Anda di halaman 1dari 13

BAB I

PENDAHULUAN

I. LATAR BELAKANG
Identifikasi bakteri pada saat ini masih dilakukan secara konvensional
melalui studi morfologi dan biokimia menggunakan buku sumber
Bergey’s Manual of Systematic Bacteriology. Metode identifikasi
konvensional hanya berhasil mendeteksi satu atau dua jenis bakteri saja
atau satu persen dari total mikroba dalam tanah. Metode ini memperbesar
kemungkinan bakteri lain yang memiliki fenotip yang sama teridentifikasi
menjadi spesies yang sama, padahal keduanya belum tentu secara genetik
memiliki kesamaan. Sementara itu, bakteri jenis tertentu terkadang
memiliki kemampuan membentuk endospora, sehingga hanya aktif pada
waktu tertentu sesuai kondisi optimum pertumbuhannya. Hal ini dapat
menghambat proses identifikasi bakteri menggunakan metode
konvensional.
Sistem identifikasi konvensional yang digunakan pada saat ini membatasi
proses identifikasi hanya sampai taksa genus atau sampai spesies untuk
beberapa jenis bakteri tertentu. Sementara itu, data di lapangan
menunjukkan perubahan database spesies bakteri dari waktu ke waktu.
Untuk mengidentifikasi secara pasti pada tingkatan spesies diperlukan
analisis lanjut secara molekuler. Teknik identifikasi menggunakan metode
biologi molekuler telah berhasil mengidentifikasi kelompok
mikroorganisme dari lingkungan secara spesifik.

II. TUJUAN
Praktikum kali ini bertujuan agar :
1. Mahasiswa memahami tahap-tahap identifikasi mikroorganisme
secara molekuler.
2. Mahasiswa mampu menganalisis sampel berupa urutan nukleotida
yang diberikan dengan software BLASTn dari NCBI hingga
menddapatkan kesimpulan hasil identifikasi.

III. RUMUSAN MASALAH


1. Apakah sampel urutan nukleotida dapat diidentifikasi melalui situs
NCBI?
2. Apa hasil bakteri dari sampel urutan nukloetida tersebut?
3. Bagaimana kekerabatannya dengan sampel kelompok lain?

BAB II

TINJAUAN PUSTAKA

Identifikasi Bakteri dengan Teknik Molekuler


Identifikasi bakteri dapat dilakukan menggunakan analisis fenotipik dengan
mempelajari sifat fisiologis atau biokimianya maupun analisis genotipik secara
molekuler. Seringkali hasil uji biokimia atau fisiologi tersebut berbeda karena
perbedaan ekspresi gen. Untuk karakterisasi galur-galur dalam satu spesies perlu
dilihat sifat yang paling mendasar dan relatif stabil yaitu analitik genotipik. Gen 16S-
rRNA sebagai gen target untuk menganalisa keragaman genom bakteri. Dasar
penggunaan gen 16S-rRNA dengan berbagai alasan mendasar yaitu ; (1) bersifat
universal : protein synthesis machinery (2) sekuen basa-basanya bersifat konservatif;
(3) jumlahnya melimpah dalam sel; (4) memenuhi ukuran untuk perhitungan secara
statistika (tidak terlalu panjang dan terlalu pendek); (5) ketersediaan informasi (data
bank/database di GenBank). Proses amplifikasi gen 16S-rRNA dapat dilakukan
melalui teknik PCR.

Gen 16S-rRNA

Kunci untuk mengerti keragaman mikroba adalah sistem klasifikasi yang dapat
diandalkan. Secara tradisional, bakteri diklasifikasikan terutama berdasarkan sifat-
sifat fenotipik. Akan tetapi hasinya tidak selalu dapat diandalkan secara filogeni.

Metode molekuler terutama klasifikasi dan identifikasi berbasis filogenetik,


menggunakan parameter yang tidak bergantung pada kondisi pertumbuhan dan
media yang digunakan. Pendekatan yang umum dipakai saat ini adalah analisis
sekuen gen 16S-rRNA. Ribosomal RNA (r-RNA) merupakan salah satu
makromolekul paling menarik karena molekul ini merupakan kerangka dari ribosom
yang sangat berperan dalam mekanisme translasi. Semua rRNA identik secara
fungsional yakni terlibat dalam produksi protein. Meski demikian, sekuen di
bagianbagian tertentu terus berevolusi dan mengalami perubahan pada level struktur
primer sambil tetap mempertahankan struktur sekunder dan tersier yang homologus

PCR (Polymerase Chain Reaction)

Teknik PCR (Polymerase Chain Reaction) merupakan teknik untuk keperluan


amplifikasi DNA secara in vitro yang seringkali mempunyai sensitivitas dan
spesifisitas tinggi. Amplifikasi DNA secara in vitro dengan PCR terdiri atas beberapa
siklus yang setiap siklusnya terdiri dari 3 tahap yaitu tahap denaturasi, pelekatan
(annealing) dan pemanjangan (elongasi). Tahap denaturasi adalah pembentukan DNA
utas tunggal dari DNA utas ganda (putusnya hidrogen dari kedua utas tunggal DNA
yang komplementer) yang umumnya terjadi pada suhu ≥ 95oC. Tahap annealing
yaitu pelekatan primer yang terjadi pada suhu 35-65oC, bergantung panjang
pendeknya oligonukleotida primer yang digunakan. Sedangkan tahap pemanjangan
primer terjadi sebagai hasil aktivitas polimerisasi oleh enzim Taq polimerase, yang
pada umumnya dilakukan pada suhu 70°C.

Teknik ini banyak dilakukan untuk keperluan deteksi atau identifikasi cepat bakteri
patogen. Teknik PCR-RFLP gen 16S-rRNA dikembangkan untuk mengetahui
keragaman bakteri dengan cara mengamplifikasi gen 16S-rRNA menggunakan
primer universal domain bakteria (Marchesi et al. 1998). Adanya keragaman genetik
ini dapat dilihat dengan membandingkan profil DNA hasil amplifikasi (dalam hal ini
gen 16S-rRNA) setelah didigesti dengan enzim restriksi tertentu. Perbedaan profil
DNA (jumlah dan ukuran pita DNA yang terbentuk pada gel elektroforesis)
menunjukkan adanya keragaman genetik.

Teknik PCR adalah suatu teknik biologi molekuler untuk memperbanyak sekuen
DNA tertentu (lebih dari 100 juta kopi) dengan waktu relatif singkat (beberapa jam),
oleh karena itu teknik ini bisa disebut amplifikasi DNA. Dengan PCR, molekul DNA
dapat diperbanyak sampai jutaan kopi dalam tabung reaksi.

Sekuensing

Dewasa ini hampir semua usaha sekuensing DNA dilakukan dengan menggunakan
metode terminasi rantai yang dikembangkan oleh Frederick Sanger. Teknik tersebut
melibatkan terminasi atau penghentian reaksi sintesis DNA in vitro yang spesifik
untuk sekuens tertentu menggunakan substrat nukleotida yang telah dimodifikasi.

Sekuens DNA menyandikan informasi yang diperlukan bagi makhluk hidup untuk
melangsungkan hidup dan berkembang biak. Dengan demikian, penentuan sekuens
DNA berguna di dalam ilmu pengetahuan 'murni' mengenai mengapa dan bagaimana
makhluk hidup dapat hidup, selain berguna dalam penerapan praktis. Karena DNA
merupakan ciri kunci makhluk hidup, pengetahuan akan sekuens DNA dapat berguna
dalam penelitian biologi manapun. Sebagai contoh, dalam ilmu pengobatan
sekuensing DNA dapat digunakan untuk mengidentifikasi, mendiagnosis, dan
mengembangkan pengobatan penyakit genetik. Demikian pula halnya, penelitian
pada agen penyebab penyakit (patogen) dapat membuka jalan bagi pengobatan
penyakit menular. Bioteknologi, yang dapat pula memanfaatkan sekuensing DNA,
merupakan bidang yang berkembang pesat dan berpotensi menghasilkan banyak
barang dan jasa berguna.

Gen Bank NCBI

Gen Bank (R) adalah data base komprehensif yang berisi urutan nukleotida publik
tersedia untuk lebih dari 260.000 organisme bernama, diperoleh terutama melalui
pengajuan dari laboratorium individu dan kiriman dari proyek sequencing batch
skala besar. Kebanyakan pengiriman dibuat menggunakan Bank It berbasis web atau
standalone payet program dan

nomor aksesi ditugaskan oleh staf Gen Bank pada saat diterima. Data harian
pertukaran dengan Laboratorium Biologi Molekuler Eropa Nukleotida Sequence
Data base di Eropa dan DNA Data Bank of Japan memastikan cakupan seluruh
dunia. Gen Bank dapat diakses melalui sistem pencarian NCBI itu, Entrez, yang
mengintegrasikan data dari DNA utama dan urutan protein data base bersama dengan
taksonomi, genom, pemetaan, struktur protein dan informasi domain, dan literatur
jurnal biomedis melalui PubMed. BLAST menyediakan pencarian kesamaan urutan
Gen Bank dan data base urutan lainnya, yang dirilis dua bulan sekali lengkap dan
update harian dari Gen Bank tersedia dengan FTP. Untuk mengakses Gen Bank dan
pengambilan terkait dan jasa analisis, mulai di Situs Web NCBI:
www.ncbi.nlm.nih.gov.

Ostell et al. (2001) mengemukakan bahwa format FASTA memuat sebuah baris
definisi dan karakter dari sekuens yang dapat digunakan sebagai input bagi sebuah
variasi dari program program analisis. Hal inilah yang dimanfaatkan untuk
memperoleh informasi jenis mikroba yang memiliki tingkat kesamaan tertinggi
dengan sampel mikroba melalui input format FASTA tersebut sebagai query dalam
BLAST (Basic Local Alignment Search Tool) pada GenBank NCBI. Selain itu,
sekuens dalam format FASTA tersebut juga akan memudahkan pemindahan text
antar-platform penyunting sekuens DNA ke pencari sekuens database GenBank pada
NCBI.

BAB III

ALAT, BAHAN, DAN CARA KERJA


I. ALAT DAN BAHAN
1. Sampel berupa urutan nukleotida (diberikan oleh DPP)
2. Laptop yang terhubung dengan internet

II. CARA KERJA


1. Dibuka laman NCBI
2. Dibuka program BLASTn
3. Sampel urutan nukleotida yang diberikan dimasukkan dalam bentuk
format FASTA
4. Klik BLAST
5. Ditunggu beberapa saat, akan tampil hasil analisis BLAST
6. Dilaporkan dan dibuat kesimpulan
7. Dibuka laman https://www.ebi.ac.uk/Tools/
8. Diketik “PROTEIN” pada Enter or paste a set of

9.

Diinput sampel urutan nukleotida dari semua kelompok


10. Ditunggu hasil
11. Dicatat hasil dan dilaporkan kesimpulan.

BAB IV

HASIL DAN PEMBAHASAN

I. HASIL PENGAMATAN
Sampel urutan nukleotida :
AATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCC
ATCGGATGTGCCCAGATG
GGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGG
TCTGAGAGGATGACCAG
CCACACTGGAACTGAGACACGGTCCAGACTCCTACGAAAGGCAGCAGTGGG
GAATATTGCACAATGAGCC
CAAGCCTGATGCAGCCATGCCGCGTGTAAGAAGAAGGCCTTCCGGGTGTAAA
GTAACTTCCAGCCGGGGA
AGAAGGGAGTAAAGTCAATACCTTTGCTCAATGACGTTAACCGGCAGAAGGA
AGCACCCGGCTAACTCCG
TGCCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAAATTACT
GGGCGTAAAGCGCACGCA
GGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCA
TCTGATACTGGCAAGCTT
GAGTCTCGTAGAGGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGA
GATCTGGAGGAATACCGG
TGGCGAAGGCGGCCCCCTGGACGAAGACTGACGCTCAGGTGCGAAAGCGTG
GGGAGCAAACAGGATTAGA
TACCCTGGTAGTCCACGCCGTAAACGATGTCGACTTGGAGGTTGTGCCCTTGA
GGCGTGGCTTCCGGAGC
TAACGCGTTAAGTCGACCGCCTGGGGAGTACGGCCGCAAGGGTTAAAACTCA
AATGAAATTGACGGGGGC
CCGCACAAGCGGGTGGAGCATGTGGTTTAATTCGATGCAACGCGGAAGAACC
CTTTACCCTGGGTCTTGA
CATCCACGGAAGTTTTTCAGAGATGAGAATGTGCCCTCCGGAACAGTGAGAC
AGGTGCTGCATGACTGTC
GTCAGCTCGTGCTGTGAAAGGATGGGTTAAGTCCCGCAACAAGCGCAACCAT
TATCCATTGATTGCCAGC
GGTCCGGCCGGGAACTCAAAGGAGACTGCCAGTGATAAACTGGAGGAAGGC
GGGGATGA

Hasil :
II. PEMBAHASAN
Cut Amiya Safitri (2016210050)
1. Pada praktikum kali ini dilakukan identifikasi secara molekuler
terhadap sampel berupa untaian gen. Setelah data diinput dan
dilakukan pemrosesan di website BLASTN, diperoleh mikroba
Escherichia coli. Untuk lebih spesifiknya adalah Escherichia coli
strain EcSD4 16S ribosomal RNA. Hal ini diamati dari persen
kemiripan yang tinggi yaitu hingga 100,00% dan merupakan satu-
satunya hasil dengan persen kemiripannya tertinggi. Pada urutan
kedua dengan persen kemiripan 96,15% diperoleh lebih dari satu
hasil, di antaranya Escherichia coli akan tetapi dari strain yang
berbeda.
2. Pada pohon filogeni, semakin dekat jarak cabang yang satu dengan
cabang yang lain berarti kekerabatan antarmikroba semakin dekat, dan
sebaliknya semakin jauh jarak cabang yang satu dengan cabang yang
lain berarti kekerabatan antarmikroba semakin jauh. Dari hasil yang
diperoleh dapat diamati bahwa mikroba-mikroba yang memiliki
kekerabatan yang dekat di antaranya mikroba 6 dengan 4, mikroba 2
dengan 1, dan mikroba 8 dengan 9. Sedangkan mikroba-mikroba yang
memiliki kekerabatan yang jauh di antaranya mikroba 6 dengan 11,
mikroba 4 dengan 10, dan mikroba 7 dengan 9.

Dana Fauziyah Rahmat (2016210052)


1. Pada percobaan ini dilakukan identifikasi mikroba secara molekuler
untuk dapat mengidentifikasi mikroba hingga tingkat gen. Sampel
berupa urutan gen dalam bentuk FASTA diinput dalam situs NCBI
pada BLASTn. Didapatkan %kemiripan sebesar 100,00% dengan
Escherichia coli strain EcSD4 16S ribosomal RNA, dan %kemiripan
sebesar 96,15% dengan Escherichia coli dengan tiga strain yang
berbeda. Diambil kesimpulan yang %kemiripannya mendekati
sempurna karena hanya terdapat satu hasil.
2. Setelah mendapatkan hasil identfikasi, sampel berupa urutan
nukleotida diinput kembali pada laman web www.ebi.ac.uk bersama
sampel urutan nukleotida kelompok lain untuk melihat
kekerabatannya dengan sampel lain. Dan didapatkan hasil berupa
pohon filogeni, yang menunjukkan bahwa sampel bakteri kelompok
kami memiliki kekerabatan dengan sampel bakteri kelompok 6, dan
memiliki kekerabatan yang jauh dengan sampel bakteri kelompok 11.

Daniel Immanuel (2016210054)

Identifikasi mikroba secara molekular adalah identifikasi mikroba


menggunakan materi genetik berupa DNA atau RNA mikroba. Metode ini
memiliki keunggulan dibanding metode konvensional, yaitu lebih cepat
dan tidak dipengaruhi faktor lingkungan, karena materi genetik relatif
stabil dalam berbagai kondisi. Materi genetik yang dibandingkan disebut
dengan kronometer molekular. Kronometer molekular memiliki beberapa
syarat, yaitu :

1. Merupakan makromolekul

2. Laju mutasinya konsisten atau cukup lama

3. Gen yang terdistribusi secara universal

4. Gen tersebut pasti menjadi atau mengekspresikan protein tertentu

5. Terdapat gen yang homolog dan heterolog

Pada bakteri, gen yang memenuhi syarat sebagai kronometer molekular


adalah
1. Pada prokariot (total 70s) : 16sRNA, karena panjang gennya
sesuai

2. Pada eukariot (total 80s) : 18sRNA

3. Fungi : ITS atau 18Srna

4. RNA Polymerase : RpoB

5. SOD (Super Oxide Dismutase)

Cara identifikasi mikroba secara molekuler:

1. Diambil sel

2. Dilakukan isolasi genom

3. Dilakukan isolasi Gen (16s rRNA)

4. Adanya primer yang berkomplemen dengan gen yang homolog untuk


mengetahui tempat penempelan pertama

5. Adanya PCR (Polymerase Chain Reactor)  16s rRNA

6. Dilakukan Analysist sequencing

7. Dimasukkan ke NCBI kemudian di blast  % identifikasi, % hemologi,


dan filogenetik

BAB V

KESIMPULAN DAN SARAN

I. KESIMPULAN
Cut Amiya Safitri (2016210050)
Bakteri yang teridentifikasi adalah Escherichia coli.
Dana Fauziyah Rahmat (2016210052)
Sampel urutan nukleotida merupakan Escherichia coli strain
EcSD4.
Daniel Immanuel (2016210054)
Sampel diidentifikasi sebagai Escherichia coli.
II. SARAN
Cut Amiya Safitri (2016210050)
Pastikan untaian gen yang diinput pada website sudah benar
agar hasil yang diperoleh memiliki %kemiripan yang
memenuhi syarat dan juga diperlukan koneksi internet yang
baik agar pemrosesan untaian gen tidak terhambat
Dana Fauziyah Rahmat (2016210052)
Untuk praktikum kedepannya praktikan dapat mengaplikasikan
situs tersebut untuk identifikasi dengan ketelitian dalam
penginputan data untuk memperoleh hasil yang akurat dan
pastikan untuk memiliki koneksi internet yang baik.
Daniel Immanuel (2016210054)
Disarankan untuk mengecek kembali setelah penginputan
sampel urutan nukleotida untuk meminimalisir kesalahan pada
hasil

DAFTAR PUSTAKA

1. Hadioetomo, R. S. 1993. Mikrobiologi Dasar dalam Praktek :


Teknik dan Prosedur Dasar Laboratorium. PT Gramedia Pustaka
Utama. Jakarta.
2. Singleton and Sainsbury. 2006. Dictionary of Microbiology and
Molecular Biology 3rd Edition. John Wileyand Sons. England.
3. Madigan, M.T., J.M. Martinko, and J. Parker. 2009. Biology of
Microorganisms 12th ed. New York: Prentice Hall International.