,

and Gary I. Dmitrienko
Summary
The ability, either innate or acquired, to produce -lactamases, enzymes capable of
hydrolyzing the endocyclic peptide bond in -lactam antibiotics, would appear to be a primary
contributor to the ever-increasing incidences of resistance to this class of antibiotics. To date,
four distinct classes, A, B, C, and D, of -lactamases have been identified. Of these, enzymes in
classes A, C, and D utilize a serine residue as a nucleophile in their catalytic mechanism while
class B members are Zn2+ -dependent for their function. Efforts have been and still continue to
be made toward the development of potent inhibitors of these enzymes as a means to ensure the
efficacy of -lactam antibiotics in clinical medicine. This chapter concerns procedures for the
evaluation of the catalytic activity of -lactamases as a means to screen compounds for their
inhibitory potency.
Key Words: -lactam antibiotics; -lactamases; antibiotic resistance; chromogenic

substrates; -lactamase inhibitors; penicillins; cephalosporins; carbapenems.
1. Introduction
-Lactam antibiotics constitute a major class of chemotherapeutic agents
currently employed in the treatment of diseases of bacterial origin. This
family of antibiotics comprises penicillins and cephalosporins, derived from
6-aminopenicillanic acid (6APA) and 7-aminocephalosporanic acid, respec-
tively, as well as oxacephems, carbapenems, and monobactams. Structures of
some of these -lactam antibiotics are shown in Fig. 1.
Innate features of oral bioavailability, low toxicity, and high efficacy have
contributed to the widespread use of these antibiotics in clinical medicine.

239
240 T. Viswanatha et al.
O O
N N
H H H H H H
N N Cl N
S Me S Me S Me
O O O
N Me N Me N Me
O O O
CO2 CO2 CO2
Penicllin G Oxacillin Cloxacillin
(Penam) (Penam) (Penam)
H O
OH OH
H HN H
Me NH2 Me NMe2
+
S S NH2
N N +
O O
CO2 CO2
Imipenem Meropenem
(Carbapenem) (Carbapenem)
S H OMe H H OMe H
N N
S HO O
Me
O O
N O NH2 N S N
O O N
CO2 O CO2 N N
Cefoxitin Moxalactam
(Cephamycin) (7-α-methoxy oxacephem)
N OMe CO2
H2N N H H3C
H CH3
N
S S
O O
N N
N H2N N
O O
CO2 Me Aztreonam
Cefepime S CH3
HN (Monobactam)
(Cephalosporin)
N
O SO3
Fig. 1. Some clinically important -lactam antibiotics.
Such extensive use, often overuse or abuse, of penicillins and cephalosporins

in chemotherapy has led to the development of bacterial resistance to -lactam
antibiotics. This phenomenon has been and continues to be the topic of intense
investigation in recent years (1–4).
In general, microorganisms have been found to gain antibiotic resistance by
the use of either one or a combination of the following strategies (5,6): (1)
extrusion of the drug by means of an active transmembrane efflux system;
(2) acquisition of tolerance to the antibiotic via subtle mutation(s) in the gene
encoding for the target protein; (3) production of one or more enzymes capable
of deactivating the antibiotic; and (4) rendering the cell less permeable or
impermeable to the antibiotic by the loss of porins or channels required for
Assays for -Lactamase Activity and Inhibition 241
its entry. Of these mechanisms, the production of enzymes, viz. -lactamases,

happens to be the most commonly encountered and hence the most signif-
icant contributor to the emergence of bacterial resistance to -lactam antibi-
otics (7–9). Furthermore, the promiscuous transfer of the genetic information
encoding for the production of -lactamases, not only among the members
within a group but also among the diverse genera of microorganisms, via inher-
ently mobile elements such as plasmids or transposons, appears to be a major
contributor to the ever-increasing incidences of bacterial resistance to -lactam
antibiotics.
In light of the above-noted rapid spread of microbial resistance to -lactam
antibiotics, strategies to circumvent the adverse action of -lactamase(s) have
been and still continue to be developed. These include (1) development of
-lactam antibiotic analogues resistant to the action of -lactamase(s), e.g.,
carbapenems, such as imipenem and meropenem (10), and monobactams, such
as aztreonam (11), and (2) production of -lactamase inhibitor(s) which could
be co-administered with the -lactam antibiotic in clinical medicine, e.g.,
clavulanic acid (12), sulbactam (13), and tazobactam (14) (structures given
in Fig. 2).
According to the currently accepted classification, -lactamases fall into four
distinct classes, viz., A, B, C, and D, respectively (15). Of these, the members
of classes A, C, and D utilize an active-site serine residue as a nucleophile
in their catalytic mechanism involving an acyl-enzyme intermediate akin to
that noted in the case of serine proteases (16). The class B -lactamases, in
contrast, are metalloproteins with Zn2+ present in their active sites and are
often referred to as MBLs (metallo--lactamases). A further division of the
MBLs into three subclasses (B1, B2, and B3) has been proposed and is widely
accepted (17). The MBLs isolated to date have two distinct Zn2+ binding sites.
The class B3 MBLs are carbapenemases that occur in various Aeromonas
species. They function with only one zinc ion in the active site and, in fact,
appear to be inhibited by zinc binding to the second binding site (18–20). Most
H H O2 H O2
O OH S S N
N N
N N N
O O O
CO2H CO2H CO2H
calvulanic acid sulbactam tazobactam
Fig. 2. Clinically important -lactamase inhibitors.

of the class B1 and class B2 MBLs appear to be capable of functioning as

either dizinc or monozinc enzymes, and there has been considerable debate
concerning the active-site stoichiometry with respect to zinc under physiological
conditions (20). The very interesting and clinically important SPM-1 (Sao Paulo
metallo-ß-lactamase) appears to fall somewhere in between the B1 and B2
classifications and is the least effective of the B1 and B2 MBLS at binding
the second zinc ion to its active site (21). Active-site metal ion replacement
has been achieved under a number of conditions (22,23) and, in some cases
(e.g., Zn2+ → Co2+ ), has yielded a catalytically competent enzyme (23). As
in the cases of other metallo-proteases, the catalytic mechanism of class B
-lactamases does not involve an acyl-enzyme intermediate in the reaction
pathway (20,24).
1.1. The Principles Underlying -Lactamase Assay Methods

-lactamases catalyze the hydrolysis of penicillins and cephalosporins, as
shown in Fig. 3.The assay procedures for the measurement of -lactamase
activity are based on the consequences of the hydrolysis of the amide bond of
the substrate.
Both direct and indirect assay procedures have been developed for the
assessment of -lactamase activity. The latter methods exploit some of the
innate features of the reaction product; these include (1) its ability to function
O
O
R NH
R NH H2O O S
S
β-lactamase + H
N O HN
O
CO2 CO2
penicillin (antibiotic) penicilloic acid (devoid of antibiotic activity)
O
O H
N S H2 O R NH
R O S
N X β-lactamase + H
O O HN X
CO2
CO2
cephalosporin (antibiotic) cephalosporoic acid (devoid of antibiotic activity)
Fig. 3. Hydrolysis of -lactam antibiotics.

as an acid by virtue of the newly formed carboxylic acid function (see Fig. 3).
This aspect has provided the basis for such assay techniques as (a) alkali-metric
titration with the aid of a pH-stat (25), (b) acidimetric analysis involving the
use of an indicator such as phenol red or bromocresol purple (26), and (c)
manometric assay procedure (27); (2) its ability to function as a reducing agent
and thus forming the basis for iodometric analytical procedures (28,29); and (3)
the absence of antibiotic activity, the basis for the development of biological
assay techniques (30,31). The protocols and the related details of these proce-
dures have been documented (32). The relative merits of some of these methods
have been assessed (33).
The direct methods, on the other hand, exploit the difference between the
substrate and its product with regard to their UV-visible spectra. The -
lactamase catalyzed reaction is usually monitored by following the change
in absorbance at the wavelength where the difference in the molar absorp-
tivity, M , is maximal or near the maximum value. This approach, which
was initially employed to monitor the -lactamase catalyzed hydrolysis of
cephalosporins (34), has been extended to studies with penicillins as substrates
(35,36). The introduction of chromogenic -lactam substrates such as nitro-
cefin (37), CENTA (38), mCPP (39), PADAC (40), and FAP (6--furylacry-
loylamidopenicillanic acid) (41) has allowed for spectrophotometric assays to
be performed in the visible spectral region, a feature that allows for circum-
S H H
H H H
N N
S Me S
NO2
O O
N N
Me O
O
CO2 CO2
Nitrocefin NO2
Penicllin G
S S NH
H H H H H H O O
N N
S S
O O O
N N N S
O O
CO2 N CO2
PADAC N CENTA NO2 CO2
CO2
Depsipeptide Substrate
N
H3C CH3
Fig. 4. Useful substrates for -lactamase assays. mCPP, 1-(3-chlorophenyl)piper-

azine; PADAC, pyridine-2-azo-p-dimethylanaline cephalosporin.
venting the problems arising from the high absorbance of most of the substrates
in the UV spectral region. The structures of these substrates are shown
in Fig. 4.
2. Materials
2.1. Buffers
1. 100 mM of acetate, pH 4.5–5.5.
2. 50 mM of phosphate, pH 6.0–7.5.
3. 50 mM of HEPES (N-(2-hydroxyethyl)piperazine-N´-2-ethane sulfonic acid), pH
6.0–7.5.
4. AMT buffer system (42): 50 mM of acetic acid, 50 mM of MES (2-(N-morpholino)-
ethane sulfonic acid), and 100 mM of Tris (tris(hydroxymethyl)aminomethane), pH
4.5–9.0 (see Note 1).
2.2. Substrates
The chromophoric -lactams, nitrocefin (37) and CENTA (38), are the
substrates of choice by virtue of their attractive features that allow for a rapid
and reliable spectrophotometric assay procedure for monitoring the activity of
-lactamases. The particulars regarding the use of nitrocefin, the most widely
used substrate, are provided below:
1. Nitrocefin: A stock solution (2 mM) is prepared by dissolving 10.3 mg of nitrocefin
in 0.5 mL of DMSO (dimethyl sulfoxide) and subsequently adding 25 mM HEPES
buffer, pH 7.3, or other desired buffer to a final volume of 10 mL. This nitrocefin
stock solution (DMSO 5% v/v) is stable for several weeks when stored at 4 °C.
2. CENTA: A stock solution (1 mM) is prepared by dissolving 5.4 mg in 10 mL of 25
mM HEPES, pH 7.3, or other desired buffer. This CENTA stock solution is stable
for several days when stored at 4 °C.
3. Benzyl penicillin (Pen G): In instances when Pen G is used as a substrate, a
stock solution (10 mM) of this substrate is prepared by dissolving 37 mg of
benzyl penicillin (potassium salt) in 10 mL of the desired buffer (see Note 2).
Despite the drawback of requiring the use of low-wavelength measurements, assays
employing Pen G do have the advantage of low cost and still find significant use in
this area.
2.3. Enzyme
-lactamase (stock) solutions (0.4–1.0 μM) can be stored at –20 °C without
adverse effect on the catalytic activity of the protein (see Note 3). However,
they are prone to inactivation when subjected to repeated freezing and thawing.
To circumvent this problem, it is recommended that the stock solutions of the

protein be stored in small (10–20 μL) aliquots and that the remnant of the
aliquot be discarded after its use in the desired experiment.
-Lactamases are marked with very high catalytic efficiency. Consequently,
it is essential to determine, by preliminary experiments, the range in which
a linear relationship prevails between the initial rate of reaction and the final
concentration of the enzyme in the assay. An enzyme concentration, within a
range that allows for an accurate measurement of the initial rate during the
progress of the reaction, is to be chosen.
2.3.1. Production and Purification of -Lactamases
1. Purification of IMP-1 as reported (43). An overnight culture of Echerichia coli
BL21 (DE3) pLysS transformed with pCIP4 in 5 mL of LB containing 50 μg/mL of
kanamycin served as the inoculant for LB medium (500 mL) containing 50 μg/mL
of kanamycin, and the culture was incubated at 37 °C, shaking at 200 rpm. At
mid-late log phase of culture growth (Abs600 = 0.6–0.8), production of IMP-1 was
induced by the introduction of 1 mM IPTG, and growth was allowed to proceed as
before for a period of 2–3 h.
2. The cells were collected by centrifugation (6000X g) prior to washing with 50 mM
of HEPES buffer, pH 7.3.
3. Cell lysis was achieved by four cycles of freezing and thawing and subsequently
treated with DNase and RNase (1 mg of each). Unbroken cells and cell debris were
removed by centrifugation (300,000× g), and the supernatant fraction served as a
source for IMP-1.
4. Following the addition of ZnSO4 (10 μM), the supernatant was subjected to
chromatography on S-Sepharose FF matrix ( Amersham Biosciences) using a 2 ×
10-cm column, equilibrated with 50 mM of HEPES buffer, pH 7.3. After washing
the column with 3 × 25 mL of equilibrating buffer, proteins bound to the column
were eluted with a linear increasing gradient of NaCl in equilibration buffer.
5. Fractions containing -lactamase activity (monitored by nitrocefin hydrolysis) were
pooled and dialyzed against 50 mM of HEPES buffer, pH 7.3.
6. The dialyzed material was subsequently applied onto the second cation exchange
column, POROS S-20 (Perceptive System) equilibrated with 50 mM of HEPES
buffer, pH 7.3. After washing the column with the equilibrating buffer, IMP-1 was
eluted with the same buffer containing an increasing concentration of NaCl (0–300
mM). Fractions (5 mL) were collected and assessed for the presence of protein
(A280nm ) and -lactamase activity with nitrocefin as substrate. The protein recovered
by this procedure was found to be homogeneous by SDS-PAGE.
7. Literature references for the procedures for the production and purification of other
representative members of the four classes of -lactamases are summarized in
Table 1.
Table 1
Published Procedures for the Isolation and Purification of Some
Representative -Lactamases
-lactamase Class Enzyme * Reference
A BcI, 44
TEM-1 45
B IMP-1 43
BcII 44
CcrA 46
VIM-2 47
L1 48
C P99 49
D Oxa 10 50
BcI, Bacillus cereus 569H (type I); TEM, class A -lactamases named after the
patient (Temoneira) providing the first sample; in the early literature also termed
RTEM or R-TEM to emphasize its R plasmid origin; IMP-1, plasmid-encoded
class B -lactamases active on imipenem. Pseudomonas aeruginosa 101/477 (most
common in Japan); BcII, Bacillus cereus 569H (type II); CcrA, Bacteriodes fragilis
TAL636 (Cefoxitin and carbapenem resistant); VIM 1, Verona integron-encoded
metallo--lactamase. Pseudomonas aeruginosa VR-143/97 (most common in Taiwan,
Verona; L1, Labile enzyme from Stenotrophomonas (Pseudomonas, Xanthomonas)
maltophilia; P99, chromosomal -lactamase from Enterobacter cloacae P99; Oxa 10,
class D -lactamases active on oxacillin (Acinetobacter species).
2.4. Automated and Semi-automated Procedures for the Assessment

of -Lactamase Activity
1. Reagents: 2 mM of nitrocefin, 10.3 mg of nitrocefin is dissolved in 500 μL DMSO
and subsequently diluted to 10 mL by the addition of 50 mM of HEPES, pH 7.3.
2. -lactamase: Metallo--lactamase (4 nM) prepared by the dilution of enzyme
stock (400 nM) in 50 mM of HEPES, pH 7.3.
3. OXA--lactamase (3–5 nM) of enzyme in 100 mM of phosphate, pH 7.0,
containing 25 mM of NaHCO3 .
4. Classes A and C -lactamases (3–5 nM) in 100 mM of phosphate, pH 7.0.
5. 25 mM of HEPES, pH 7.3.
6. 100 mM of phosphate, pH 7.0, containing 25 mM of NaHCO3 (see Note 4).
7. 96-well polystyrene microtitre plates (Costar).
8. Plate reader (Molecular Dynamics, Spectramax 190).
9. Eppendorf multichannel dispenser.
10. Softmax Pro 3.0 for recording rates (total time of recording, 3 min; interval
reading, 6 s; and the rate is estimated from the linear increase in absorbance values
between 20 and 60 s. The total absorbance change is less than 1.0 OD in order to
ensure compliance with Beer’s law.
11. Grafit 4.0 for IC50 determination.
3. Methods
As noted in Section 1, -lactamases, identified to date, fall into four distinct
categories, classes A, B, C, and D. The requirement(s) for the optimal expression
of catalytic function, as is to be expected, may depend on the class of -lactamase
under investigation. Information concerning such specific requirement(s) is
provided in the sections pertaining to the assay procedures for the different
types of -lactamases. Given below are the details of items that are common
to all the procedures regardless of the class or type of enzymes under study.
3.1. Classes A, C, and D -Lactamases

1. Substrate: 2 mM of nitrocefin stock solution in 50 mM of HEPES, pH 7.3, 10 mM
of benzyl penicillin stock in 50 mM HEPES, pH 7.3, or the desired buffer with 25
mM sodium bicarbonate being present in the assays for class D enzymes.
2. Enzyme: -lactamase stock solution (0.4–1.0 μM) diluted with the assay buffer to
achieve the desired concentration in the reaction mixture.
3. Spectrophotometric assay procedure:
a. Nitrocefin substrate:
The enzyme in 950 μL of 50 mM HEPES, pH 7.3, is transferred to a cuvette
(10-mm path length) and placed in the sample compartment of the spectropho-
tometer and allowed to equilibrate at 30 °C for 1 min. The reaction is initiated
by the introduction of an aliquot (50 μL) of nitrocefin stock, and the reaction’s
progress is monitored by recording the absorbance at 482 nM. The concentra-
tions of nitrocefin and the enzyme, in the reaction mixture of final volume of 1
mL, are 100 μM and 2–4 nM, respectively.
b. CENTA substrate:
Similar experimental conditions apply when CENTA replaces nitrocefin as the
substrate. The reaction can be monitored by following the change in absorbance
either at 346 nM (accompanying the hydrolysis of the substrate) or at 405 nM
(arising from the elimination of the 2-nitrothiobenzoate chromaphore from the
hydrolytic product, cephalosphoroic acid). In the latter procedure based on an
increase of absorbance at 405 nM, the reaction should be performed in buffer
media of pH >7.0 to ensure the nitro-thiobenzoic acid moiety is in its fully
dissociated state. Although CENTA would appear to be a preferable substrate by
virtue of its ready solubility in aqueous media (a feature that obviates the need
for a cosolvent such as DMSO in the assay), its lower affinity (reflected in high
Km -values) for many class B -lactamases (38), relative to that of nitrocefin,
demands its presence at a relatively high concentration (mM range) to ensure

substrate saturation conditions in the assay.
c. Benzyl penicillin substrate:
The stock solution of the substrate is diluted 10-fold with the buffer (same
buffer as in the stock solution) to achieve a final concentration of 1 mM. In a
typical assay, 1 mL of the substrate is transferred to each of the two cuvettes,
which are subsequently placed in the reference and sample compartments of
a double-beam spectrophotometer. Following equilibration at 30 °C for 1 min,
the reaction is initiated by the introduction of an aliquot of the enzyme to the
substrate in the reference compartment. The reaction’s progress was monitored
by recording the increase in absorbance at 232 nm. The final concentration of
the substrate and the enzyme in the reaction mixture of total volume of 1 mL
are 1 mM and 2–4 nM, respectively.
3.2. Assessment of the Potency and the Mechanism of Action

of Inhibitors
In the studies with the inhibitors, the procedure is similar to that described above
except for the inclusion, in the assay, of the compound to be tested for its potency
as an inhibitor of the -lactamase. The protocols to be observed in the experiments
designed to evaluate the potency of -lactamase inhibitors have been elegantly
addressed in a review (51). These studies are performed under conditions of both
with and without prior incubation of the enzyme and the inhibitor.
In the latter instance, the inhibitor is introduced into the substrate solution,
and the reaction is initiated by the addition of the enzyme. In experiments
involving preincubation, the enzyme (0.5–1.0 mL; 0.4–1.0 μM) in an appro-
priate buffer is treated with the compound (1–10 mM) to be tested for inhibitory
potency and allowed to incubate at 30 °C. Appropriate aliquots, drawn at
desired intervals, are used to assess the enzyme’s catalytic activity with nitro-
cefin, benzyl penicillin, or CENTA as substrates, with the final volume of the
reaction mixture being 1 mL as outlined above.
Estimates of the steady-state kinetic parameters (kcat and KM ) for the
hydrolysis of the substrate are achieved by fitting the initial velocity data to the
Michaelis–Menten equation with the software package, Grafit 4.0 (Erithacus
Software Ltd, Stains, UK). The inhibition constant, Ki , is assessed by Dixon’s
procedure (52). A Cornish–Bowden plot (53) of the resulting data is used to
establish the mode of inhibition.
A M -value of 15,900 M−1 cm−1 at 482 nm for nitrocefin hydrolysis (54)
and a M -value of 1,100 M−1 cm−1 for benzyl penicillin hydrolysis (55) are
used for the calculation of kcat -values. In the case of CENTA, the following
M -values are used: –2,500 M−1 cm−1 and +6,400 M−1 cm−1 at 346 nm and
405 nm, respectively (see Note 5).
3.3. Slow-Binding Inhibitors

In the case of some inhibitors, when assays are performed by preincubation
of the inhibitor with the enzyme, with aliquots being removed for assay as
described above, the steady-state rate of hydrolysis may be slow to be attained,
as indicated by a lag phase in the rate profile. In each case, the quotient
vi /vs (where vi and vs represent the initial and steady-state rates of substrate
hydrolysis, respectively) provides a quantitative measure of the lag observed.
This situation is encountered in the case of slow-binding inhibitors. The inter-
action of some thiols with IMP-1 provides an example of this phenomenon
(54) (Fig. 5). In these instances, estimates of kinetic parameters are achieved
from the steady-state data.
Fig. 5. Thiols as classical and slow-binding inhibitors of IMP-1. Influence of mercap-

toacetic acid and benzylmercaptan on the enzymatic activity of IMP-1. All assays
were performed in 50 mM Hepes, pH 7.3, at 25 °C with nitrocefin (0.2 mM) as a
substrate and IMP-1 (0.8 nM). The progress of nitrocefin hydrolysis was monitored at
482 nm: (1) control with no mercaptan present and (2) in the presence of mercaptoac-
cetic acid (10 μM). The profile is the same whether the enzyme is preincubated with
mercaproacetic acid or exposed to it in the presence of substrate. (3) The enzyme was
preincubated with benzylmercaptan (10 μM) for 1 min prior to addition of substrate.
(4) The enzyme was exposed to benzylmercaptan (10 μM) in the presence of substrate.
(Reprinted from (54) with permission from the American Chemical Society.)
3.4. Mechanism-Based Inhibitors

The class of antagonists referred to as “suicide” or “mechanism-based”
reagents is recognized by the enzyme as potential substrates but results in
inhibition or inactivation of the enzyme as a consequence of a shift in the normal
reaction pathway with the concomitant generation of a highly potent inhibitory
species. The characteristics of the “suicide” inhibitors are (1) time dependence
of inactivation, (2) the inactivation being proportional to inhibitor concentration
at low inhibitor concentrations but independent at high concentrations, and (3)
a decrease in the rate of inactivation with an increase in substrate concentration.
The latter two kinetic phenomena, saturation kinetics and substrate protection,
demonstrate that the inactivation process involves the enzyme’s active site
(56). The mechanism of action of the mechanism-based inhibitors of class A
-lactamases has been the topic of an elegant review (1).
3.5. Assay Procedure for Mechanism-Based Inhibitors

A solution of the enzyme (0.3–1.0 μM) in 0.5 mL of appropriate buffer
is incubated at 25 °C with the compound (1.0–10 mM) to be tested for the
inhibitory potency to achieve the desired molar excess over that of the enzyme.
Aliquots (5–10 μL) of the reaction mixture are removed at various intervals
and assayed for enzymatic activity with either nitrocefin or benzyl penicillin, as
outlined earlier. An enzyme sample incubated under the conditions mentioned
above, but for the exclusion of the inhibitor, is used as a control in these studies.
The amount of the inhibitor required to effect total inactivation of the enzyme
is estimated by extrapolation of the percent residual activity after prolonged
incubation (2–3 h) versus the ratio of the molar excess of the inhibitor over
that of the enzyme.
The procedures for the assay of class C and class D -lactamases are similar
to those used in the case of class A enzymes. The assays of class D enzyme
are performed in buffer media containing 25 mM of NaHCO3 because of the
need to ensure the maintenance of the essential carbamate group in the active
site of the enzyme.
3.6. Class B -Lactamases

1. Reagents: 2 mM of nitrocefin containing stock DMSO (5% v/v), -lactamase (400
nM) containing 100 μM of ZnCl2 , and 100 μg/mL of bovine serum albumin (BSA)
(see Note 6).
2. Spectrophotometric assay procedure: An aliquot (950 μL) of -lactamase in 50 mM
HEPES, pH 7.3, was introduced to a cuvette (10-mm-pathlength) in the sample
compartment of the spectrophotometer and allowed to equilibrate at 30 °C for 1 min.
The reaction was initiated by the addition of an aliquot (50 μL) of nitrocefin stock.
The final concentrations of the substrate, enzyme, and BSA, in a reaction mixture
of 1 mL, were 100 μM, 4 nM, and 1 μg/mL, respectively (see Note 6). The progress
of the reaction was monitored by recording the increase in the absorbance at 482
nm. Estimates of the steady-state kinetic parameters (KM and kcat ) for the hydrolysis
of the substrate are achieved by fitting the initial velocity data to the Michaelis–
Menten equation with the aid of Grafit 4.0 (Erithacus Software Ltd, Stains, UK).
A M -value of 15,900 M−1 cm−1 at 482 nm for nitrocefin hydrolysis (54) is used
for the determination of the kcat -value.
3.7. Inhibition by Chelators

Class B -lactamases, like other metalloenzymes, are susceptible to inhibition
by chelators. The inhibition can ensue as a consequence of either the interaction
of the chelator with the metal ion subsequent to its release from the protein
matrix (SN 1 type of mechanism) or while it is still associated with the protein
(SN 2-type mechanism) as indicated below (57):
E Zn + C E Zn C E + Zn C or E∗ Zn C
where E:Zn represents the holoenzyme, C, the chelator, E:Zn:C, the

enzyme:zinc:chelator ternary complex, Zn:C, the zinc:chelator complex,
E*:Zn:C, the inactive enzyme:zinc:chelator complex, KI , the concentration of
the inhibitor for half-maximal inhibition, and kinact , the first-order rate constant
for inactivation. Dixon plots (52), which depict the relationship between the
reciprocal activity and the inhibitor concentration, are used to determine the
type of inhibition exerted by the chelator. If the inhibition is reversible, the
relationship is linear, while it is nonlinear if the process is irreversible.
A linear plot of log enzyme activity versus time provides the basis for
the determination of t1/2 (time required to effect 50% inhibition of the initial
activity) value. Similar experiments are performed at different chelator concen-
trations and t1/2 value in each case recorded. A plot of t1/2 versus 1/[C], the
reciprocal of the chelator concentration according to the procedure of Kitz and
Wilson (58) and Silverman (59) is used to estimate Ki and kinact .
The interaction of metallo--lactamase, IMP-1, with a variety of commonly
used chelators (structures shown below) depicted in Figs. 6 and 7 serves as
a typical example of this type of investigation. In these studies, the enzyme,
IMP-1, in 50 mM of HEPES, pH 7.3, containing 100 μg/m of BSA was
incubated with the chelator at the desired concentration (0–200 mM) for 30 min
at 25 °C prior to the determination of catalytic activity with nitrocefin as the
substrate (60).
Fig. 6. Common metal chelators. (a) Structures of DPA (dipicolinic acid); (b) OP (o-
phenanthroline); (c) PAR (4-(2-pyridylazo)resorcinol); (d) EDTA (ethylenediaminete-
traacetic acid); (e) TPEN (N,N,N ,N -tetrakis(2-pyridylmethyl)ethylenediamine); (f) and
Zincon. (Reprinted from (60) with permission from Elsevier.)
Fig. 7. Inactivation of IMP-1 by various Zn2+ chelators. Inactivation of IMP-1 by

various Zn2+ chelators. The enzyme (4 nM) in Hepes containing BSA (0.1 mg/ml) was
incubated with the chelator at the desired concentration (0–0.2 mM) for 30 min at 25 jC
and subsequently assayed for activity with nitrocefin as substrate. In the case of Zincon,
the reaction was monitored at 525 nm (instead of 482 nm) in order to minimize inter-
ference due to the absorbance of the chelator. For clarity of presentation, inhibition curves
(Dixon plots) for DPA and OP are shown in the inset of the figure, while that for PAR was
omitted, since it closely resembles the curve obtained with TPEN. •, TPEN; , EDTA;
, Zincon. Inset: •, DPA; , OP. (Reprinted from (60) with permission from Elsevier.)
3.8. Automated and Semi-automated Procedures for the Assessment

of -Lactamase Activity
The spectrophotometric methods outlined above permit an accurate
assessment of the kinetic parameters of the -lactamase catalyzed hydrolysis of
its substrates and of the IC50 (concentration of inhibitor needed to effect 50%
inhibition of the enzyme’s initial catalytic activity) when an inhibitor is included
in the assay. However, these procedures are time-consuming, labor-intensive,
and uneconomical in view of the requirement of relatively large amounts of the
reaction ingredients in the multiple assays needed to be performed to assess
the enzyme’s kinetic parameters.
Hence, the introduction of a semi-automated technique or procedure that
allows for a rapid and reliable means for the assessment of both the substrate
profiles of -lactamase as well as for the evaluation of the potency of its
inhibitors is indeed a significant development (61). Given below are the details
of an automated assay method, adapted in our laboratory, for the screening of
-lactamase inhibitors, using the chromogenic substrate nitrocefin (37).
Assays are performed in microtiter plates (of 96 wells) with a final reaction
volume of 100 μL. In the procedure used in our laboratory, the eight wells of
column 1 (of the microtiter plate) are used for pretreatment of the enzyme prior
to its exposure to the substrate. Thus, in the microtiter plate, wells A and B
are used for control 1 (no DMSO) and control 2 (with DMSO), and wells C to
H are used for incubation of the enzyme with the compound assessed for its
inhibitory potency at six different concentrations. The ingredients in control 1,
control 2, and test samples are given below (Table 2) (see Note 7).
Aliquots (10 μL) of nitrocefin stock are placed in each of the wells in columns
2 and 3 of the microtiter plate. Following incubation for 10 min at 25 °C, 90-μL
aliquots from each of the wells in the first column are rapidly transferred with the
aid of a multichannel dispenser to the corresponding wells in columns 2 and 3,
and the microtiter plate is placed in the Plate Reader. After mixing, the initial rate
of the reaction in each well is recorded (at 6-s intervals) between 20 and 60 s at
Table 2
Ingredients in Control and Test
Reagent Control 1 Control 2 Test
Buffer: 50 mM HEPES, pH 7.3 10 μL 8 μL 8 μL

DMSO — 2 μL —
Enzyme 190 μL 190 μL 190 μL
Inhibitor (in DMSO) — — 2 μL
482 nm. The average of the two determinations (from the reactions in the corre-
sponding wells in the columns 2 and 3 of the microtiter plate) is used to determine
percent activity relative to the rate in control 2 (see Note 7). IC50 values can be
determined by fitting each inhibition data set to the IC50 -2 parameter equation of
Grafit 4.0 (Erithacus Software Ltd., Staines, UK) by nonlinear regression analysis.
3.9. New Directions

Although the focus of this article is the discussion of practical and proven
methodologies for assaying -lactamase activity, it is worth noting that new
approaches continue to be discovered. One very new development involves the
Hydrophilic
group O
HN
S
N S
O
Hydrophobic,
CO2 potential
gelation agent
β−lactamase
Hydrophilic
group O
HN HS
S
Hydrophobic,
Activated
N +
gelation agent
O
O
CO2
Self assembly
H2O
Hydrogel formation
Fig. 8. A -lactamase assay based on triggering supramolecular hydrogelation.

design of -lactamase substrates that, upon hydrolysis of the -lactam bond,

release a gelation agent that self-assembles in such a way that water molecules
are incorporated into the assembled supramolecular hydrogel scaffold. It is
reported that the gelation process is readily visible to the naked eye even
in the presence of colored impurities that might interfere with other assay
methods (62). Although this method is too new to have been adopted widely
in -lactamase research, it represents a very imaginative and promising new
direction in this field. Figure 8 illustrates this assay approach.
4. Notes
1. This buffer system provides a constant ionic strength of ∼0.1 over the pH range
of 4.5–9.0 and is useful in pH optimum determinations. It is pertinent to note the
following limitation(s) of the medium. MES can exert inhibitory action on class B
-lactamases, as in the CcrA (63), although no adverse effect was observed in the
case of IMP-1 (54). And Tris, the third component of the buffer system, being a
good nucleophile at high pH, may interfere in the assay procedures of class A, C,
and D -lactamases, which operate via an acylenzyme intermediate in their catalytic
mechanism (64).
2. Pen G solutions at pH ≥ 6.0 are prone to undergo hydrolysis even when stored at
4 °C. The hydrolysis of Pen G is accompanied by a M -value of -1100 M−1 cm−1 at
232 nm. The deviation from this value in the assay is a reflection of the breakdown
of the substrate during storage. Substrate preparations standing for more than 1 h
at 4 °C should be replaced by freshly prepared stock solutions.
3. In the case of metallo--lactamases, stock solutions of the enzyme are prepared in
buffer medium (other than phosphate) containing 100 μM of ZnCl2 and 100 μg/mL
of BSA to minimize the denaturation of the protein.
4. The pH of the buffer increases upon standing due to loss of the bicarbonate. Buffer
is to be replaced by a fresh preparation after 4–6 h.
5. In the case of CENTA as substrate, the reaction can be monitored either at 346
nm or at 405 nm. The increase in the absorbance at 405 nm accompanying the
hydrolysis of CENTA is due to the formation of 2-nitrothiobenzoate (NTB− ) anion,
an outcome of the propensity of the primary product of the reaction to undergo the
relevant elimination event. The M -values of 6,400 M−1 cm−1 (38) and ≈8,000
M−1 cm−1 (65) reported in the studies with CENTA as substrate are considerably
lower than the M -values reported (66,67).
6. BSA at the concentration present in the enzyme stock protects the enzyme from
denaturation. At the concentration present in the reaction mixture, it does not
interfere with the catalytic function of -lactamase but, by its protective action,
ensures the reaction’s progress is linear with time.
7. Some DMSO preparations have been found to exert strong inhibitory action even
when present at a concentration as low as 1% (v/v) in the reaction mixture. DMSO
preparations should be checked for this feature, and only those without such adverse
effects should be chosen for use in the studies and kept under argon at 4 °C. In these
studies, a DMSO preparation with no such adverse effect (the difference between
the activity in control 1 and that in control 2 does not exceed 10%) is used.
References
1 Knowles, J. R. (1985) Penicillin resistance—The chemistry of -lactamase
1.
inhibition. Acc. Chem. Res. 18, 97–104.
2.
2 Livermore, D. M., and Wooford, N. (2006) The -lactamase threat in Enterobac-
teriacae, Pseudomonas and Acinetobacter. Trends Microbiol. 9, 413–420.
3.
3 Payne, D. J., Du, W., and Bateson, J. H. (2000) -Lactamase epidemiology and
the utility of established and novel -lactamase inhibitors. Expert Opin. Invest.
Drugs 9, 247–261.
4.
4 Fisher, J. F., Meroueh, S. O., and Mobashery, S. (2005) Bacterial resistance to -
lactam antibiotics: Compelling opportunism, compelling opportunity. Chem. Rev.
105, 395–424.
5.
5 Walsh, C. (2000) Molecular mechanisms that confer antibacterial drug resistance.
Nature 406, 775–781.
6.
6 Martinez, J. L., and Baquero, F. (2000) Mutation frequencies and antibiotic resis-
tance. Antimicrob. Agents Chemother. 44, 1771–1777.
7.
7 Helfand, M. S., and Bonomo, R. A. (2003) -lactamases: A survey of protein
diversity. Curr. Drug Targets-Infect. Disord. 3, 9–23.
8.
8 Matagne, A., Dubos, A., Galleni, M., and Frère, J. M. (1999) The -lactamase
cycle: A tale of selective pressure and bacterial ingenuity. Nat. Prod. Rep. 16,
1–19.
9.
9 Page, M. I., and Laws, A. P. (1998) The mechanism of catalysis and the inhibition
of -lactamases. Chem. Comm. 16, 1609–1617.
10.
10 Rasmussen, B. A., and Bush, K. (1997) Carbapenem-hydrolyzing -lactamases.
11.
11 Sykes, R. B., Bonner, D. P., Bush, K., and Georgopapadakou, N. H. (1982)
Aztreonam (SQ.26,776) a synthetic monobactam specifically active against Gram-
negative bacteria, Antimicrob. Agents Chemother. 21, 85–92.
12.
12 Fisher, J., Charnas, R., and Knowles, J. R. (1978) Kinetic studies on the inacti-
vation of Escherichia coli RTEM -lactamase by clavulanic acid. Biochemistry 17,
2180–2184.
13.
13 English, A. R., Retsema, J. A., Girard, A. E., Lynch, J. E., and Barth, W. E. (1978)
CP-45,899, a -lactamase inhibitor that extends the antibacterial spectrum of -
lactams: Initial bacteriological characterization. Antimicrob. Agents Chemother.
14, 414–419.
14.
14 Micetich, R. G., Maiti, S. N., Spevak, P., Hall, T. W., Yamabe, S., Ishida, N.,
Tanaka, M., Yamazaki, T., Nakai, A., and Ogawa, K. (1987) Synthesis and
-lactamase inhibitory properties of 2-[(1,2,3-triazol-1-yl)]-2a-methylpenam-3a-

carboxylic acid 1,1-dioxide and related triazolyl derivatives. J. Med. Chem. 30,
1469–1474.
15.
15 Ambler, R. P. (1980) The structure of -lactamases. Philos. Trans. R. Soc.
London, B, Biol. Sci. 289, 321–331.
16.
16 Ghuysen, J. M. (1991) Serine -lactamases and penicillin-binding proteins. Ann.
Rev. Microbiol. 45, 37–67.
17.
17 Galleni, M., Lamotte-Brasseur, J., Rossolini, G. M., Spencer, J., Dideberg, O.,
and Frère, J. M. (2001). Standard numbering scheme for class B -lactamases.
18.
18 Hernandez-Valladares, M., Felici, A., Weber, G., Adolph, H. W., Zeppezauer, M.,
Rossilini, G. M., Amicosante, G., Frère, J. M., and Galleni, M. (1997) Zn(II)
dependence of the Aeromonas hydrophila AE036 metallo--lactamase activity and
stability. Biochemistry 36, 11534–11541.
19.
19 Sharma, N. P., Hajdin, C., Chandrasekar, S., Bennett, B., Yang, K.-W., and
Crowder, M. W. (2006) Mechanistic studies on the mononuclear ZnII -containing
metallo--lactamase ImiS from Aeromonas sobria. Biochemistry 45, 10729–10738.
20.
20 Crowder, M. W., Spencer, J., and Vila, A. J. (2006) Metallo--lactamases: Novel
weaponry for antibiotic resistance in bacteria. Acc. Chem. Res. 39, 721–728.
21.
21 Murphy, T. A., Catto, L. E., Halford, S. E., Hadfield, A. T., Minor, W.,
Walsh, T. R., and Spencer, J. (2006) Crystal structure of Pseudomonas aeruginosa
SPM-1 provides insights into variable zinc affinity of metallo--lactamases. J.
Mol. Biol. 357, 890–903.
22.
22 Siemann, S., Badiei, H. R., Karanassios, V., Viswanatha, T., and Dmitrienko, G. I.
(2006) 68 Zn isotope exchange experiments reveal an unusual kinetic lability of
the metal ions in the di-zinc form of IMP-1 metallo--lactamase. Chem. Comm.,
532–534.
23.
23 Badarau, A., Damblon, C., and Page, M. I. (2007) The activity of dinuclear
cobalt--lactamase from Bacillus cereus in catalysing the hydrolysis of -lactams.
Biochem. J. 401, 197–203.
24.
24 Wang, Z., Fast, W., Valentine, A. M., and Benkovic, S. J. (1999) Metallo--
lactamase: Structure and mechanism. Curr. Opin. Chem. Biol. 3, 614–622.
25.
25 Hou, J. P., and Poole, J. W. (1972) Measurement of -lactamase activity and rate
of inactivation of penicillins by a pH-stat alkalimetric titration method. J. Pharm.
Sci. 61, 1594–1598.
26.
26 Saz, A. K., Lowery, D. L., and Jackson, L. J. (1961) Staphyloccocal penicillinase:
Inhibition and stimulation of activity. J. Bacteriol. 82, 298–304.
27.
27 Henry, R. J., and Housewright, R. D. (1947) Studies on penicillinase: II.
Manometric method of assaying penicillinase and penicillin, kinetics of the
penicillin-penicillinase reaction, and the effects of inhibitors on penicillinase. J.
Biol. Chem. 167, 559–571.
28.
28 Grove, D. C., and Randall, W. A. (1955) Assay methods of antibiotics. A laboratory
manual Medical Encyclopedia, New York, p. 16.
29.
29 Perret, C. J. (1954) Iodometric assay of penicillinase. Nature, 174, 1012–1013.
30.
30 Masuda, G. (1976) Studies on bactericidal activities of -lactam antibiotics on
agar plates: The correlation with the antibacterial activities determined by the
conventional methods. J. Antibiot. 29, 1237–1240.
31.
31 McGhie, D., Clarke, P. D., Johnson, T., and Hutchison, J. G. P. (1977) Detection
of -lactamase activity of Haemophilus influenzae. J. Clin. Path. 30, 585–587.
32. Sykes, R. B., and Mathew, M. (1979) Detection and immunology of -lactamases.
32
In -Lactamases (J. M. T. Hamilton-Smith and J. T. Smith, eds.). Academic Press
Ltd., London, pp. 17–49.
33.
33 Lucas, T. J. (1979) An evaluation of 12 methods for the demonstration of penicil-
linase. J. Clin. Pathol. 32, 1061–1065.
34.
34 O’Callaghan, C. H., Muggleton, P. W., and Ross, G. W. (1968) Effects of
-lactamase from gram-negative organisms on cephalosporins and penicillins.
35.
35 Samuni, A. (1975) A direct spectrophotometric assay and determination of
Michaelis constants for the -lactamase reaction. Anal. Biochem. 63, 17–26.
36.
36 Waley, S. G. (1974) A spectrophotometric assay of -lactamase action on
penicillins. Biochem. J. 139, 789–790.
37. O’Callaghan, C. H., Morris, A., Kirby, S., and Shingler, A. H. (1972) Novel method
37
for detection of -lactamases by using a chromogenic cephalosporin substrate.
38.
38 Bebrone, C., Moali, C. Mahy, F., Rival, S., Docquier, J. D., Rossolini, G. M.,
Fastrez, J., Pratt, R. F., Frère, J. M., and Galleni, M. (2001) CENTA as a
chromogenic substrate for studying -lactamases. Antimicrob. Agents Chemother.
45, 1868–1871.
39.
39 Perumal, S. K., and Pratt, R. F. (2006) Synthesis and evaluation of ketophosph
(on)ates as -lactamase inhibitors. J. Org. Chem. 71, 4778–4785.
40.
40 Jones, R. N., Wilson, H. W., and Novick, W. J. Jr. (1982) In vitro evaluation
of pyridine-2-azo-p-dimethylaniline cephalosporin, a new diagnostic chromogenic
reagent, and comparison with nitrocefin, cephacetrile, and other -lactam
compounds. J. Clin. Microbiol. 15, 677–683.
41.
41 Durkin, J. P., Dmitrienko, G. I., and Viswanatha, T. (1977) N-(2-Furyl) acryloyl
penicillin: A novel compound for the spectrophotometric assay of -lactamase I.
J. Antibiot. 30, 883–885.
42.
42 Ellis, K. J., and Morrison, J. F. (1982) Buffers of constant ionic strength for
studying pH dependent processes. Methods Enzymol. 87, 405–426.
43.
43 Laraki, N., Franceschini,N., Rossolini,G. M., Santucci,P., Meunier, C., de
Pauw, E., Amicosante,G., Frère, J. M., and Galleni, M. (1999) Biochemical charac-
terization of the Pseudomonas aeruginosa 101/1477 metallo-ß-lactamase IMP-1
produced by Escherichia coli. Antimicrob. Agents Chemother. 43(4), 902–906.
44.
44 Kuwabara, S. (1970) Purification and properties of two extracellular -lactamases
from Bacillus cereus 569/H. Biochem. J. 118, 457–465.
45.
45 Mathonet, P., Deherve, J., Soumillion, P., and Fastrez, J. (2006) Active TEM-1
mutants with random peptides inserted in three contiguous surface loops. Protein
Sci. 15, 2323–2334.
46.
46 Toney, J. H., Wu, J. K., Overbye, K. M., Thompson, C. M., and Pompliano, D. L.
(1997) High-yield expression, purification, and characterization of active, soluble
Bacteroides fragilis metallo-beta-lactamase, CcrA. Protein Expr. Purification 9(3),
355–362.
47.
47 Poirel, L., Naas,T., Nicolas,D., Collet,L., Bellais,S., Cavallo,J.-D., and
Nordmann, P. (2000) Characterization of VIM-2, a carbapenem-hydrolyzing
metallo-beta-lactamase and its plasmid- and integron-borne gene from a
Pseudomonas aeruginosa clinical isolate in France. Antimicrob. Agents Chemother.
44(4), 891–897.
48.
48 Crowder, M. W., Walsh, T. R., Banovic, L., Pettit, M., and Spencer, J.
(1998) Overexpression, purification, and characterization of the cloned metallo--
lactamase L1 from Stenotrophomonas maltophilia. Antimicrob. Agents Chemother.
42(4), 921–926.
49.
49 Goward, C. R., Stevens, G. B., Hammond, P. M., and Scawen, M. D. (1988) Large-
scale purification of the chromosomal ß-lactamase from Enterobacter cloacae P99.
J. Chromat. 457, 317–324.
50.
50 Maveyraud, L., Golemi-Kotra, D., Ishiwata, A., Meroueh, O., Mobashery, S., and
Samama, J.-P. (2002) High-resolution X-ray structure of an acyl-enzyme species
for the class D OXA-10 -lactamase. J. Amer. Chem. Soc. 124(11), 2461–2465.
51.
51 Bush, K., and Sykes, R. B. (1986) Methodology for the study of -lactamases.
52.
52 Dixon, M. (1953) The determination of enzyme inhibitor constants. Biochem. J.
55, 170–171.
53.
53 Cornish-Bowden, A. (1974) A simple graphical method for determining the
inhibition constants of mixed, uncompetitive and non-competitive inhibitors.
Biochem. J. 137, 143–144.
54.
54 Siemann, S., Clarke, A. J., Viswanatha, T., and Dmitrienko, G. I. (2003) Thiols
as classical and slow-binding inhibitors of IMP-1 and other binuclear metallo--
lactamases. Biochemistry, 42, 1673–1683.
55.
55 Doucet, N., DeWals, P. Y., and Pelletier, J. N. (2004) Site saturation mutagenesis
of Tyr 105 reveals its importance in substrate stabilization and discrimination in
TEM-1 -lactamase. J. Biol. Chem. 279, 46295–46303.
56.
56 Abeles, R. H., and Maycock, A. L. (1976) Suicide enzyme inactivators. Acc. Chem.
Res. 9, 313–319.
57.
57 Auld, D. S. (1988) Use of chelating agents to inhibit enzymes. Methods Enzymol.
158, 110–114.
58.
58 Kitz, R., and Wilson, I. B. (1962) Esters of methanesufonic acid as irreversible
inhibitors of acetylcholinesterase. J. Biol. Chem. 237, 3245–3249.
59.
59 Silverman, R. B. (2000) The organic chemistry of enzyme catalyzed reactions.
Appendix 1 Academic Press, New York, pp. 584–587.
60.
60 Siemann, S., Brewer, D., Clarke, A. J., Dmitrienko, G. I., Lajoie, G., and
Viswanatha, T. (2002) IMP-1 metallo--lactamase: Effect of chelators and
assessment of metal requirement by electrospray mass spectrometry. Biochim.
Biophys. Acta 1571, 190–200.
61.
61 Payne, D. J., Coleman, K., and Cramp, R. (1991) The automated in-vitro
assessment of -lactamase inhibitors. J. Antimicrob. Chemother. 28, 775–776.
62.
62 Yang, Z., Ho, P.-L., Liang, G., Chow, K. H., Wang, W., Cao, Y., Guo, Z., and
Xu, B. (2006) Using -lactamase to trigger supramolecular hydrogelation. J. Amer.
Chem. Soc. ASAP Article; DOI: 10.1021/ja0675604.
63.
63 Fitzgerald, F. M. D., Wu, J. K., and Toney, J. H. Unanticipated inhibition of
metallo- -lactamase from Bacterioides fragilis by 4-morpholinoethane sulfonic
acid (MES): A crystallographic study at 1.85 À resolution. Biochemistry 37,
6791–6800.
64.
64 Oliver, R. W. A., and Viswanatha, T. (1968) Reaction of tris(hydroxymethyl)-
aminomethane with cinnamoylimidazole and cinnamoyltrypsin. Biochem. Biophys.
Acta 156, 422–425.
65.
65 Jones, R. N., Wilson, H. W., Novick, W. J. Jr., Barry, A. L., and Thornsberry, C.
(1982) In vitro evaluation of CENTA, a new -lactamase-susceptible chromogenic
cephalosporin reagent. J. Clin. Microbiol. 15, 954–958.
66.
66 Ellman, G. L. (1959) Tissue sulfhydryl groups. Arch. Biochem. Biophys. 82, 70–77.
67 Riddles, P. W., Blakely, R. L., and Zerner, B. (1979) Ellman’s reagent: 5,5 -
67.
dithiobis-92-nitrobenzoic acid: a reexamination. Anal. Biochem. 94, 75–81.
20
Studies of Enzymes That Cause Resistance

to Aminoglycoside Antibiotics
Engin H. Serpersu, Can Özen, and Edward Wright
Summary
Aminoglycoside antibiotics are highly potent, wide-spectrum bactericidals (1,2). Bacterial
resistance to aminoglycosides, however, is a major problem in the clinical use of aminoglycosides.
Enzymatic modification of aminoglycosides is the most frequent resistance mode among several
resistance mechanisms employed by resistant pathogens (1,3). Three families of aminoglycoside
modifying enzymes, O-phosphotransferases, N-acetyltransferases, and N-nucleotidyltransferases,
are known to have more than 50 enzymes (1,3,4). In this chapter, determination of enzymatic
activity of a single enzyme from each family in the presence and absence of an inhibitor is
described.
Key Words: antibiotic resistance; aminoglycosides; aminoglycoside acetyltransferase;

aminoglycoside nucleotidyltransferase; aminoglycoside phosphotransferase; enzyme inhibition;
drug design.
1. Introduction
Aminoglycosides are hydrophilic molecules carrying several hydroxyl and
amino functional groups. Most of the aminoglycosides have one or more amino
sugars that are attached to a 2-deoxystreptamine (2-DOS) ring. Aminogly-
cosides that contain 2-DOS are generally further separated into two groups
as the neomycin group (4,5-disubstituted 2-DOS) and the kanamycin group
(4,6-disubstituted 2-DOS) based on the substitution pattern of the 2-DOS
(Fig. 1). Aminoglycoside-modifying enzymes (AGMEs) are promiscuous in

261
262 E. H. Serpersu et al.
Fig. 1. Kanamycins (4,6-disubstituted deoxystreptamine, top) and neomycins (4,5-

disubstituted deoxystreptamine, bottom).
substrate recognition, and many AGMEs show overlapping substrate speci-

ficity. Therefore, when a specific inhibitor was developed to inhibit one specific
enzyme, it failed to inhibit cell growth because other AGMEs, expressed in
multiply resistant bacteria, were not affected (5,6). Similarly, inhibitors based
on removal of hydroxyl or amine groups from aminoglycosides may inhibit
one specific AGME but usually are substrates of others. Thus, an inhibitor
must affect several AGMEs simultaneously to be effective. More recently,
various inhibitors based on different strategies have been developed (7–15).
Our studies also yielded inhibitors of these three enzymes (16); however, to
date, no clinically useful inhibitor has been developed against AGMEs. Due
to its importance in testing inhibitors, in this chapter, we will describe activity
Studies of Enzymes That Cause Resistance to Aminoglycosides 263
measurements with each class of AGMEs using an example enzyme from each
family, an acetyltransferase, a nucleotidyltransferase, and a phosphotransferase.
1.1. Acetyltransferase Activity

We will use the aminoglycoside acetyltransferase(3)-IIIb (17) (AAC) (MW:
30 kDa, ∼5 μmoles/min/mg specific activity with kanamycin A as substrate
at 24 ºC (17)), which catalyzes the acetylation of aminoglycosides at N3. The
reaction is
Kanamycin A + Acetyl CoA → 3 − Acetyl − Kanamycin A + CoASH
Activity of this enzyme is measured based on the reduction of 4,4’-Dipyridyl

disulfide (18) by CoASH, releasing pyridine-4-thiolate, which can easily be
detected at 324 nm spectrophotometrically (19). The reaction is
4 4 − Dipyridyl disulfide + CoASH → CoA − S − S − pyridine

+ pyridine − 4 − thiolate
1.2. Nucleotidyltransferase Activity

Aminoglycoside nucleotidyltransferase(2˝)-Ia (21) (ANT) (MW: 25 kDa,
specific activity for tobramycin nucleotidylation: 0.4 units/mg at 30 °C using
40 μM tobramycin and 1.0 mM MgATP (22) is one of the most prevalent
enzymes causing resistance to aminoglycosides (23) and catalyzes the covalent
attachment of adenosine monophosphate (AMP) to the 2˝ position of 4,6-
disubstituted aminoglycoside antibiotics (21,24). The overall reaction is
MgATP + 2 − hydroxyaminoglycoside → MgPPi + AMP − 2 − aminoglycoside
A discontinuous coupled enzyme assay based on the conversion of one

molecule of the reaction product, inorganic pyrophosphate, to two molecules
of inorganic phosphate was utilized to measure the steady-state rate of the
reaction catalyzed by ANT (21,22,25). Inorganic pyrophosphatase catalyzes
hydrolysis of pyrophosphate to inorganic phosphate as shown below, which is
then determined spectrophotometrically (25,26):
MgPPi →Mg2+ + 2Pi

1.3. Phosphotransferase Activity

The enzyme used in these studies is the aminoglycoside phosphotransferase(3’)-
IIIa (28) (APH) (MW: 31 kDa, specific activity for kanamycin A phosphory-
lation: 2.0 units/mg at 24 °C (29,30)). APH catalyzes phosphorylation of the
3 -OH position on aminoglycosides. The enzyme is purified based on McKay
et al. (28), with modifications described in Özen and Serpersu (30). The catalytic
reaction is
Mg2+ + ATP + KanA → Mg2+ + ADP + KanA − PO−
3
The rate of this reaction is determined by coupling it to the well-known

pyruvate kinase-lactic dehydrogenase coupled enzyme system where phospho-
enolpyruvate (PEP) is converted to pyruvate, which is then reduced to lactate
while NADH is oxidized to NAD+ :
PEP + Mg2+ + ADP − PyruvateKinase → Pyruvate + Mg2+ + ATP
Pyruvate + NADH —-(Lactate Dehydrogenase)→ Lactate + NAD+ .
2. Materials
1. Spectrophotometer.
2. 0.5 M Tris-HCl buffer, pH 7.5. Store at 4 °C.
3. 0.25 M EDTA. Store at 4 °C.
4. 100 mM AldrithiolTM -4 (4,4’-dipyridyl disulfide). Store at –80 °C.
5. 50 mM acetyl coenzyme A. Store at –80 °C.
6. 5 mM kanamycin A. Store at –20 °C or –80 °C.
7. AAC sample.

2. 0.25 M HEPES buffer, pH 7.5. Store at 4 °C.
3. 1.0 M KCl. Store at 4 °C.
4. 100 mM MgCl2 . Store at 4 °C.
5. 2.5 mM tobramycin. Store at –20 °C.
6. 20 mM ATP. Prepare in ice, and adjust pH to 5.0–6.0. Store at –20 °C.
7. Inorganic pyrophosphatase (follow manufacturer’s storage instructions).
8. 1.0% (w/v) Ammonium molybdate in H2 O. Store at room temperature.
9. 10% (w/v) SDS in acetic acid/acetate, pH 4.0. Store at room temperature.
10. 10% Ascorbic acid in ddH2 O. Prepare immediately before use.
11. 0.5–1.0 mg/mL of ANT.

2. 0.5 M TrisHCl buffer, pH 7.5. Store at 4 °C.
3. 1.0 M KCl. Store at 4 °C.
4. 100 mM MgCl2 . Store at 4 °C.
5. 50 mM kanamycin A. Store at –20 °C.
6. 20 mM ATP. Prepare in ice, and adjust pH to 5.0–6.0. Store at –20 °C.
7. 10 mM phospho(enol)pyruvate (PEP). Prepare in 1.0 mM TrisHCl, pH 7.5. Store
at –20 °C.
8. 10 mM NADH. Prepare in 1.0 mM TrisHCl, pH 7.5. Store at –20 °C.
9. Pyruvate kinase (PK) and L-lactate dehydrogenase (LDH) mixture, each 750
units/mL. Store at 4 °C.
10. APH sample. In order to obtain a measurable rate, adjust the concentration to
100 μM.
3. Methods
1. Turn on the spectrophotometer, and set the wavelength to 324 nm and the run
time to several minutes.
2. Prepare the assay mix by adding 856 μL distilled water (resistivity 17.5 M-cm
or better), 100 μL 0.5 M TrisHCl, and 4 μL 0.25 M EDTA into a quartz cuvette.
3. Equilibrate the mix to the temperature at which the assay will be conducted.
4. Add 2 μL 50 mM acetyl coenzyme A, 8 μL 100 mM 4,4’-dipyridyl disulfide, and
10 μL 100 μM (∼3 mg/mL) AAC sample and mix (see Notes 1 and 2).
5. Blank the spectrophotometer using the mixture prepared in Step 4.
6. Start the run and determine the background rate ( absorbance units/min) for
pyridine-4-thiolate formation.
7. Add 20 μL 5 mM kanamycin A, quickly mix, and continue the run.
8. After the run is complete, calculate the rate of increase ( absorbance units/min)
in pyridine-4-thiolate absorption using a linear part of the plot. Subtract the
background rate from this value to find the enzymatically catalyzed reaction rate
(see Notes 3 and 4).
9. Using the rate calculated in Step 8 and the molar extinction coefficient of pyridine-
4-thiolate (19,800 M−1 cm−1 at 324 nm), calculate the enzyme activity in units
(one unit is defined as μmoles of substrate utilized per min).
10. Calculate the specific enzyme activity (μmoles/min/mg or units/mg) by dividing
the activity determined in Step 9 by the amount (mg) of AAC in the assay cuvette.
AAC activity is ∼5 units/mg (17) (see Notes 5 and 6).

1. Turn on the spectrophotometer, and set the wavelength to 820 nm. Prepare a 30 °C
water bath.
2. Aliquot 700 μL of 10% (w/v) SDS in acetic acid/acetate, pH 4.0 (stopping
solution), in a test tube for each time point of the assay.
3. Prepare 1:1 mixture of 1.0% (w/v) ammonium molybdate:10% ascorbic acid.
4. Prepare the assay mix by adding 280 μL of distilled water (resistivity 17.5 M-cm
or better), 25 μL of 0.25 M HEPES, 50 μL of 1.0 M KCl, 75 μL of 100 mM
MgCl2 , 25 μL of 20 mM ATP, and 2.0 units (5 μL of 400 units/ml solution) of
inorganic pyrophosphatase and 25 μL of ANT into a plastic cuvette (see Note 7).
5. Equilibrate the mix to 30 °C in a water bath.
6. Start reaction by addition of 20 μL of tobramycin. Run a parallel blank reaction
by adding water instead of tobramycin (see Notes 8 and 9).
7. Every 2 min remove 100 μL from each reaction mixture and add to tube containing
stopping solution.
8. After all time points are complete (3 or 4 for 500 μL assay volume), add 200 μL
ammonium molybdate:ascorbic acid solution. Let stand 30 min at room temper-
ature.
9. Read each tube at 820 nm using tubes without tobramycin from each time point
as a blank (see Note 10).
10. Calculate rate by plotting A820 vs. time. A reading of 1.0 at 820 nm corresponds to
260 nanomoles of Pi formed. Therefore, a reading of 1.0 results from the formation
of 130 nanomoles of MgPP i (and also TobAMP) in the initial reaction. Calculate
the specific enzyme activity (units/mg) by dividing the rate by the amount (mg)
of ANT in the assay.
11. When present, inhibitors must be added at Step 4 above (see Notes 11 and 12).
12. As indicated earlier, for inhibitors with low water solubility, DMSO, ethylene
glycol, or hexylene glycol can be used in activity assays up to a few percent
without affecting the enzyme activity (16,20).

1. Turn on the spectrophotometer, and set the wavelength to 340 nm and the run time
to 2.0 min.
2. Prepare the assay mix by adding 495 μL of distilled water (resistivity 17.5 MO-cm
or better), 100 μL of 0.5 M TrisHCl, 100 μL of 1.0 M KCl, 15 μL of 100 mM
MgCl2 , 10 μL of 50 mM aminoglycoside stock, 50 μL of 20 mM ATP, and 200 μL
of 10 mM PEP into a cuvette with 1-cm path length (see Note 13).
3. Equilibrate the mix to the temperature at which the assay will be conducted.
4. Blank the spectrophotometer using the assay mix (see Note 14).
5. Add 15 μL of 10 mM NADH and 5.0 μL of PK/LDH into the cuvette and mix well
(see Note 15).
6. Start the run. Observe a flat baseline for the initial 10 to 20 s, add 10 μL of 100
μM APH, quickly mix, and continue the run.
7. After the run is complete, calculate the rate of decrease ( absorbance units per
minute) in NADH absorption using a linear stretch of the plot (see Note 16).
8. Using the rate calculated in Step 7 and the molar extinction coefficient of NADH
(6.22 × 103 M−1 cm−1 at 340 nm), calculate the enzyme activity in units (a unit is
defined as one μmole/min) (see Note 17).
9. Calculate the specific enzyme activity (units/mg) by dividing the activity determined
in Step 8 by the amount (mg) of APH in the assay cuvette (see Notes 18–20).
4. Notes
1. Keep 4,4’-dipyridyl disulfide, acetyl coenzyme A, kanamycin A stocks, and AAC
sample on ice.
2. If multiple assays are to be conducted, one can prepare a stock solution of the
assay mix by multiplying the amounts given at Step 2 of the Methods section with
the number of assays. This solution can be stored on ice for several hours. Use
962 μL from the prepared stock for each assay.
3. In order to ensure that no other assay component except AAC is the limiting factor
in the assay, double the amount of AAC added in another run and confirm the
doubling of the rate.
4. Mercaptoethanol (BME) can be used as a positive control to test the assay mix.
Add 5 μL of 5 mM BME into the cuvette. An immediate increase in absorbance
should be observed.
5. When present, inhibitors should be added in Step 4 before the baseline determi-
nation.
6. Inhibitors with low water solubility can be added from stocks dissolved in DMSO,
ethylene glycol, or hexylene glycol. A matching concentration of solvent needs
to be present in assays performed without the inhibitor. Generally, AGMEs are
tolerant to the presence of these solvents in the assay medium up to several
percentage points.
7. The assay can be scaled up to 1.0 mL if more time points are required.
8. Initial tests to determine the limits of linearity of the assay vs. enzyme concen-
tration (Fig. 2) and linearity of activity vs. time (Fig. 3) are strongly recommended.
9. If desired, commercial preparations of inorganic pyrophosphate can be used in
place of tobramycin to construct a standard curve to determine absorbance vs.
inorganic phosphate for a particular spectrophotometer. This method also can
confirm the activity of the inorganic pyrophosphatase is not a limiting factor in
the assay.
10. If multiple assays are to be conducted, prepare an assay mix stock that can be
stored at 4 °C for a couple of hours by multiplying the amounts given at Step 2
of the Methods section with the number of assays.
Fig. 2. A typical experiment showing the linearity of the assay as a function of ANT
concentration. Incubation time was 5 min.
11. ANT is an unstable enzyme. It should be kept on ice at all times and should be
used within 48 h of preparation. ANT should not be frozen.
12. Substrate inhibition is observed with ANT (22,27). This phenomenon must be
considered when designing detailed kinetic analysis using this enzyme.
Fig. 3. Accumulation of inorganic phosphate as a function of assay time. ANT

concentration was 0.04 mg/mL. Data represent the average of three measurements with
different batches of enzyme. Errors smaller than the size of data points are not visible
in early time points.
13. Keep stock solutions of kanamycin A, ATP, PEP, NADH, PK/LDH, and APH on
ice.
14. If multiple assays are to be conducted, one can prepare an assay mix stock that
can be stored at 4 °C for a couple of hours by multiplying the amounts given at
Step 2 of the Methods section with the number of assays. Use 970 μL from the
prepared stock for each assay.
15. NADH stocks will undergo oxidation and take a yellowish color within a couple
of weeks. The degree of oxidation can be estimated from the absorbance reading
when 15 μL of NADH are added into the assay mix (100% NADH should give
an absorbance reading of 0.95). Thus, small stocks of NADH should be prepared
to be consumed in a short period of time. Also, repeated freeze/thaw cycles of
NADH solutions are not recommended.
16. In order to ensure that no other assay component except APH is the limiting
factor for the measured rate, add another 10 μL of APH after a linear decrease in
absorbance is observed. The rate should double after the second addition.
17. ADP can be used as a positive control to check the assay mix components in case
no activity is observed. Add 10 μL of 10 mM ADP to observe approximately a
0.6-unit decrease in absorbance.
18. In these types of assays, coupling enzyme(s) should not create a bottleneck for
observed activity. To guarantee this, activity units per unit volume for coupling
enzymes should be at least 10-fold higher than the one for the enzyme studied.
19. Substrate inhibition is observed with APH at high concentrations, which must be
considered in detailed kinetic experiments.
20. APH activity is not affected by DMSO, ethylene glycol, or hexylene glycol up
to several percent presence of these solvents, which can be used in assays of
inhibitors with low solubility in water (16,20).
References
1.
1 Umezawa, H. (1974) Biochemical mechanism of resistance to aminoglycosidic
antibiotics. Adv. Carbohydrate Chem. Biochem. 30, 183–225.
2.
2 Davies, J. E. (1991) In Antibiotics in Laboratory Medicine (V. Lorian, ed.).
Williams and Wilkins, Baltimore, MD, pp. 691–713.
3.
3 Davies, J. E. (1994) Inactivation of antibiotics and the dissemination of resistance
genes. Science 264, 375–382.
4. Shaw, K. J., Rather, P. N., Hare, R. S., and Miller, G. H. (1993) Molecular-
4
genetics of aminoglycoside resistance genes and familial relationships of the
aminoglycoside- modifying enzymes. Microbiol. Rev. 57, 138–163.
5.
5 Allen, N. E., Alborn, W. E., Hobbs, J. N., and Kirst, H. A. (1982) 7-
Hydroxytropolone—An inhibitor of aminoglycoside-2”-O-adenylyltransferase.
6.
6 Williams, J. W., and Northrop, D. B. (1979) Synthesis of a tight-binding, multi-
substrate analog inhibitor of gentamycin acetyltransferase I. J. Antibiot. 32,
1147–1154.
7.
7 Yu, L. P., Oost, T. K., Schkeryantz, J. M., Yang, J. G., Janowick, D., and
Fesik, S. W. (2003) Discovery of aminoglycoside mimetics by NMR-based
screening of Escherichia coli A-site RNA. J. Amer. Chem. Soc. 125, 4444–4450.
8.
8 Agnelli, T., Sucheck, S. J., Marby, K. A., Rabuka, D., Yao, S. L., Sears, P. S.,
Liang, F. S., and Wong, C. H. (2004) Dimeric aminoglycosides as antibiotics.
Angew. Chem. Intl. Ed. 43, 1562–1566.
9.
9 Sucheck, S. J., Greenberg, W. A., Tolbert, T. J., and Wong, C.-H. (2000) Design of
small molecules that recognize RNA: Development of aminoglycosides as potential
antitumor agents that target oncogenic RNA sequences. Angew. Chem. Intl. Ed.
39, 1080–1084.
10.
10 Asensio, J. L., Hidalgo, A., Bastida, A., Torrado, M., Corzana, F., Chiara, J.
L., Garcia-Junceda, E., Canada, J., and Jimenez-Barbero, J. (2005) A simple
structural-based approach to prevent aminoglycoside inactivation by bacterial
defense proteins. Conformational restriction provides effective protection against
neomycin-B nucleotidylation by ANT4. J. Amer. Chem. Soc. 127, 8278–8279.
11.
11 Griffey, R. H., Hofstadler, S. A., and Swayze, E. E. (2003) Preparation of
heterocyclic 2-deoxystreptamine aminoglycoside analogues and characterization of
their interaction with RNAs by use of electrospray ionization mass spectrometry.
Carbohydrate-Based Drug Discovery 2, 483–499.
12.
12 Haddad, J., Kotra, L. P., Llano-Sotelo, B., Kim, C., Azucena, E. F., Liu, M. Z.,
Vakulenko, S. B., Chow, C. S., and Mobashery, S. (2002) Design of novel
antibiotics that bind to the ribosomal acyltransfer site. J. Amer. Chem. Soc. 124,
3229–3237.
13. Fridman, M., Belakhov, V., Yaron, S., and Baasov, T. (2003) A new class of
13
branched aminoglycosides: Pseudo-pentasaccharide derivatives of neomycin B.
Org. Lett. 5, 3575–3578.
14.
14 Boehr, D. D., Draker, K. A., Koteva, K., Bains, M., Hancock, R. E., and
Wright, G. D. (2003) Broad-spectrum peptide inhibitors of aminoglycoside
antibotic resistance enzymes. Chem. Biol. 10, 189–196.
15.
15 He, Y., Yang, J., Wu, B., Robinson, D., Sprankle, K., Kung, P.-P., Lowery, K.,
Mohan, V., Hofstadler, S., Swayze, E. E., and Griffey, R. (2004) Synthesis and
evaluation of novel bacterial rRNA-binding benzimidazoles by mass spectrometry.
Bioorg. Med. Chem. Lett. 14, 695–699.
16.
16 Welch, K. T., Virga, K. G., Brown, C. L., Wright, E., Lee R. E., and Serpersu, E. H.
(2005) Inhibitors of aminoglycoside-modifying enzymes based on the 1,3-diamine
motif of the 2-deoxystreptamine ring. Bioorg. Med. Chem. 13, 6252–6263.
17.
17 Owston, M. A., and Serpersu, E. H. (2002) Cloning, overexpression, and
purification of aminoglycoside antibiotic 3-acetyltransferase-IIIb: Conformational
studies with bound substrates. Biochemistry 41, 10764–10770.
18.
18 Williams, J. W., and Northrop, D. B. (1978) Kinetic mechanisms of gentamycin
acetyltransferase-I—Antibiotic-dependent shift from rapid to nonrapid equilibrium
random mechanisms. J. Biol. Chem. 253, 5902–5907.
19.
19 Grassetti, D. R., and Murray, J. F. (1967) Determination of sulfhydryl groups with
2,2’- or 4,4’-dithiodipyridine. Arch. Biochem. Biophys. 119, 41–49.
20.
20 Serpersu, E., and Dan, J. (2004) Effects of solvents on the activity and substrate
preference of the aminoglycoside-3-acetyltransferase-IIIb. Biophys. J. 86, 93a–93a.
21.
21 Wright, E., and Serpersu, E. H. (2004) Isolation of aminoglycoside
nucleotidyltransferase(2”)-Ia from inclusion bodies as active, monomeric enzyme.
Protein Expr. Purif. 35, 373–380.
22.
22 Wright, E., and Serpersu, E. H. (2005) Enzyme-substrate interactions with
an antibiotic resistance enzyme: Aminoglycoside nucleotidyltransferase(2”)-
Ia characterized by kinetic and thermodynamic methods. Biochemistry 44,
11581–11591.
23.
23 Shimizu, K., Kumada, T., and Hsieh, W. C. (1985) Comparison of aminoglycoside
resistance patterns in Japan, Formosa, and Korea, Chile, and the United States.
24.
24 Gates, C. A., and Northrop, D. B. (1988) Substrate specificities and structure
activity relationships for the nucleotidylation of antibiotics catalyzed by amino-
glycoside nucleotidyltransferase-2”-I. Biochemistry 27, 3820–3825.
25.
25 Ekman, D. R., DiGiammarino, E. L., Wright, E., Witter, E. D., and Serpersu, E. H.
(2001) Cloning, overexpression, and purification of aminoglycoside antibiotic
nucleotidyltransferase (2 ‘)-Ia: Conformational studies with bound substrates.
26.
26 Ames, B. N. (1965) Assay for inorganic phosphate. Meth. Enzymol. 7, 115–118.
27.
27 Gates, C. A., and Northrop, D. B. (1988) Alternative substrate and inhibition-
kinetics of aminoglycoside nucleotidyltransferase-2”-I in support of a Theorell-
Chance kinetic mechanism. Biochemistry 27, 3826–3833.
28.
28 McKay, G., A., Thompson, P. R., and Wright, G. D. (1994) Broad spectrum
aminoglycoside phosphotransferase type III from Enterococcus: Overexpression,
purification and substrate specificity. Biochemistry 33, 6936–6944.
29.
29 Ozen, C., Malek, J. M., and Serpersu, E. H. (2006) Dissection of aminoglycoside-
enzyme interactions: A calorimetric and NMR study of noemycin B binding to the
aminoglycoside phosphotransferase(3’)-IIIa. J. Amer. Chem. Soc. (in press).
30.
30 Özen, C., and Serpersu, E. H. (2004) Thermodynamics of aminoglycoside binding
to aminoglycoside-3’-phosphotransferase IIIb studied by isothermal titration
calorimetry. Biochemistry 43, 14667–14675.
Index
A Chaperone proteins, 75
Agarose gel electrophoresis, 13, 15, 17, 19 Circular dichroism assay, 168
Aminoglycosides, 263–264
Aminoglycoside modifying enzyme assays, D
aminoglycoside acetyltransferase assay, 265 Database of Essential Genes (DEG), 5
aminoglycoside nucleotidyltransferase assay, 266 Decatenation assay for topo IV, 15
aminoglycoside phosphotransferase assay, DNA cleavage assay, 17–19
266–267 DNA gyrase, 11–12
Antibiotic mechanisms of inhibition, 2 DNA polymerase III, 26
Antibiotic target identification, 3 DNA polmyerase III assay, 28, 32
DNA polymerase III, isolation 27–30
B DNA supercoling assay, 13–15
Bacillus subtilis, 26 DNA topoisomerase IV, 11–12
Bacterial colony counting, 58, 66 DnaK, 76, 80
Bacterial efflux pump inhibitors (EPI), 187–188 Drug target features, 4
Bacterial cell extracts, 28, 42, 57, 67, 78, 98, 110,
123, 227, 246 E
Bacterial growth media, Erythromycin resistance methyltransferase (Erm)
broth growth media, 30, 38, 56, 64, 68, 120, enzyme isolation, 227–228
189, 225 Escherichia coli, 5,12, 38, 68, 76, 98, 120, 134,
minimal media, 55–56, 64, 77, 93, 120 189, 191, 217, 245
Bacterial membrane preparations, 134, 136 Essential genes, 4, 7
Beta-galactosidase assay, 80 Ethidium bomide, 20, 177, 188
Beta-keto acyl carrier protein synthase III Ethidium bromide accumulation assay,
(FabH), 207 191–193
Beta-lactamase, 241–244
Beta-lactamase assays, 244–245, 250–251, F
252–256 Fatty acid biosynthesis, 205–206
Beta-lactamase isolation, 246 Flow cytometry, 176–177
BLASTP, 5 Fluorescence polarization assay, 218–219
Bocillin, 139 Fluorescent dyes, 179
Broth growth media, 30, 38, 56, 64, 68, 120, Fluorography, 137
189, 225 Four-part assay for ribosomal subunit
formation, 65
C Fractional inhibitory concentration method (FIC),
Calcein leakage assay, 165 196–197, 201
Calf thymus DNA activation, 30
Cationic antimicrobial peptides, 155–156 H
Cell-free translation assays, 88 Haemophilus influenzae, 2, 54, 68,
bacterial translation, 100 189, 191
human cell translation, 102 HeLa cell culture, 93
yeast cell translation, 101 High throughput screening assay, 45
273
274 Index
His-tagged proteins, 14, 30, 41, 124 PDF enzyme preparation, 123–125
Human cell extracts, 100 Plasmid DNA, 12
Post-antibiotic effect, 67
I Primer extension assay, 28, 33
IC50 , 61, 65 Protonophore assay, 197–199
Pseudomonas aeruginosa, 6, 188
K Pulse and chase labeling, 67
Kinetoplast DNA, 12
Q
L Quinolones, 12
Large unilamellar vesicle (LUV) assays, 162–163
Lipid quantitation assay, 162 R
Lipopolysaccharides (LPS), 143–144 Ribosomes, 63, 76, 87, 109, 223
Liquid scintillation counting, 32, 67, 77, 79, 147, Ribosomal subunit, 64
149, 199, 211 RNA methyltransferases, 224–225
LpxC deacetylase assay, 147 RNA polymerase, 37–38
RNA polymerase assay, 39, 40
M RNA polymerase purification, 42–43
MALDI mass spectrophometry, 229 RNA transcription, 96, 228
Membrane permeability and potential
measurements, 180–181
Membrane preparation, 135, 136 S
Messenger RNA (mRNA), 88 S100 supernatant preparation, 57,110
Miicroorganisms, Scintillation proximity assay, 39, 109
Bacillus subtilis , 26 SDS polyacrylamide gel electrophoresis (PAGE),
Escherichia coli, 5,12, 38, 68, 76, 98, 120, 134, 40, 47, 133, 137
189, 191, 217, 245 Sigma factor purification, 43–44
Haemophilus influenzae, 2, 54, 68, 189, 191 SPARK assay, 112–114
Pseudomonas aeruginosa, 6, 188 SPARK assay principle, 108
Staphylococcus aureus, 38, 54, 66, 68, 135 Staphylococcus aureus, 38, 54, 66, 68, 135
Streptococcus pneumoniae, 19, 54, 68 Streptococcus pneumoniae, 19, 54, 68
Minimal inhibitory concentration (MIC), 57, 170, Sucrose density gradient centrifugation, 67, 77
194–196 Synthetic templates, 27, 32
Minimal media, 55–56, 64, 77, 93, 120
Mouse infection, 58 T
Messenger RNA (mRNA) transcription, 96–97 Thin-layer chromatography (TLC), 147
mtFabH assay, 210–211 Time kill kinetics assays, 58, 200
Transfer RNA synthetases, 53–54
O Transfer RNA synthetase assay, 57
ONPG leakage assays, 164 Tryptophan fluorescence assays, 166–167
Two-component signal transduction (TCST),
P 215–216
Penicillin binding proteins (PBP), 131–132
PBP labeling, 134, 136
U
PBP assays, 137–139
Ultrafiltration binding assay, 149
Peptide deformylase (PDF), 117–118
Uridine labeling of RNA, 65, 77
PDF enzyme assays,
PDF coupling enzymes, 122
AAP coupled, 125–127 Y
DPPI coupled, 127–128 Yeast extract preparation, 99
FDH coupled, 124–125 Yeast growth media, 93

New Antibiotic Targets PDF

Diunggah oleh

Informasi Dokumen

Judul Asli

Hak Cipta

Format Tersedia

Bagikan dokumen Ini

Bagikan atau Tanam Dokumen

Opsi Berbagi

Apakah menurut Anda dokumen ini bermanfaat?

Apakah konten ini tidak pantas?

Hak Cipta:

Format Tersedia

New Antibiotic Targets PDF

Diunggah oleh

Hak Cipta:

Format Tersedia

New Antibiotic Targets

John M. Walker, SERIES EDITOR

New Antibiotic Targets

All rights reserved.

This publication is printed on acid-free paper.

Production Editor: Christina M. Thomas

Photocopy Authorization Policy:

Printed in the United States of America. 10 9 8 7 6 5 4 3 2 1

Library of Congress Cataloging in Publication Data: 2007933473

A crisis is developing in the treatment of infectious diseases. Resistance of

1 Biocomputational Strategies for Microbial Drug Target Identiﬁcation

13 Methods for Assessing the Structure and Function of Cationic

Jean-Hervé Alix • Institute de Biologie Physico-Chimique, UPR 9073 du CNRS,

Claudio O. Gualerzi • Department of Biology MCA, University of Camerino, Camerino

Thammaiah Viswanatha • Department of Chemistry, University of Waterloo, W.,

Biocomputational Strategies for Microbial Drug Target

From: Methods in Molecular Medicine, Vol. 142: New Antibiotic Targets

primarily on antibacterial activity, specifically growth inhibition of a desired

However, the widespread emergence of antibiotic resistance is of growing

specifically identifying a target that is present in many or at least several

Fig. 1. Drug discovery pipeline.

Fig. 2. Criteria for selection of proteins as drug targets.

which includes the essential genes identified in the genomes of Escherichia

complementary data sets (Table 1) and the application of a subtractive genomics

Number of proteins 5567

Fig. 3. Percentage distribution of 306 essential genes encoding different classes of

Methods to Assay Inhibitors of DNA Gyrase

L. Mark Fisher and Xiao-Su Pan

From: Methods in Molecular Medicine, Vol. 142: New Antibiotic Targets

2.2. Decatenation Assay for Topo IV

2.3. Drug-Promoted DNA Cleavage by Gyrase or Topo IV

1. Gyrase assays are performed in 35 mM Tris-HCl, pH 7.5, 24 mM KCl, 6 mM

3.2. kDNA Decatenation Assay for Topoisomerase IV

Fig. 1. Reconstitution and titration of DNA supercoiling activity using

Fig. 2. Inhibition of DNA supercoiling by ciprofloxacin. Relaxed pBR322 DNA

John Innes Enterprises. Recombinant topo IV from a number of Gram-positive

3.3. DNA Cleavage Assays for Gyrase and Topo IV

Fig. 3. Titration of DNA decatenation activity of S. pneumoniae topo IV. Kinetoplast

the ability of the inhibitor to promote linearization of pBR322 DNA mediated by

Fig. 4. Inhibition of S. pneumoniae topo IV decatenation activity by ciprofloxacin.

9. Inclusion of ATP has no significant effect on the level of quinolone-induced DNA

quinolone action from enzymatic analysis, intracellular levels, and phenotypes of

A Method to Assay Inhibitors of DNA Polymerase IIIC

Michelle M. Butler and George E. Wright

From: Methods in Molecular Medicine, Vol. 142: New Antibiotic Targets

target. However, the pol III enzymes of Gram-positive and Gram-negative

10. Denatured DNA cellulose, prepared as described by Alberts et al. (8).

2.1.2. Isolation of Recombinant B. subtilis Pol IIIC

2.2. DNA Substrates

2.2.2. Synthetic Primer:Templates

2.3. Pol IIIC Assays

2.3.2. Pol IIIC Assay Using Synthetic Template:Primers

2.3.3. Primer Extension Assay

3.1.2. Cloning, Overexpression, and Isolation of Recombinant

3.2. Preparation of DNA Substrates

25000 0.15 ug/mL

Fig. 1. Pilot-scale preparation of activated calf thymus DNA, described in Section

3.2.2. Synthetic Primer:Templates

In order to prepare these DNA substrates, a ratio of 5 A260 units of polymer

3.3. Assays Using Pol III

1. Each 25 μL assay contains 30 mM Tris, pH 7.5, 10 mM magnesium acetate, 4

3.3.2. Assays Using Synthetic Primer:Templates

1. A final template (polymer) concentration of 0.5 OD/mL is used in a 25 μL assay

only the 70 -saturated holoenzyme preparation from Epicentre (Madison, WI)