Journal of Life Sciences

Volume 4, Number 5, August 2010 (Serial Number 30)

David Publishing

David Publishing Company

www.davidpublishing.com
Publication Information:
Journal of Life Sciences (ISSN1934-7391) is published bimonthly in hard copy and online by David Publishing
Company located at 1840 Industrial Drive, Suite 160, Libertyville, Illinois 60048, USA.

Aims and Scope:

Journal of Life Sciences, a bimonthly professional academic journal, covers all sorts of research on botany, zoology,
microbiology, genetics, ecology, cytobiology, biochemistry, molecular biology and biophysics, as well as other
issues.

Editors:
Tina Z., August A., Pann T., Andrew Jackson C., Andy J., Lily L., Jim Q., Hiller H., Jane C., Betty Z., Gloria G., Stella
H., Alina Y., Ben Y., Hubert H., Ryan H.

Manuscripts and correspondence are invited for publication. You can submit your papers via Web Submission, or
E-mail to life-sciences@davidpublishing.com or info@davidpublishing.com. Submission guidelines and Web
Submission system are available at http://www.davidpublishing.com.

Editorial Office:
1840 Industrial Drive, Suite 160 Libertyville, Illinois 60048
Tel: 1-847-281-9826
Fax: 1-847-281-9855
E-mail: life-sciences@davidpublishing.com; info@davidpublishing.com

Copyright©2010 by David Publishing Company and individual contributors. All rights reserved. David Publishing
Company holds the exclusive copyright of all the contents of this journal. In accordance with the international
convention, no part of this journal may be reproduced or transmitted by any media or publishing organs (including
various websites) without the written permission of the copyright holder. Otherwise, any conduct would be
considered as the violation of the copyright. The contents of this journal are available for any citation. However, all
the citations should be clearly indicated with the title of this journal, serial number and the name of the author.

Subscription Information:
Price:
$96 (6 issues)

David Publishing Company

1840 Industrial Drive, Suite 160, Libertyville, Illinois 60048
Tel: 1-847-281-9826. Fax: 1-847-281-9855
E-mail: order@davidpublishing.com

Dav i d Pub li sh i ng

Dav id Publishing Company

w ww.davidpublis hing.com
 Journal of
Life Sciences
Volume 4, Number 5, August 2010 (Serial Number 30)

Contents
Research Papers
1 Study of Succinic Acid Production by Actinobacillus Succinogenes
Elcio Ribeiro Borges, Ludmylla Bastos Rocha de Souza and Nei Pereira Junior
9 Effectiveness of Some Plant Extracts on the Pupal Stage of Culex Quinquefasciatus (Diptera:
Culicidae)
Roqaya Mohammad Al Mehmadi
15 Isolation of Multi-Drug Resistant Paenibacillus sp. from Fertile Soil: An Imminent Menace of
Spreading Resistance
Pallavi B. Pednekar, Roopesh Jain, Narsinh L. Thakur and Girish B. Mahajan
20 Cultivation Practice of Pleurotus Fossulatus on Rice Straw
Nirmalendu Das, Protik Chowdhury and Birja Pasman
25 Identification of Genes for Powdery Mildew Resistance in Mungbean
Parinya Khajudparn, Sopone Wongkaew and Piyada Tantasawat
30 Expression of Recombinant Protein Bovine Prion pCIp264 in COS-7 Cells and Its Detection
Yaozhong Ding, Yongsheng Liu, Wenqian Liu, Yanping Ma, Meng Wang, Shenghai Yang and Jie Zhang
37 The Influence of Magnetite Nanoparticles on Human Leukocyte Activity
Anežka Džarová, Martina Dubničková, Vlasta Závišová, Martina Koneracká, Peter Kopčanský, Hubert
Gojzewski and Milan Timko
44 The Hepatoprotective Effects of Solanum Incanum on Acetaminophen-Induced Hepatotoxicity in
Guinea Pigs
Yahya Saleh Al-Awthan, Mohammed A. Salama and Ahmed M. Helal
49 Prolonged Production of L-DOPA Using Immobilized Aspergillus Terreus
Sankar Lal Poddar and Sharmila Chattopadhyay

Reviews
53 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicine Fungal
Yi Zhuang
Aug. 2010, Volume 4, No.5 (Serial No.30)
Journal of Life Sciences, ISSN 1934-7391, USA

Study of Succinic Acid Production by Actinobacillus

Succinogenes

Elcio Ribeiro Borges, Ludmylla Bastos Rocha de Souza and Nei Pereira Junior
Center of Technology, School of Chemistry, Federal University of Rio de Janeiro, Rio de Janeiro 21949-900, Brazil

Received: March 29, 2010 / Accepted: June 21, 2010 / Published: August 30, 2010.

Abstract: Succinic acid has recently emerged as an important chemical (commodity) because it can be used for the manufacturing of
synthetic resins and biodegradable polymers and as an intermediate for chemical synthesis. Till date, succinic acid is mainly produced
by chemical processes, however, due to the environmental concerns and the concepts of sustainability, researches are directed towards
the production of succinic acid by microbial fermentation. The fact that carbon dioxide (CO2) is needed by the microorganisms for
succinic acid production is another interesting feature. The fermentation was carried out with Actinobacillus succinogenes using a
two-level fractional factorial design 25-1. The variables analyzed and their levels were: concentration of glucose, yeast extract,
temperature, pH and agitation. The results show that the variables that more influenced on succinic acid production were pH,
temperature and yeast extract.

Key words: Organic acids, Actinobacillus succinogenes, fermentation, carbon dioxide.

1. Introduction petroleum. Today’s task is the development of useful

building-block chemicals that can be produced from
Presently, succinic acid is produced commercially
biomass and subsequently converted to several
by catalytic hydrogenation of petrochemical derived
high-value chemicals and materials. Building-block
maleic acid or maleic anhydride. Due to increasing
chemicals are molecules with multiple functional
global demands for oil and the emergence of
groups that can be transformed into new families of
environmental consequences from excessive using
usable molecules [5]. Microbial production of organic
fossil fuels, fermentative production of succinic acid
acids is a promising approach for obtaining
from renewable biomass by anaerobic bacteria has
building-block chemicals from renewable carbon
become more attractive economically [1]. Utilizing
sources. These processes are also favorable from a
renewable carbon source and greenhouse gas as
chemical and economic point of view [6].
substrates, bio-based succinic acid has remarkable
Succinic acid has been identified as one of the top 12
environmental benefits [2, 3], diversifying the potential
chemicals derived from lignocellulosic biomass [5, 7].
product portfolio of a biorefinery [4].
The market price of petrochemically produced succinic
A biorefinery is a facility that integrates biomass
acid is about US $ 5.9 - 8.8 kg-1 depending on its purity
conversion processes and equipment to produce fuels,
whereas the raw material costs based on production
power and chemicals from biomass. The biorefinery
from maleic anhydride are about US $ 1 kg-1 succinic
concept is analogous to today’s petroleum refineries,
acid [8]. The current production of chemicals based on
which produce multiple fuels and products from
succinic acid accounts to about 16,000 t/y [7]. However,
the market potential is estimated to be about 270,000
Corresponding author: Elcio Ribeiro Borges, Ph.D., t/y if succinic acid replaced maleic anhydride for all
research field: chemical engineering. E-mail: elcioeq@yahoo.
com.br. uses of the latter [1, 9-11]. Because of these predictions
2 Study of Succinic Acid Production by Actinobacillus Succinogenes
and the rising oil, price interest in succinic acid
production by fermentation processes is increasing.
Succinic acid, also known as amber acid or
butanedioic acid, is a dicarboxylic acid with the
molecular formula C4H6O4. Succinic acid can be used
as a precursor for the production of many industrial
chemicals fermentation for use in the agricultural, food
and pharmaceutical industries (for example, as surface-
tants, detergents, adipic acid, 1,4 butanediol, tetrahy-
drofuran, N-methyl pyrrolidinone, 2-pyrrolidinone,
succinate salts, gamma-butyrolactone, various green
solvents, biodegradable polymers such as polybutyrate
succinate (PBS), and ingredients to stimulate animal
and plant growth) [2, 10, 12, 13].
Various working groups are dealing with the fer-
mentation of succinic acid with strains of Anaerobios-
pirillum succiniciproducens, Actinobacillus succino-
genes, Mannheimia succiniciproducens [3, 14, 15],
recombinant Escherichia coli strains and Cory-
nebacterium glutamicum [16]. A. succinogenes shows
a distinctive ability to produce a relatively large
amount of succinic acid from a broad range of carbon
sources such as arabinose, cellobiose, fructose,
galactose, glucose, lactose, maltose, mannitol,
mannose, sorbitol, sucrose, xylose or salicin under
anaerobic conditions [17]. Actinobacillus succinogenes
is an anaerobic, gram-negative bacterium that naturally
produces high concentrations of succinate as a
fermentation end product in addition to formate,
acetate, and ethanol. Its CO2 concentration has been
shown to regulate the levels of key enzymes of the PEP
carboxykinase pathway in A. succinogenes at high CO2
levels. PEP carboxykinase levels rise, whereas alcohol
dehydrogenase and lactate dehydrogenase are not
detectable. Consequently, CO2 functions as an electron
acceptor and alters the flux of PEP, which metabolises
to pyruvate and lactate / ethanol at low CO2 levels but
makes succinate at high CO2 levels [18].
Usually, culture medium is important to the yield of
any fermentation products. The physiological and
nutritional factors such as initial sugar concentration,
complex nitrogen sources, carbonate ion
concentrations, pH and temperature of the growth
medium are reported to be the most critical factors
affecting both cell growth and succinic acid production
[19, 20]. The pH is an important factor that affects both
growth and growth-associated production of molecules.
Succinic acid production is a CO2 fixing process [21]
and the pH of the medium affects the solubility and the
availability of the CO2, it is therefore most critical
factor affecting succinic acid production [22, 23].
The carbon and nitrogen sources generally play a
significant role because these nutrients are directly
linked with cell proliferation and metabolite biosynthe-
sis [24]. The utilization of cheap carbon sources instead
of glucose is important for the cost-efficient production
of succinic acid. However, these influential factors
have not been studied systematically.
The fermentation cost of bio-based succinic acid is
however a key aspect for its competition with oil-based
succinic acid. Therefore, it is necessary to optimize the
culture conditions of A. succinogenes to improve
succinic acid production. Thus, being the objective of
this work is to verify the effect of process variables for
succinic acid production from glucose by
Actinobacillus succinogenese strain CIP 106512.
2. Experiment
2.1 Microrganism and Culture Medium
An Actinobacillus succinogenes strain (CIP 106512)
was obtained from the Pauster Institute. The culture
stock was maintained in Trypticase Soy Agar (TSA)
slants at 4 ℃. Inoculum (20 mL prepared in
trypticasein soy broth (TSB) sterile medium,
transferred to flask (150 mL)) was incubated at 150
rpm and 37 ℃ in an orbital shaking incubator (Marconi,
Piracicaba, Brazil) during 16 h, which was the time
necessary for the microorganisms to enter a
logarithmic phase of growth. Then the inoculum was
seeded in a medium whose composition was (in g/Ll)
glucose 20.0, yeast extract 10.0, NaHCO3 10.0, NaCl
1.0, MgSO4 0.05, K2HPO4 6.8, and NaH2PO4 15.5.
 Study of Succinic Acid Production by Actinobacillus Succinogenes 3

2- Manometer

4- Milipor
membrane CO2

3- Rotameter
0.05 vvm
1 - CO2
cylinder
6- Orbital shaking incubator

Fig. 1 Schematic circuit of the gas distribution in the fermentation.

2.2 Fermentation Assays

2.4 Analytical Methods
Batch fermentations were carried out in 500 mL
After growth, the cells necessary for each fermenta-
flask which containing 200 mL medium with CO2 as
tion assay were separated from media by centrifugation
the gas phase (Fig. 1). Media were inoculated with
at 8,000 rpm for 20 minutes, and their concentration
10%.(v / v) of inoculum in the same medium and
was determined by measuring the optical density of a
incubated at 150 rpm and 37 ℃ for 24-48 h. A
diluted sample at 600 nm (SPECTRUMLAB 22 PC),
separately autoclaved solution of carbohydrate was
using a standard curve of absorbance against dry cell
added aseptically to the medium after autoclaving.
mass.
2.3 Fractional Factorial Design The residual glucose concentration was measured in
the cell-free supernatant by the glucose oxidase-
The fermentation was carried out using a two-level
peroxidase method using an enzymatic kit (Laborclin,
fractional factorial design 25-1. The variables analyzed
Pinhais, Brazil). Succinic acid concentration produced
and their levels were (Table 1): concentrations of glu-
was estimated on high performance liquid chromate-
cose (20-40 g·L-1), yeast extract (5-11 g·L-1), tempera-
graphy (HPLC). The sample (20 µL) was injected into
ture (32-42 ℃), pH (6-8) and agitation (100-300 rpm).
a column (C18, 250 mm length 4.6 mm internal
The statistical significance was checked using
diameter column, 9 µm; StrodsII Peek) at a flow rate of
analysis of variance (ANOVA). The values of succinic
0.9 mL/min. Degassed and filtered sulfuric acid (0.01
acid concentration obtained and statistical significance
N) was used as the mobile phase [25]. Succinic acid
were analyzed by one-way ANOVA. The statistical
yield was defined as the amount succinic acid produced
Fractional Factorial Design (STATISTIC 6.0) software
from 1 g glucose expressed in percentage.
was used to investigate conditions to obtain high
succinic acid concentration. 3. Results and Discussion
Table 1 Factors and levels used in the experimental design. The experiments were performed using the statistical
Real levels methodology of response surfaces (RSM) and a Pareto
Parameters
-1 0 +1
chart, which are statistical models widely used to study
A- pH 6 7 8
B- Temperature (℃) 32 37 42
the aggregate effect of multiple variables and to seek
C- Yeast extract (g / L) 5 8 11 optimal conditions for a multivariable system [26].
D- Glucose (g / L) 20.0 30.0 40.0 Two-level fractional factorial design 25-1 leading to a
E- Agitation (rpm) 100 200 300 total number of 19 runs was generated (16 independent
4 Study of Succinic Acid Production by Actinobacillus Succinogenes

Table 2 Fractional factorial design 25-1 investigating effects of pH, temperature, yeast extract, agitation and glucose
concentration on final succinic acid concentration, yield and volumetric productivity.
Parameters Measured response
Experiment number (24 h) (48 h)
A B C D E QP YP / S Ef QP YP / S Ef
AS AS
(g / L·h) (g / g) (%) (g / L·h) (g / g) (%)
1 8 42 11 300 40 13.2 0.55 0.33 50.60 13.60 0.28 0.34 52.30
9 8 42 11 100 20 11.98 0.50 0.60 92.20 11.6 0.24 0.58 89.23
PC 7 37 7 200 30 9.05 0.38 0.30 46.30 9.43 0.19 0.31 48.30
PC: Center points (average of the values); A: pH; B: Temperature (℃); C: Yeast extract (g/L); D: Agitation; E: Initial glucose
concentration (g/L); AS: Succinic acid (g/L); QP: Productivity (g/L·h); YP/S: Product yield in relation to the substrate; Ef: Efficiency.

runs and 3 repetitions of the central point - Data not
shown). Final succinic acid concentration, volumetric
productivity and yield were the response variables in
all experiments.
Table 2 presents some of the final results, more
relevant to the fermentation process, which presented
larger values for final succinic acid concentration
(experiments 1 and 9, besides the results obtained with
the average of the 3 central points).
Analysis of these results showed that the concentra-
tion of succinic acid varied between 1.7 g·L-1 and 13.6
g·L-1, and that the largest concentrations, above 8.75
g·L-1, resulted from a pH adjustment to 7.0 (Data not
shown). Van der Werf et al. [18] reported that cell
growth was affected adversely at low pH, possibly
reflecting higher maintenance requirements at lower
pH values. The largest concentration of succinic acid
was obtained with the sample cultivated in experiment
number 1, with the following conditions: initial glucose
concentration of 40 g·L-1, yeast extract of 11.0.g·L-1,
temperature of 42 ℃, pH of 8.0 and speed agitation of
300 rpm, during 48 hours of fermentation. However,
the efficiency of the fermentation process depends on
the initial glucose concentration (experiment number 9,
with 20 g·L-1 of glucose, presents the greatest
efficiency).
According to the analysis of variances (ANOVA
-Data not shown), the best model for succinic acid
concentration was the Reduced Quadratic Model and
the values of R2 (0.992), pure error (0.056), which
show that the model is in accordance with the
experimental data.
Based on the effects of parameters using the Pareto
chart (Fig. 2), pH (parameter A) appears as the most
important parameter, followed by the parameter B
(temperature), parameter E (glucose), parameter C
(yeast extract), followed by the interactions between
the parameters, and finally agitation (parameter D),
which bore a lesser influence as independent variables
on succinic acid concentration. The parameter A
showed a positive effect, considering minimal
confidence range of 90% (P<0.1), indicating that in the
next trial its concentration should be further increased
(pH 7-10, for example). There are a few reports where
it has been observed that on increasing the pH to 7.2,
there was a decrease in succinic acid yield [21, 27].
The inhibitory effects of organic acids on microbial
growth have been known to depend on the pH of
culture broth [28, 29]. Similar has been reported by
Samuelov et al. [22] who studied the influence of pH
on the level of fermentative enzymes responsible for
end-product formation and found that in the cells
grown at pH 6.2, both the PPCK activity and succinic
acid production was high.
From these charts one can see that temperature
indicated a significative effect for 24 hours of
fermentation, and of low importance for a time of 48
hours. The analysis of ANOVA and Pareto chart shows
that agitation and yeast extract could be decreased
(down to 100 rpm, for example). The initial glucose
 Study of Succinic Acid Production by Actinobacillus Succinogenes 5

a b
Fig. 2 Pareto chart for pH (A), temperature (B), initial glucose concentration (E) and yeast extract (C) activities in the 25-1
factorial design after 24 (a) and 48 (b) hours of fermentation.

a b
Fig. 3 Responses surface plots showing the effect of pH (Parameter A) and temperature (Parameter B) and their combined
effects on final succinic acid concentration after 24 (a) and 48 (b) hours of fermentation.

and yeast extract concentration could be maintained at
20 g/L and 5 g/L, respectively, for next trial design
sequence, because these parameters showed a negative
and not significant effect (glucose p = 0.3056 and yeast
extract p = 0.1577) for 48 hours of fermentation.
However, concentrations of amino nitrogen (YE -
yeast extract) in the fermentation broth usually reflect
the concentrations of the protein and amino acids [30].
It has been shown that A. succinogenes is a fastidious
microorganism and YE (contains protein, lipid,
vitamins and others) supplied important growth factors
for succinic acid production, but its high cost is a
limitation for its application in industrial processes [31].
Recent reports for similar types of fermentations have
demonstrated that the nitrogen deficiency stimulated
the biosynthesis of other secondary metabolites such as
acetic and formic acid [32].
The Fig. 3 shows that the maximum succinic acid
concentration occurs when the parameter pH (A) and
temperature (B) are at their highest levels. The increase
in the pH associated with an increase in temperature
improved the efficiency and therefore generated a
higher final succinic acid concentration. Although
there is no tendency toward curvature in the ethanol 3D
plot, the maximum value is clearly reached, as it can be
seen in the plots of volumetric productivity. Similarly
M. succiniciproducens KCTC 0769 grew best and
produced succinic acid at 39 ℃ in 72 h, where the
effect of temperature on the activities of the enzymes
involved in the production of succinic acid (via the
reverse TCA cycle) was determined [33].
Finally, Table 3 shows results reported in literature
using strains in succinic acid fermentation as they
compare with those obtained in the current experiments.
6 Study of Succinic Acid Production by Actinobacillus Succinogenes

Table 3 Main results reported in literature for succinic acid production.

So (g/L) Qp (g/L·h) Yp/s (g/g) Carbon source Organism Cultivation Reference
35.6 1.01 0.82 Wheat Actinobacillus succinogenes Fed-batch [34]
58.3 1.08 0.62 Glucose Escherichia coli Fed-batch [35]
83.0 10.40 0.89 Glucose Anaerobiospirillum succiniciproducens Fed-batch / Eletrodialyis [36]
52.0 1.8 0.76 Glucose Mannheimia succiniciproducens Batch [37]
19.3 0.48 0.62 Glucose Actinobacillus succinogenes Shake flask (24 hours) [38]
19.3 0.25 0.59 Glucose Actinobacillus succinogenes Shake flask (48 hours) [38]
Borges et al.
20.0 0.51 0.60 Glucose Actinobacillus succinogenes Shake flask (24 hours)
(article in press)
Borges et al.
20.0 0.24 0.58 Glucose Actinobacillus succinogenes Shake flask (48 hours)
(article in press)

Regarding the other parameters, the variable yeast
extract was not significant, showing that a decrease in
the initial yeast extract concentration can be adopted.
The effect of variable temperature was positive but not
significant for the time of 48 hours. A maximum
succinic acid concentration of 35 g·L-1 was obtained by
some authors from A. succinogenes with 60 g·L-1 of
glucose in repeat-batch biofilm fermentation [31].
Similar results were obtained in this study; maximum
concentration of succinic acid achieved was 11.98 g·L-1
from 20.0 g·L-1 of glucose.
4. Conclusions
The sequential experimental design strategy used to
study the effects of parameters in the fermentation was
an important tool for maximizing final succinic acid
concentration through the response surface
methodology (RSM). It can be concluded that pH and
temperature show a greater effect on production of
succinic acid as compared with the concentration of
glucose, yeast extract and speed agitation, a fact that
has not yet been reported.
The maximum succinic acid concentration (13.60
g·L-1) occurs when the parameters (A) and (B) are at
their highest level (experiment of number 1), which
indicates that there exists a maximum. However, major
efficiency was obtained in experiment number 9, and
the analysis of the Pareto chart also depicted significa-
tive curvature for final succinic acid concentration of
11.98 g·L-1. The pH was shown to be a variable of high
statistical importance, as an increase in the value of pH
from 6.0 to 8.0 (ANOVA) resulted in an increase of 6.9
g·L-1 in succinic acid concentration.
Moreover, the values of the center points are close to
the maximum obtained in the studied range, indicating
the need to add axial points to a subsequent trial to
optimize succinic acid production, since that in
factorial design only linear models can be evaluated.
Thus, the next step could to evaluate succinic acid
production using the CCRD (central composite
rotational design) technique, since it enabled prediction
of the response surface with curvature plots and
visualization of the maximum values of the response
variables. The succinic acid concentration can still be
enhanced, as the center points are still lower than the
factorial points, showing an increasing tendency in the
direction of the maximum point.
Succinic acid is predicted to be one of the future
platform chemicals that can be derived from renewable
resources. Moreover, during the microbial production
of succinic acid, CO2 get fixed, thereby making
succinate a novel “green technology”.
Acknowledgments
The authors are grateful to the Brazilian Council for
Research (CNPq), the Rio de Janeiro Foundation for
Science and Technology (FAPERJ) and the Brazilian
Oil Company (PETROBRAS) for financial support of
this research.
 Study of Succinic Acid Production by Actinobacillus Succinogenes
References
[1] T.H. Willke, K.D. Vorlop, Industrial bioconversion of
renewable resources as an alternative to conventional
chemistry, App. Microbiol. Biotechnol. 66 (2004)
131-142.
[2] J.B. McKinlay, J.G. Zeikus, C. Vieille, Insights into
Actinobacillus succinogenes fermentative metabolism in a
chemically defined growth medium, Appl. Environ.
Microbiol. 71 (11) (2005) 6651-6656.
[3] I. Bechthold, K. Bretz, S. Kabasci, R. Kopitzky, A.
Springer, Succinic acid: a new platform chemical for
biobased polymers from renewable resources, Chem. Eng.
Technol. 5 (2008) 647-654.
[4] L.R. Lynd, C. Wyman, M. Laser, D. Johnson, R. Landucci,
Strategic biorefinery analysis: analysis of biorefineries,
National Renewable Energy Laboratory, Golden, CO.,
2002.
[5] T. Werpy, G. Petersen (Eds.), Top Value Added
Chemicals From Biomass, US Department of Energy,
2004, available online at http://www1.eere.energy.gov/
biomass/pdfs/35523.pdf.
[6] M. Sauer, D. Porro, D. Mattanovich, P. Branduardi,
Microbial production of organic acids: expanding the
markets, Trends Biotechnol. 26 (2) (2008) 100-108.
[7] M.A. Patel, Medium and long-term opportunities and risks
of the biotechnological production of bulk chemicals from
renewable resources-the potential of white biotechnology,
The BREW Project, 2006, available online at: http:
www.chem.uu.nl/brew/.
[8] H. Song, S.Y. Lee, Production of succinic acid by bacterial
fermentation, Enzym. Microbial. Technol. 39 (2005)
352-361.
[9] C. Delhomme, D. Weuster-Botz, F.E. Kühn, Succinic acid
from renewable resources as a C4 building-block chemical
– a review of the catalytic possibilities in aqueous media,
Green Chem. 11 (2009) 13-26.
[10] J.G. Zeikus, M.K. Jain, P. Elankovan, Biotechnology of
succinic acid production and markets for derived industrial
products, Appl. Microbiol. Biotechnol. 51 (1999)
545-552.
[11] Y.H. Zhang, Reviving the carbohydrate economy via
multi-product lignocellulose biorefineries, J. Ind.
Microbiol. Biotechnol. 35 (2008) 367-375.
[12] M.S. Rudner, S. Jeremic, K.A. Petterson, D.R. Kent, K.A.
Brown, M.D. Drake, Intramolecular hydrogen bonding in
disubstituted ethanes, A comparison of hydrogen bonding
through conformational analysis of 4-amino-4-
oxobutanoate (succinamate) and monohydrogen 1,4-
butanoate (monohydrogen succinate) anions, J. Phys.
Chem. A. 109 (2005) 9076-9082.
[13] H. Song, S.Y. Lee, Production of succinic acid by
7
fermentation, Enzyme. M. Technol. 39 (2006) 352-361.
[14] P. Zheng, J.J. Dong, Z.H. Sun, Y. Ni, L. Fang,
Fermentative production of succinic acid from straw
hydrolysate by Actinobacillus succinogenes, Bioresour.
Technol. 100 (2009) 2425-2429.
[15] D.Y. Kim, S.C. Yim, P.C. Lee, W.G. Lee, S.Y. Lee, H.N.
Chang, Batch and continuous fermentation of succinic
acid from wood hydrolyzate by Mannheimia
succiniciproducens MBEL55E, Enzyme. Microb. Technol.
34 (2004) 648-653.
[16] N. Okuda, K. Ninomiya, M. Takao, Y. Katakura, S. Shio-
ya, Microaeration enhances productivity of bioethanol
from hydrolyzate of waste house wood using ethanologe-
nic Escherichia coli KO11, J. Biosci. Bioeng. 103 (2007)
350-357.
[17] M.V. Guettler, M.K. Jain, B.K. Soni, Process for making
succinic acid, microorganisms for use in the process and
methods of obtaining the microorganisms, US patent,
March 3, 1998, pp. 5, 322, 723.
[18] M.J. Van der Werf, M.V. Guettler, M.K. Jain, Environ-
mental and physiological factors affecting the succinate
product ratio during fermentation by Actinobacillus sp.
130Z, J. Appl. Microbiol. 167 (1997) 332-342.
[19] P.C. Lee, W.G. Lee, S. Lee, H.N. Chang, Succinic acid
production with reduced by-product formation in the
fermentation of Anaerobiospirillum succiniciproducens
using glycerol as a carbon source, Biotech. Bioeng. 72
(2001) 41-48.
[20] N.P. Nghiem, B.E.S. Davison, G.R. Richardson,
Production of succinic acid by Anaerobiospirillum
succiniciproducens, Appl. Biochem. and Biotechnol.
63-65 (1) (1997) 565-576.
[21] P.C. Lee, W.G. Lee, S. Kwon, S.Y. Lee, H.N. Chang,
Succinic acid production by Anaerobiospirillum
succiniciproducens: effects of the H2 / CO2 supply and
glucose concentration, Enzyme. Microb. Technol. 24
(1998) 549-554.
[22] N.S. Samuelov, R. Lamed, S. Lowe, J.G. Zeikus,
Influence of CO2-HCO3 + levels and pH on growth,
succinate production and enzyme activities of
Anaerobiospirillum succiniciproducens, Appl. Environ.
Microbiol. 57 (1991) 3013-3019.
[23] R.P. Jones, P.F. Greenfield, Effect of carbon dioxide on
yeast growth and fermentation, Enzyme. Microb. Technol.
4 (1982) 210-223.
[24] J.L. Casas López, J.A. Sánchez Pérez, J.M. Fernández
Sevilla, F.G. Acién Fernández, E. Molina Grima, Y. Chisti,
Production of lovastatin by Aspergillus terreus: effects of
the C:N ratio and the principal nutrients on growth and
metabolite production, Enzyme. Microb. Technol. 33
(2003) 270-277.
[25] S.P. Martins, G.M. Titato, L.H. Mazo, Acompanhamento
8 Study of Succinic Acid Production by Actinobacillus Succinogenes
da Produção de Ácidos em Amostras de Leite Fermentado
por Fungos utilizando RP-HPLC, 29a Reunião Anual.
Sociedade Brasileira de Química (SBQ), Brasil, 2006. (in
Portuguese)
[26] G.E.P. Box, W.G. Hunter, J.S. Hunter, Statistics for
Experimenters: An Introduction to Design, Data Analysis,
and Model Building, John Wiley and Sons, New York,
1978.
[27] P.C. Lee, W.G. Lee, S.Y. Lee, H.N. Chang, Effects of
medium components on the growth of Anaerobiospirillum
succiniciproducens and succinic acid production, Process
Biochem. 35 (1999) 49-55.
[28] N.V. Narendranath, K.C. Thomas, W.M. Ingledew, Acetic
acid and lactic acid inhibition of growth of Saccharomyces
cerevisiae by different mechanisms, J. Am. Soc. Brew.
Chem. 59 (2001) 187-194.
[29] C. Vasseur, L. Baverel, M. H´ebraud, J. Labadie, Effect of
osmotic, alkaline, acid or thermal stresses on the growth
and inhibition of Listeria monocytogenes, J. Appl.
Microbiol. 86 (1999) 469-476.
[30] N. Pereira Jr., M.A.P.G. Couto, L.M.M. Santa Anna,
Series on Biotechnology: Biomass of Lignocellulosic
Composition for Fuel Ethanol Production within the
Context of Biorefinery, Rio de Janeiro, Amigadigital Press,
2008, p. 47. ISBN: 978-85-903967-3-4.
[31] S.E. Urbance, A.L. Pometto, A.A. DiSpirito, A. Demirci,
Medium evaluation and plastic composite support
ingredient selection for biofilm formation and succinic
acid production by Actinobacillus succinogenes, Food
Biotechnology 17 (2003) 53-65. doi:10.1081 /
FBT-120019984.
[32] S. Papanikolaou, S. Sarantou, M. Komaitis, G. Aggelis,
Repression of reserve lipid turnover in Cunninghamella
echinulata and Mortierella isabellina cultivated in
multiple-limited media, J. Appl. Microbiol. 97 (2004)
867-875.
[33] Y.S. Huh, Y.K. Hong, W.H. Hong, H.N. Chang, Selective
extraction of acetic acid from the fermentation broth
produced by Mannheimia succiniproducens, Biotechnol.
Lett. 26 (2004) 1581-1584.
[34] C.Y. Du, S.K. Carol Lin, A. Koutinas, R.H. Wang, P.
Dorado, C. Webb, A wheat biorefining strategy based on
solid-state fermentation for fermentative production of
succinic acid, Bioresour. Technol. 99 (2008) 8310-8315.
[35] H. Lin, C.E. Wyman, Fed-batch culture of a metabolically
engineered Escherichia coli strain designed for high-level
succinate production and yield under aerobic conditions,
Biotechnol. Bioeng. 90 (2005) 775-779.
[36] I. Meynial-Salles, S. Dorotyn, P. Soucaille, A new process
for the continuous production of succinic acid from
glucose at high yield, titer and productivity, Biotechnol.
Bioeng. 99 (2008) 129-135.
[37] S.Y. Lee, Production of succinic acid by bacterial
fermentation, Enzyme. Microb. Technol. 39 (2006)
352-361.
[38] R.M. Alegre, T.A. Gonzales, B.T. Ubeda, L.O. Santos,
Produção de ácido succínico: uso da ferramenta de
planejamento experimental fatorial para otimização do
processo, 09 / 2008, XVII Congresso Brasileiro de
Engenharia Química - COBEQ - 2008,Vol. cd rom, Recife,
PE, Brasil, 2008. (in Portuguese)
Aug. 2010, Volume 4, No.5 (Serial No.30)
Journal of Life Sciences, ISSN 1934-7391, USA

Effectiveness of Some Plant Extracts on the Pupal Stage

of Culex Quinquefasciatus (Diptera: Culicidae)

Roqaya Mohammad Al Mehmadi

Dept. of Zoology, Girls College of science, King Abdul-Aziz University, Jeddah 21445, Saudi Arabia

Received: May 4, 2010 / Accepted: July 3, 2010 / Published: August 30, 2010.

Abstract: This study aims to evaluate the effectiveness of plant extracts Artemisia herba-alba, Matricharia chamomella, and Melia
azedarach against the Culex quinquefasciatus. The following concentrations were used to assess the effectiveness of A. herba-alba, M.
chamomella, and M. azedarach: 0.50, 1.00, 1.50, 2.00, 2.50 and 3.00 mg/L; 0.12, 0.25, 0.50, 0.75, 1.00 and 1.50 mg/L and 0.50, 0.75,
1.00, 1.50, 1.75 and 2.00 mg/L, respectively. The mortality rates of the mosquito pupae were measured after 24 hours. It was found that
the LC50 was 0.50, 1.00 and 1.80 mg/L of M. chamomile, M. azedarach, and A. herab-alba respectively which mean that M.
chamomella extracts had the best pesticide effects against Cx. Quinquefasciatus pupae where was A. herba-alba the lower of them.

Key words: Culex quinquefasciatus, botanical extracts, pupa, Artemisia herba-alba, Matricharia chamomella, Melia azedarach,
mosquito control.

1. Introduction [14] and Momordica charantia (Cucurbitaceae) [15].

The control of mosquito-transmitted diseases is
The efficiency of botanical extracts against insects
becoming difficult because of increasing resistance of
has been recorded by a number of researchers [1-5].
mosquitoes to pesticides [16]. A new approach for
Azadirachta indica extract is a botanical extracts that
mosquito control is the use of natural plant-based
has raised a wide range of interest for its high
products, botanical insecticides are generally pest
efficiency against various types of pests in general,
specific, readily biodegradable, and usually lack
particularly insects. It has been reported that several
toxicity to non-target animals [17]. Extensive studies
plants from various families have mosquitocidal effects,
were conducted in order to assess the role of botanical
and some have been effectively applied in the
extracts in pest management programs [18-22]. This
environment. The current lack of application of these
study aims to assess the efficiency of Artemisia herba-
extracts may be due to the light and heat instability of
alba, Matricharia chamomella and Melia azedarach
phytochemicals, compared to synthetic insecticides [6].
botanical extracts as safe and natural pesticides against
Examples of mosquitocidal extracts include: Polyal-
the pupae of the Culex quinquefasciatus mosquito.
thia longifolia (Annonanceae) [7], Mentha piperita
(Labiatae) [8], Citrus spp. (Rutaceae) [9, 10], Tagetes 2. Materials and Methods
errecta (Compositeae), Ocimum sanctum (Labiatae),
2.1 Colony Foundation
Dalbergia sisco Roxb (Leguminasae) [11], Solanum
nigrum (Solanaceae) [12], Atlantia monophylla (Ruta- This study used Cx. quinquefasciatus, which has
ceae) [13], Azadirachta indica (Meliaceae) 112 plants been already reared for multiple generations. The
colony consists of sensitive Cx. quinquefasciatus
Corresponding author: Roqaya Mohammad Al Mehmadi, larvae obtained from the College of Agriculture / Plant
Ph.D., associate professor, research field: zoology and entom- Protection Department, King Saud University, Riyadh.
ology. E-mail: d_almehmadi@yahoo.com.
10 Effectiveness of Some Plant Extracts on the Pupal Stage of Culex Quinquefasciatus (Diptera: Culicidae)

The colonies were established under appropriate 95% confidence limits [24]. Regression lines were
laboratory conditions throughout the study period (75 drawn, showing the relationship between the rates of
± 5% RH, 26 ± 1 ℃), and as soon as the larvae molted mortality in the treated pupae and the used
into the pupal stage, they were collected via suction concentrations (LC-P Log Concentration lines) by
pipetae into 450 mL plastic cups filled halfway with using the draw lines regression (LdP Line). From this,
water. The cups were placed inside the rearing cages, we selected the required concentration, expressed in
along with a sugar syrup food source, which is for both mg/L, to kill 50% LC50 of treated pupae.
male and female newly pupae.
3. Results
2.2 Preparation of Stock Solution
The efficiency of botanical extracts have been
Ethanolic extract from a whole plant of A. studied in the current study using different
herba-alba, M. chamomella, and M. azedarach were concentrations of each extract against new pupae of the
obtained from Pharmacy College, King Saud Cx. quinquefasciatus mosquito. The results show that
University. This extract was dark green and crude, and botanical extracts have a significant effect on treated
was used to prepare stock solution. The known amount pupae compared to non-treated pupae, where treatment
(10 mg/L) of filtered crude extract obtained from the with botanical extracts led to increased mortality rates.
above source was serially diluted to obtain the desired Table 1 and Fig. 1 illustrate the effect of different
concentration of each plant. The stock solution was concentrations of A. herba-alba extract (between
gradually diluted to prepare test solutions of 0.50-3.00 mg/L) on Cx. quinquefasciatus pupae. It is
concentrations. One drop of emulsifier (Tween 20, evident from the table that the mortality rate of pupae
Sigma Chemical Company) was mixed with the extract ranges between 13.33 - 86.667% and the regression
to ensure complete solubility of the material in water. line been drawn, representing the relationship between
the mortality rates and the extract concentrations (Fig.
2.3 Procedures of Study 1). The regression line (Lc - p line) has been used to
determine the value of the concentration required to kill
The ethanolic extracts of A. herba-alba, M.
50% of the treated pupae (LC50) (1.854 mg/L), the
chamomella and M. azedarach were tested under
value of the slope of the regression line is equal to 2.62
laboratory conditions to study the efficiency of these
± 0.45. Furthermore, Chi and tabular values of the data
botanical extracts against the pupae of Cx.
(Factual) were found to be 7.2 and 9.5, respectively, at
quinquefasciatus. The new pupae were divided into
three replicates, each containing 10 pupae/20 mL Table 1 Percentage mortality of pupal stage of Cx.
quinquefasciatus after being treated with different
concentrations of A. herba-alba (0.50, 1.00, 1.50, 2.00,
concentrations of A. herba-alba extracts.
2.50, 3.00 mg/L), M. chamomella (0.12, 0.25, 0.50,
Mortality Mortality
Conc. No. of Liner log. Liner
0.75, 1.00, 1.50 mg/L), M. azedarach (0.50, 0.75, 1.00, “observed” “expected”
(mg/L) pupae (con. *10) probit
(%) (%)
1.50, 1.75, 2.00 mg/L); in addition, another group
0.50 30 13.333 6.802 0.699 3.509
containing 30 pupae divided to three replicates of 10 1.00 30 20.000 24.116 1.000 4.297
pupae were used for comparison. Mortality rates were 1.50 30 33.333 40.469 1.176 4.759
recorded for treated pupae against different 2.00 30 40.000 53.433 1.301 5.086
concentrations after 24 hours of exposure, and were 2.50 30 63.333 63.309 1.398 5.340
3.00 30 86.667 70.800 1.477 5.548
corrected using Abbott’s formula [23]. Results were
Control 30 0 0 0 0
analyzed according to the method of Ref. 24 to Slope 2.62 ± 0.454. Chi: 8.775 tabulated 9.5. r: 0.902 tabulated
determine the LC50 and LC95 values, as well as their 0.81.
 Effectiveness of Some Plant Extracts on the Pupal Stage of Culex Quinquefasciatus (Diptera: Culicidae) 11

1 M. chamomella
2 M. azedarach
3 A. herba-alba

Fig. 1 Comparing of efficacy of A. herba-alba, M. azedarach, M. chamomella extracts against pupae of Cx. quinquefasciatus
mosquito.

the degrees of freedom (n - 2), which indicates Table 2 Percentage mortality of pupal stage of Cx. quinq-
uefasciatus after being treated with different concentrations
homogeneity in the mortality rates. The results also
of M. chamomilla extracts.
show a strong relationship between concentration and Mortality Mortality
Conc. No. of Liner log. Liner
mortality rate: the Correlation Coefficient (r) was 0.902, “observed “expected
(mg/L) pupae (con. *10) probit
” (%) ” (%)
as shown in Table 1.
0.12 30 13.333 13.175 0.079 3.88
Table 2 illustrates the effect of different 0.25 30 33.333 29.165 0.398 4.45
concentrations of M. chamomilla extract (0.12 - 1.50 0.50 30 46.667 49.578 0.699 4.98
mg/L) on Cx. quinquefasciatus pupae; the mortality 0.75 30 56.667 61.948 0.875 5.30
1.00 30 66.667 70.104 1.000 5.53
rate ranged from 13.33 - 86.67%. The regression line
1.50 30 86.667 80.015 1.176 5.84
(Fig. 1) (Lc - p line) has been used to determine the Control 30 0 0 0 0
concentration required to kill 50% of the treated pupae Slope: 1.787 ± 0.294. Chi: 1.711 tabulated 9.5. r: 0.98 tabulated
(LC50) value (0.507 mg/L). The value of the slope of 0.811.

the regression line is 1.787 ± 0.294. Furthermore, the Table 3 Percentage mortality of pupal stage of Cx. quinq-
Chi and tabular values of the data (Factual) were 1.711 uefasciatus after being treated with different concentrations
of M. azedarach extracts.
and 9.5, respectively, at the degrees of freedom (n - 2),
Mortality Mortality
indicating homogeneity in the obtained rates of Conc. No. of Liner log. Liner
“observed” “expected”
(mg/L) pupae (con. *10) probit
mortality. The results also show a strong relationship (%) (%)
0.50 30 13.333 10.793 0.699 3.762
between concentration and mortality (r = 0.98), as
0.75 30 30.000 28.087 0.875 4.420
shown in Table 2. 1.00 30 40.000 45.477 1.000 4.886
Table 3 shows the effect of M. azedarach (0.50 - 1.50 30 63.333 70.676 1.176 5.544
2.00 mg/L) on Cx. quinquefasciatus pupae. Mortality 1.75 30 76.667 78.638 1.243 5.794
2.00 30 93.333 84.384 1.301 6.011
rates range from 13.33-93.33%. The regression line
Control 30 0 0 0 0
was drawn to indicate the relationsip between the
Slope: 3.735 ± 0.532. Chi: 3.303 tabulated 9.5. r: 0.964
mortality rates and the concentrations of M. azedarach tabulated 0.81.
12 Effectiveness of Some Plant Extracts on the Pupal Stage of Culex Quinquefasciatus (Diptera: Culicidae)
Table 4 Comparing of efficacy of three plant extracts against pupae of Cx. quinquefasciatus mosquito after treated.
No. Line name LC50 Lower limit Upper limit
1 M. chamomilla 0.507 0.385 0.659
2 M. azedarach 1.073 0.934 1.218
3 A. herba-alba 1.854 1.554 2.269
Index Compared with M. chamomilla. Resistance Ratio (RR) Compared with M. chamomilla.
(Fig. 1). Furthermore, the regression line (Lc - p line)
shows an LC50 value of 1.07 mg/L, with a regression
line slope of 3.735 ± 0.532. The Chi and tabular values
were calcutaed to be 3.303 and 9.5, respectively,
revelaing homogeneity in the mortality rates. In
addition, there is a strong relationship between
concentration and mortality rates: r = 0.964.
When comparing the efficiency of the three
botanical extracts (Table 4 and Fig. 1), it is clear that M.
chamomilla extract was more efficient, followed by M.
azedarach extract and finally, A.herba-alba extract.
Based on the results recorded in Table 4, the values of
the slope of the toxicity lines of the botanical extracts
that specified for each plant extracts against the pupae
of Cx. quinquefasciatus differed: 2.62, 3.735, and
1.787, respectively. Botanical extracts have a
significantly increased the mortality rates of treated
pupae compared to non-treated pupae.
4. Discussion
Environmental safety with regard to insecticides is
very important in today’s culture.
Phytochemicals could be a suitable alternative to
synthetic insecticides in the future; they are
inexpensive, safer, and available naturally in many
parts of the world. The extraction of locally available
medicinal plants for mosquito control can reduce
dependence on more expensive products, and can
stimulate local efforts to enhance public health [25].
Ethanolic extracts of A. herba-alba, M. chamomilla
and M. azedarach are found to be effective pupal
pesticides and regulators of growth against the pupal
stage of the Cx. quinquefasciatus mosquito.The
extracts used in this study clearly demonstrated an
effect in stopping the process of pupal molting and thus
1 2 3 Index RR Slope Slope ± LC50 LC90
* 100.0 1.00 1.787 0.294 0.507 2.642
* 47.251 2.116 3.735 0.532 1.073 2.364
* 27.346 3.657 2.620 0.454 1.854 5.718
reducing the emergence of adult insects. The results
show that pupae treated with M. chamomilla had the
0.50 mg/L of LC50, followed by those treated with M.
azedarch 1.0 mg/L, and A. herba-alba 1.8 mg/L. These
results corroborate with those of N. Prabhaker, et al.
[26], where pupae did not molt when the fifth instar
larvae of Trichoplusia ni and Spodoptera exigua were
fed on artificial food that was mixed with A.indica seed
extract at concentrations of 0.02, 0.2, and 2% (w / v).
N.Z. Dimetry, et al. also found that the ethanolic
extract of Curcuma longa has a clear effect on Aphis
craccivora, and that high concentrations were the most
effective in reducing the reproduction, life span, and
growth of nymphs while also prolonging the pupal
stage and the occurrence of malformation [27]. The
results of these ethanolic extracts may be attributed to
the fact that alcohol solvent is a polar solvent that can
extract all natural plant materials [28]. The biological
activity observed in the botanical extracts used in this
study may be due to their active components: santonin,
azadirachtin, and azulene in A. herba-alba, M.
azedarch, and M. chamomilla, respecitively. Since
ancient times, the effects of plants on insects has been
well known; some plants may protect themselves from
pests by producing secondary metabolites. Extracts
from seeds of the tropical Meliaceae family show
inhabitation growth activity [29]. Furthermore, H.
Rembold has found that Corporous cardiacum is a
target organ for azadirachtin [30], which affects insect
neuroendocrine activity [31] is neurosecretory in L.
migratoria [32].
Research on the effects of plants as insect growth
inhibitors has extended to other members of the
Meliaceae family, such as Azadirachta indica; it was
found that the fruits of the Melia volkensii plant
 Effectiveness of Some Plant Extracts on the Pupal Stage of Culex Quinquefasciatus (Diptera: Culicidae)
showed antifeedant activity and growth inhibiting
activiy against the desert locust, Shistocerca gregaria
[33, 34] also found that the acetone extract of M.
volkensii seeds is a growth inhabitor against Ae.
aegypti mosquito larvae.
References
[1] A. Kumar, G.P. Dutta, Indigenous plant oils as larvisidal
agent against Anopheles stephensi mosquitoes, Curr. Sci.
18 (1987) 956-960.
[2] T.T. Subramonia, K. Kathiresan, Toxic effect of seaweed
extracts on mosquito larvae, Indian J. Med. Res. 88 (1988)
35-37.
[3] B.A. Soliman, L.S. El-Sherif, Larvicidal effect of some
plant oils on mosquito culex pipiens L. (Diptera:culicidae),
J. Egypt Ger. Soc. Zool. 16 (E) (1995) 161-169.
[4] M.M. El-Bokl, H.M. Moawad, Evaluation of some plant
extracts as mosquito larvicides, Ain. Shams. Sci. Bull. 34
(1996) 351-362.
[5] L.A. El-Shareef, Population dynamics and study of
bioactivity of neem seed extract on the whitefly Bemisia
tabaci (Gennadius) (aleyrodidae: Homoptera) infesting
tomato plant in Jeddah, Ph.D. Thesis, College of Science,
King Abdul-Aziz University, Saudi Arabia, 2003.
[6] M. Green, J.M. Singer, D.J. Sutherland, C.R. Hibben,
Larvicidal activity of Tagetus minuta (marigold) towards
Aedes aegypti., J. Am. Mosq. Cont. Assoc. 7 (1991)
282-290.
[7] U.S. Murty, K. Sriram, J. Kaiser, Effect of leaf extract of
Polyalthia longifolia (Family: Annonaceae) on mosquito
larvae and pupae of Culex quinquefasciatus (Diptera:
Culicidae) of different habitats, Int. Pest Cont. 39 (1997)
52-57.
[8] M.A. Ansari, P. Vasudevan, M. Tandon, R.K. Razdan,
Larvicidal and mosquito repellent action of peppermint
(Mentha piperita) oil, Bioresource Technol. 71 (1999)
267-275.
[9] M.A. Al Dakhil, T.A. Morsy, The larvicidal activities of
the peel oils of three citrus fruits against Culex pipiens, J.
Egypt. Soc. Parasitol. 29 (1999) 347-351.
[10] F.C. Ezeonu, G.I. Chidume, S.C. Udedi, Insecticidal
properties of volatile extracts of orange peels, Bioresource
Technol. 76 (2001) 273-280.
[11] N. Pathak, P.K. Mittal, O.P. Singh, S. Vidya, P.
Vasudevan, Larvicidal action of essential oils from plants
against the vector mosquitoes Anopheles stephensi
(Liston), Culex quinquefasciatus (Say) and Aedes aegypti
(L.), Int. Pest Cont. 42 (2000) 53-58.
[12] S.P. Singh, K. Raghavendra, R.K. Singh, S.K. Subbarao,
Studies on larvicidal properties of leaf extract of Solanum
13
nigrum Linn (Family: Solanaceae), Curr. Sci. 81 (2002)
1529-1536.
[13] N. Sivagnaname, M. Kalyanasundaram, Laboratory
evaluation of methanolic extract of Atlantia monophylla
(Family: Rutaceae) against immature stages of mosquitoes
and non-target organisms, Mem. Inst. Oswaldo Cruz. 99 (1)
(2004) 115-118.
[14] F.G. Obomanu, O.K. Ogbalu, U.U. Gabriel, G.K.
Fekarurhobo, B.I. Adediran, Larvicidal properties of
Lepidagathis alopecuroides and Azadirachta indica on
Anopheles gambiae and Culex quinquefasciatus, Afr. J.
Biotechnol. 5 (9) (2006) 761-765.
[15] R.K. Singh, R.C. Dhiman, P.K. Mittal, Mosquito
larvicidal properties of Momordica charantia Linn
(Family: Cucurbitaceae), J. Vect. Borne. Dis. 43 (2006)
88-91.
[16] H. Ranson, L. Rossiter, F. Ortelli, B. Jensen, X. Wang,
C.W. Roth, et al., Identification of a novel class of insect
glutathione S-transferases involved in resistance to DDT
in the malaria vector Anopheles gambiae, Biochemical J.
359 (2001) 295-304.
[17] W.S. Bowers, Biorational approaches for insect control,
Korean J. of Applied Entomology 31 (1992) 289-303.
[18] W. Thorsell, Efficacy of plant extracts and oils as
mosquito repellents, Phytomedicine 5 (1998) 311-323.
[19] S. Chockalingam, S. Thenmozhi, M. Sundari, Larvicidal
activity of different products against mosquito larvae, J.
Environ. Biol. 11 (2) (1990) 101-104.
[20] L.A.D. Williams, M. Ajay, Pesticidal potentials of tropical
plants I. Insecticidal activity in leaf extracts of sixty plants,
Insect Science and Its Application 14 (5-6) (1993)
697-700.
[21] R.O. Akinkurolere, C.O. Adedire, O.O.O. Deyemi,
Laboratory evaluation of the toxic properties of forest
acnchomanes, Anchomanes difformis against pulse beetle
Callosobruchus maculates (Coleoptera:Bruchidae), Insect
Sci. 13 (2006) 25-29.
[22] R.O. Akinkurolere, Assessment of the insecticidal
properties of Anchomanes difformis (P. Beauv.) powder on
five beetles of stored produce, Journal of Entomology 4 (1)
(2007) 51-55.
[23] W.S. Abbott, A method for computing effectiveness of an
insecticide, J. Econ. Entomol. 18 (1925) 265-267.
[24] D.J. Finney, Probit Analysis, 3rd ed. Cambridge Univ.,
Cambridge, 1971.
[25] W.S. Bowers, B. Sener, P.H. Evans, F. Bingol, I. Erdogan,
Activity of Turkish medicinal plants against mosquitoes
Aedes aegypti and Anopheles gambiae, Insect Sci. Applic.
16 (3, 4) (1995) 339-342.
[26] N. Prabhaker, D.L. Coudriet, A.N. Kishaba, D.E.
Meyerdirk, Laboratory evaluation of neem-seed extract
against larvae of the cabbage looper and beet army-worm
14 Effectiveness of Some Plant Extracts on the Pupal Stage of Culex Quinquefasciatus (Diptera: Culicidae)
(Lepidoptera: Noctuidae), J. Econ. Ent. 79 (1986) 39-41.
[27] N.Z. Dimetry, F.M. El-Hawary, Response of the cowpea
aphid Aphis craccivora (kock) to alcohol extract of
different plants, J. Egypt. Ger. Sac. Zool. 18 (E) (1995)
27-40.
[28] H.S. Mohammed, Effecacy of eleven plant extracts on the
oviposition activity of Spodoptera littoralis (Boisduval)
(Lepidoptera: Noctoidae), J. Egypt. Ger. Soc. Zool. 17 (E)
(1993) 161-171.
[29] H. Schmutterer, K.R.S. Ascher, Natural pesticides from
the neem tree and other tropical plants, Proc. Third Int.
Neem Conference, German Agency Technical Coop
(GTZ), Eschborn, 1987.
[30] H. Rembold, Azadirachtins: Their structure and mode of
action, in: J.T. Arnason, B.J.R. Philogene, P. Morland
(Eds.), Insecticides of Plants Origin, ACS Symp. Ser., Vol.
387, 1989, pp. 150-163.
[31] B. Subrahmanyam, H. Rembold, Effect of azadirachtin A
on neuroendocrine activity in Locusta migratoria, Cell
Tissue Res. 256 (1989) 513-517.
[32] B. Subrahmanyam, T. Muller, H. Rembold, Inhibition of
turnover of neurosecretion by azadirachtin in Locusta
migratoria, J. Insect Phsiol. 29 (1989) 523-527.
[33] R.W. Mwangi, Locust antifeedant activity in fruits of
Melia volkensii, Entomol. Exp. Appl. 32 (1982) 277-280.
[34] R.W. Mwangi, T.K. Mukiama, Evaluation of Melia
volkensi extract fractions as mosquito larvicides, J. Am.
Mosq. Cont. Assoc. 4 (1988) 442-447.
Aug. 2010, Volume 4, No.5 (Serial No.30)
Journal of Life Sciences, ISSN 1934-7391, USA

Isolation of Multi-Drug Resistant Paenibacillus sp. from

Fertile Soil: An Imminent Menace of Spreading
Resistance

Pallavi B. Pednekar1, Roopesh Jain2, Narsinh L. Thakur3 and Girish B. Mahajan2

1. Department of Biotechnology, The KET’s V.G.Vaze College, Mumbai University, Navi-mumbai 400709, India
2. Department of Natural Products, Piramal Life Sciences Limited, Mumbai 400063, India
3. Bio-organic Chemistry Laboratory, National Institute of Oceanography (CSIR), Goa 403004, India

Received: April 7, 2010 / Accepted: June 9, 2010 / Published: August 30, 2010.

Abstract: There are a good number of reports in the literature stating spread of resistance from normal soil flora to nosocomial
microorganism through various ways. Similarly during the study of antimicrobial susceptibility pattern in the microflora, a multi-drug
resistant bacterium has been isolated from soil collected in Maharashtra state (India). The bacterium exhibited a resistance to various
classes of antibiotics namely glycopeptide, beta-lactams, aminoglycosides, macrolides and lincosomides. The bacterial strain showed
its resemblance to the genus Paenibacillus. This constitutes the first report of its kind as to the multi-drug resistance trait in the genus
Paenibacillus phenotype, especially in close phylogenetic neighbour of Paenibacillus daejeonensis. The resistance pattern displayed
by this strain particularly highlights the possible presence of multiple resistant determinants in microflora of the soil rhizosphere. In
view of the recent reports about the Paenibacillus spp. in clinical derived strains, such multi-drug resistance factors in this genus adds to
menace of transmission of resistance to common soil originating pathogen. The data also supports the fact that the resistances to certain
antibiotics need not always be due to exposure to particular antibiotic or similar substance.

Key words: Paenibacillus daejeonensis, multi-drug resistant, Paenibacillus.

1. Introduction Resistant Enterococci (VRE) has been well reported

[3]. P. thiaminolyticus and P. apiarius are also known
The genus Paenibacillus, belonging to group III of
to harbour putative D-Ala:D-Lac ligase genes flanked
the class Bacilli [1], has been reported from a variety of
by vanH and vanX-like genes which are closely related
sources including soil, water, plants and insect larvae
to van A operon of Enterococci [4]. Recently
[2]. Majority of the bacilli of this group are all strict
widespread resistance to Oxytetracycline has been
aerobes. Group III species are perhaps taxonomically
demonstrated in P. larvae, a primary pathogen of
the least satisfactory and are rather physiologically
honey bees [5]. Different species of Paenibacillus seem
heterogeneous. The genus Paenibacillus does reflect
to harbour resistance to different classes of antibiotics.
physiological heterogeneity. Paenibacillus in its due
Paenibacillus sanguinis, Paenibacillus massiliensis
course of time has been to have acquired resistance to
are already reported as atypical clinical isolates
the antibiotic Vancomycin. The presence of
associated with humans [6]. This probes as possible
vancomycin resistance gene cluster in Paenibacillus
threat of spread of resistance into hospital derived
popilliae homologous to vanA of Vancomycin
pathogens through Paenibacillus spp.
Corresponding author: Girish B. Mahajan, Ph.D., research In this investigation, the authors found a multi-drug
fields: microbiology and antimicrobial. E-mail: girish.mahajan resistant trait in Paenibacillus spp. strain MDR-1
@piramal.com.
16 Isolation of Multi-Drug Resistant Paenibacillus sp. from Fertile Soil: An Imminent Menace of Spreading
Resistance

(Accession No. EU026352). The strain has been cephalothin, ceftriaxone, ceftazidime, cephotaxime,
isolated from the fertile soil in the western region of the gentamicin, netillin, amikacin, ciprofloxacin, nalidixic
Maharashtra state (India). The strain is multi-resistant acid, ofloxacin, norfloxacin, lincomycin, clindamycin,
to existing principle antibiotics currently under use for co-trimazine, co-trimoxazole, nitrofurantoin, chloram-
the treatment of infections caused by both Gram phenicol, oxytetracycline, were chosen on the basis of
positive and Gram-negative microbes. their ability to provide diversity for representation of
different antibiotic classes, which are currently under
2. Materials and Methods
use. The soil isolates were grown in Soybean Casein
2.1 Microbial Isolation Broth, SCB (HiMedia, Mumbai) for 18-20 hrs. The
turbidity of the culture broth was adjusted to obtain
The soil samples were collected from agricultural
absorbance of 0.3-0.45 at 560 nm. Mueller-Hinton
field from Dahanu, a tiny village, 145 km north of
medium agar was swabbed with the culture. The discs
Mumbai. Samples were collected from 0.6-1.0 feet
of mentioned 25 antibiotics (HiMedia, Mumbai) were
depth of a quadrant at five different locations in the
placed in upright position on the surface of the test
fertile fields and the samples were immediately
plates. After incubation of the plates at 37 ℃ for 18-24
transferred into sterile sampling containers. All the
hrs, the plates were scored for growth by measuring the
samples were transported to Piramal Life Sciences
diameter of the zone of inhibition with respect to each
Limited (PLSL), Mumbai, India for bacterial isolation.
disc (6 mm diameter) by using a digital Vernier-
The soil samples were processed within 24 hrs of
Calliper. For the bacteria of the family Bacilliaceae the
collection. The samples were serially diluted using
zone of inhibition of ≤ 12 mm was considered resistant
sterile saline and the appropriate dilutions were surface
and ≥ 35 mm was considered sensitive [10]. As
spreaded onto the isolation medium - Soybean Casein
specifications for the zones between 12-35 mm were
Digest Agar, SCDA (HiMedia, Mumbai) and incubated
not available in The National Committee for Clinical
at 30 ℃ for 4 weeks. Amphotericin B (20 μg/mL) was
Laboratory Standards (NCCLS) [10], antibiotics
incorporated into this medium to inhibit possible
showing zones of inhibition in this range are recorded
fungal growth that might occur during the prolonged
as not defined (N.D) [11]. Enterococci faecium
incubation period. Macroscopic characteristics of the
ATCC19579, Enterococci faecalis ATCC 29212,
growing colonies were regularly monitored. The
Enterococci faecalis ATCC 47077 were used as quality
isolates were purified further and maintained on SCDA
control cultures [12]. All experiments were carried out
agar slants until used for further work. Colony charac-
in duplicate. The obtained multi-drug resistant isolate
teristics were noted and cell morphology was examined
was further characterized by microscopic and
by observing Gram stained specimens under oil immer-
macroscopic studies followed by phylogenetic analysis
sion of light microscope. Motility was checked using
using sequencing of 16S rRNA gene by the method
hanging drop method [7]. Endospore staining was
described elsewhere [13].
carried out according to Schaeffer-Fulton method [8].

2.2 Antibiotic Susceptibility Assay 2.3 DNA Isolation

Susceptibility to antimicrobial agents was deter-
mined by the standard Kirby-Bauer Disc Diffusion
Method for all the isolates from that soil [9]. Twenty-
five antibiotics viz. vancomycin, ampicillin, carbeni-
cillin, penicillin-G, cloxacillin, oxacillin, erythromycin,
Cells were grown in 2-5 mL Soybean Casein Digest
Broth till late log phase and pellet 4 mL cells in
microfuge at 8,000 rpm for 10 min. The obtained pellet
was resuspended in 200 µL Tris- EDTA buffer
containing 50 ng of RNase (Fermantas) and 400 µL of
 Isolation of Multi-Drug Resistant Paenibacillus sp. from Fertile Soil: An Imminent Menace of Spreading
Resistance
Sarkosyl solution (1% Sarkosyl, 0.5 M NaCl and 1%
SDS) was incubated at 37 ℃ with intermittent shaking
after every 5 min until the solution became clear. DNA
was purified by using equal volume of phenol : chloro-
form : isoamyl alcohol (25:24:1) and precipitated with
0.1 volume of sodium acetate (3 M) and 0.6 volume of
isopropanol in microfuge at 8,000 rpm for 10 min. The
obtained chromosomal DNA was washed with 500 µL
of 70% ethanol for 10 min by spinning at 8,000 rpm
and the sample was dried by placing open tube on
bench top for 20 min and the resulting DNA was
resuspended in 50 µL TE buffer. A Band for the
corresponding DNA was observed on 1% Agarose gel
prepared in 50 mL 1 X TAE (Tris-Acetate EDTA)
buffer.
2.4 PCR Conditions for 16S rRNA Gene Amplification
PCR amplification was performed for sample
mixture of volume 50 µL containing the appropriate
reaction buffer, reagents, the universal primer 27f
(5’-GAGTTTGATCCTGGCTCA-3’) and 1385r (5’-
CGGTGTGTACAAGGCCC-3’). The PCR conditions
were as follows: initial denaturation (2 min at 95 ℃),
followed by 30 cycles of denaturation (1 min at 95 ℃),
primer annealing (1 min at 52 ℃) and primer extension
(1.5 min at 72 ℃). Amplified gene products were
visualized on 1% Agarose gel under UV at 254 nm.
2.5 Blast and Phylogenetic Analysis
The PCR amplified product was purified using a
Qiagen kit (No. 28104), and the product was used for
sequencing on ABI 3700 Sequencer (MWG Bangalore,
India). The gene sequences were analyzed against the
NCBI database using BLAST N program packages and
matched to known 16S rRNA gene sequences
(www.ncbi.nlm.nih.gov/BLAST/).
3. Results
In this investigation, 33 bacterial strains were
isolated from the said soil samples. Among them, only
one strain (Multi-Drug Resistant-1, MDR-1) showed
17
resistance to 14 different antibiotics screened in
cross-sectional in-vitro analysis (Table 1). Other 32
bacterial strains displayed sensitivity to most of the
studied antibiotics (data not shown). For 10 antibiotics
where zone sizes were in the range 12-35 mm there was
no conclusive guidance available in the literature for
interpretation.
Hence they were reported in the not defined (N.D)
category. MDR-1 was sensitive to ciprofloxacin, a
fluoroquinolone. The resistance pattern of the
reference strains matched to their mentioned traits [12]
(Table 2).
As revealed by the microscopic studies, the isolate
MDR-1 was found to be gram-positive, rod-shaped and
motile strain. The endospore staining experiment
revealed the presence of centrally placed endospore in
a swollen cell. The colony of strain MDR-1 was
circular, off-white, effuse, opaque, and smooth on
SCDA. The strain has been deposited at cell culture
library at PLSL.
To further characterize the isolate, the 16S rRNA
gene sequence analysis was performed. The 16S rRNA
gene sequences obtained from the strain MDR-1 was
then compared with those of previously studied
Paenibacillus sp. The partial 16S rDNA sequence of
the strain MDR-1 showed high similarity with P.
daejeonensis (457/465, 98% similarity). The sequences
have been submitted to Genebank (NCBI), and the
information on which is available in an accession
number “EU026352”.
4. Discussions
Paenibacillus daejeonensis has been found to be
Gram positive, rod shaped, centrally spored with
swollen sporangium, motile bacilli. The microscopic
characteristics of MDR-1 matched with P. daejeonen-
sis producing circular, flat, smooth, opaque and white
colonies on SCDA [14]. The strain exhibited high level
of 16S rRNA gene sequence similarity to Paenibacillus
daejeonensis and other close phylogenetic neighbors
were P. agaridevorans and P. illinoisensis.
18 Isolation of Multi-Drug Resistant Paenibacillus sp. from Fertile Soil: An Imminent Menace of Spreading
Resistance

Table 1 Antibiotic resistance pattern of MDR-1 in antibiotics tested.

Antibiotic class Antibiotic tested Disc conc. (mcg) Zone Inh. Size (mm) Interpretation
Glycopeptide Vancomycin 30 0 R
Ampicillin 10 0 R
Carbenicillin 100 0 R
Beta Lactam Penicillin-G 10U 0 R
Cloxacillin 5 0 R
Oxacillin 5 6.6 R
Macrolides Erythromycin 15 0 R
Cephalothin 30 0 R
Ceftriaxone 30 20.4 N.D
Cephalosporins
Ceftazidime 30 16.8 N.D
Cephotaxime 30 12.4 N.D
Gentamicin 10 0 R
Aminoglycosides Netillin 30 11.6 R
Amikacin 30 0 R
Ciprofloxacin 30 40.6 S
Nalidixic acid 30 16 N.D
Quinolones
Ofloxacin 2 26.6 N.D
Norfloxacin 10 28.8 N.D
Lincomycin 2 0 R
Lincosomides
Clindamycin 2 0 R
Co-Trimazine 25 22 N.D
Sulfonamides
Co-Trimoxazole 25 20.8 N.D
Nitrofurans Nitrofurantoin 300 0 R
Chloramphenicol Chloramphenicol 30 17 N.D
Tetracyclines Oxytetracycline 30 16 N.D
R: resistant, S: sensitive, N.D: Not Defined, Inh: Inhibition, U : Units, Conc: Concentration.

Table 2 Antibiotic resistance pattern of reference strains to penicillin-G, cloxacillin, oxacillin, erythromycin,
Vancomycin.
cephalothin, gentamicin, netillin, amikacin, lincomycin,
Reference Antibiotic Disc conc. Zone Inh. Interpretat
strain tested (mcg) Size (mm) ion
clindamycin, and nitrofurantoin. This work constitutes
E. faecium
the first report of its kind as to the robust multi drug
Vancomycin 10 8 R
ATCC 19579 resistance trait reported ever in a Paenibacillus spp.
E. faecalis
Vancomycin 30 22 S
The van operon responsible to vancomycin resistance
ATCC 29212
in this genus was found particularly similar to that in
E. faecalis
ATCC 47077
Vancomycin 30 28 S enterococci, suggesting that the dissemination of
glycopeptides resistance may have occurred via mobile
In the past, vancomycin and oxytetracycline resis- elements present in soil resistome [15]. The present P.
tance has been demonstrated by many species of Paeni- daejeonensis strain has shown resistance to the large
bacillus [3, 5], but no antibiotic resistance has been classes of antibiotics viz Beta lactams, aminoglyco-
reported in Paenibacillus daejeonensis. However, in sides, macrolides, cephalosporines and lincosomides.
the present investigation, P. daejeonensis demonstrated The resistance pattern displayed by this strain
resistance to vancomycin, ampicillin, carbenicillin, highlights the possible presence of multiple resistant
 Isolation of Multi-Drug Resistant Paenibacillus sp. from Fertile Soil: An Imminent Menace of Spreading
Resistance
determinants in microflora of the soil rhizosphere in
particular. And this data specifically points out the
extent of overuse of potential life saving antibiotics,
which have resulted in development, and conservation
of resistance in non-pathogenic microorganisms, such
as P. daejeonensis. A report published in the year [16]
2003 highlights points on resistance in bacteria and
discuss in depth the plethora of mechanisms involved,
including several that have only recently been
discovered [16]. The report also describes the existence
of number of elements in the epidemiology of bacterial
resistance that have not been fully understood yet.
However, the report failed to explain the reason why
certain multidrug-resistant bacteria spread widely and
others not [16]. Moreover, it should be noted that
Paenibacillus, being an atypical pathogen of human
and animals, should never have been exposed to an
antibiotic as such except those produced in soil
micro-flora. Chances of exposure of this genus to
multiple antibiotics are also remote. In this regards
such multi-drug resistance factors in Paenibacillus add
intimidation of transmission of resistance to common
soil originating pathogens.
Acknowledgments
The authors greatly acknowledge Piramal Life
Sciences Limited, Mumbai for supporting this research
work. One of the authors (NLT) acknowledges the
Director NIO, Goa for his support and encouragement.
Special thanks to Dr. K. Pari, Senior Group Leader at
Piramal Life Sciences Limited for his assistance in
editing the manuscript. This article bears NIO
contribution number 4790.
References
[1] C. Ash, F.G. Priest, M.D. Collins, Molecular identification
of rRNA group 3 bacilli (Ash, Farrow, Wallbanks and
Collins) using a PCR probe test - Proposal for the creation
of a new genus Paenibacillus, Antonie van Leeuwenhoek
64 (1993) 253-260.
[2] P.P. Bosshard, R. Zbinden, M. Altwegg, Paenibacillus
turicensis sp. nov., a novel bacterium harbouring
heterogeneities between 16S rRNA, Int. J. Syst. Evol.
Microbiol. 52 (2002) 2241-2249.
19
[3] R. Patel, K. Piper, F.R. Cockerill III, J.M. Steckelberg,
A.A. Yousten, The biopesticide Paenibacillus popilliae
has a vancomycin resistance gene cluster homologous to
the enterococcal VanA vancomycin resistance gene cluster,
Antimicrob. Agents Chemother. 44 (2000) 705-709.
[4] L. Guardabassi, H. Christensen, H. Hasman, A. Dalsgaard,
Members of the genera Paenibacillus and Rhodococcus
harbor genes homologous to enterococcal glycopeptide
resistance genes vanA and vanB, Antimicrob. Agents
Chemother. 48 (2004) 4915-4918.
[5] J.D. Evans, Diverse origins of tetracycline resistance in the
honeybee pathogen Paenibacillus larvae, J. Invert Pathol.
83 (2003) 46-50.
[6] M. Drancourt, P. Berger, D. Raoult, Systematic 16S rRNA
gene sequencing of atypical clinical isolates identified 27
new bacterial species associated with humans, J. Clin.
Microbiol. 42 (2004) 2197-2202.
[7] R. Thomsona, R. Pickupb, J. Portera, A novel method for
the isolation of motile bacteria using gradient culture
systems, J. Microbial. Method. 46 (2001) 141-147.
[8] D.A. Mormak, L.E. jr Casida, Study of Bacillus subtilis
endospores in soil by use of a modified endospore stain,
Appl. Environ. Microbiol. 49 (1985) 1356-1360.
[9] W.L. Drew, A.L. Barry, R. O’Toole, J.C. Sherris,
Reliability of the Kirby-Bauer disc diffusion method for
detecting methicillin-resistant strains of Staphylococcus
aureus, Appl. Microbiol. 24 (1972) 240-247.
[10] National Committee for Clinical Laboratory Standards:
Performance Standards for Antimicrobial Disk
Susceptibility Tests (Seventh Edition), NCCLS, PA, 2000.
[11] J.S. Acar, The disc susceptibility test, in: V. Lorian (Ed.),
Antibiotics in Laboratory Medicine, The Williams and
Wilkins Company, Baltimore, USA, 1980, pp. 24-54.
[12] J.M. Swenson, N.C. Clark, D.F. Sahm, M.J. Ferraro, G.
Doern, J. Hindler, et al., Molecular characterization and
multilaboratory evaluation of Enterococcus faecalis
ATCC 51299 for quality control of screening tests for
vancomycin and high-level aminoglycoside resistance in
Enterococci, J. Clin. Microbiol. 33 (1995) 3019-3021.
[13] N.L. Thakur, A.C. Anil, W.E.G. Müller, Culturable
epibacteria of the marine sponge Ircinia fusca: temporal
variations and their possible role in the epibacterial
defense of the host, Aquat. Microb. Ecol. 37 (2004)
295-304.
[14] J.S. Lee, K.C. Lee, Y.H. Chang, S.G. Hong, H.W. Oh, Y.R.
Pyun, et al., Paenibacillus daejeonensis sp. nov., a novel
alkaliphilic bacterium from soil, Int. J. Syst. Evol.
Microbiol. 52 (2002) 2107-2111.
[15] V.M. D’Costa, K.M. McGrann, D.W. Hughes, G.D.
Wright, Sampling the antibiotic resistome, Science 311
(2006) 374-377.
[16] D.M. Livermore, Bacterial resistance: origins,
epidemiology, and impact, Clin. Infect. Dis. 36 (2003)
S11-23.
Aug. 2010, Volume 4, No.5 (Serial No.30)
Journal of Life Sciences, ISSN 1934-7391, USA

Cultivation Practice of Pleurotus Fossulatus on Rice

Straw

Nirmalendu Das, Protik Chowdhury and Birja Pasman

Department of Botany, A..B.N. Seal College, Cooch Behar, West Bengal 736101, India

Received: March 17, 2010 / Accepted: May 24, 2010 / Published: August 30, 2010.

Abstract: Pleurotus fossulatus, a member of oyster mushrooms, was successfully cultivated on rice straw. At least two flushes of fruit
body developed at 22 ℃. The first flush of fruit body initiation took place on the 21st day and second one appeared on 38th day. The
biological efficiencies (BE) were found to be 30.8% and 14.6% for first and second flush, respectively. The differentiation pattern of
pileus and gills of this mushroom was found to be different from that of other reported species of oyster mushroom. The mushroom (P.
fossulatus) took about 20 days for spore formation from primordia initiation and this time span was noted to be highest among all the
published reports about any other Pleurotus spp. The BE were 25.9% and 12.5% in first and second flush, respectively when the
mushroom was harvested on 18th day (after its initiation of primordia), i.e., before gill formation. However, the BE was found to be
14-16% lesser in comparison to that harvested after sporulation.

Key words: Cultivation, Pleurotus fossulatus, spore allergy, sporulation.

1. Introduction some sporeless or low sporing strains of Pleurotus spp.

[10-12].
Commercial cultivation of Oyster mushroom
Pleurotus fossulatus (Cooke) is a member of oyster
(Pleurotus spp.) has been in high popularity throughout
mushroom, which naturally appears on dead or
the world during the last few decades owing to its
decaying basal parts and roots of Ferula sp. in
ability to grow on a wide range of temperatures
April-May, has been collected from different parts of
(10-35 ℃) and simple cultivation methods on a variety
India, Pakistan and Afghanistan [13]. The cultivation
of lignocellulosic substrates [1-5]. This third largest
practices of this particular species have not been
group of cultivated mushroom is nutritionally as well
reported so far. In this paper the authors have tried to
as medicinally important as they are found to be a very
report that P. fossulatus can be grown on rice straw
good source of a wide variety of neutraceuticals [5, 6].
efficiently. This mushroom, if harvested before the gill
Irrespective of their tremendous demand in mushroom
formation, would show little lesser BE but at the same
industries, the main hardship associated with the
time the cultivars can easily avoid the spore-related
commercial cultivation of this mushroom is spore
allergic problems during fruit body maturation.
formation, which has been found to cause
allergy-related problems to the farmers and local 2. Methods
people [7-9]. Scientists from all across the globe are
2.1 Mushroom Strain
putting their best efforts to understand the genetics and
biochemical phenomena controlling the differentiation Pleurotus fossulatus Cooke (MTCC 1800) is collect-
of gills and sporulation process with an aim to develop ed from Microbial Type Culture Collection, Institute of
Microbial Technology, Chandigarh, India and
Corresponding author: Nirmalendu Das, Ph.D., research field: maintained on potato-dextrose agar (PDA), pH 7.0 [4].
microbial biotechnology. E-mail: nirmalendus@yahoo.co.uk.
 Cultivation Practice of Pleurotus Fossulatus on Rice Straw
2.2 Spawn Preparation
About 1,000 g of wheat grains are chosen for spawn
production. The grains are cooked for half an hour then
washed in flowing water. Extra water present is drained
off and the substrate is spread on the surface of a clean
blotting paper and air dried for 15 min. 5 g of calcium
carbonate and 10 g of calcium sulphate are mixed with
the grains. About 100 g of grains are placed in
polythene bag and sterilized in autoclave at 121 ℃ for
15 mins [4].
2.3 Substrate Preparation
Dried rice straw (var. Agnishal) has been collected
from a local farm at Cooch Behar, West Bengal, India
and is approximately two months in storage after
harvest. The rice straw is chopped into small pieces
(5-6 cm), weighed and soaked in water for overnight.
Extra water present in the substrate is drained off and
the substrate is air dried for 15 min. No heat treatment
of the substrate has been done. About 250 gm wet
substrate (~ 85% moisture content) is mixed with 10%
spawn (wet wt. / wet wt.). The spawned substrate is
then put into 30 cm × 42 cm polythene bags. The bags
are tightly closed with pin holes on the surfaces. The
bags are kept in a spawn running room at 22 ± 1 ℃ with
a 12 h photoperiod (1500-2000 Lux) with 85-90 %
relative humidity. Adequate ventilation has been
provided to prevent increase of CO2 concentration [4].
2.4 Biological Efficiency (BE)
Biological efficiency (BE) has been calculated as the
percentage yield of fresh mushroom fruit bodies in
relation to dry weight of the substrate [6].
BE (%) = Weight of fresh mushroom fruit bodies /
Weight of dry substrate × 100 (1)
2.5 Preparation of Fruit Body Extract and Protein
Estimation
Fresh fruit bodies (30 gm) before (18th day’s) and
after (25th day’s) gill formation has been disrupted by
21
crushing with acid-washed sand in a sterilized mortar
and pestle. The tissues are then extracted with 100 mL
20 mM imidazole buffer containing 1 mM EDTA, 2
mM PMSF (pH 7.8) and 2 mM 2-mercaptoethanol.
Unbroken cells with cell debris are removed by
centrifugation at 32,000 g for 30 min and the
supernatant is collected and used for protein estimation.
Protein concentration is determined according to the
method of Bradford using bovine serum albumin as
standard [14].
3. Results
3.1 Fruiting Efficiency of P. Fossulatus on Rice Straw
Biological efficiency (BE) of this mushroom and the
required time for initiation of primordia on rice straw is
given in Table 1. The initiation of primordia has been
found to start on the 21st day after spawning and
yielded the mature fruit body (bearing gill) after a span
of 19-20 days. The fruiting stage (the time span
showing initiation of primordia to mature fruit body
development) has been found to exist for 26-28 days.
The BE of first flush is about two times higher than the
BE of the second flush. The fruit bodies can be
harvested on 18th day after initiation of primordia, but
the BE has been 14-16 % lesser than that of the 25th
day (Fig. 1). The protein content of the two flushes has
not been drastically altered when estimated either
before gill formation (18th day) or after gill formation
(25th day) and the values are 7.1 mg/g and 7.4 mg/g of
fresh fruit body, respectively.
Table 1 Biological efficiency (BE) of P. fossulatus
harvested after the 25th days of primordia initiation.
Biological efficiency (%) Time of
Flush Mean per Final primordia
Fruiting life
SD (days)
batch mean initiation (days)
25.4
1st 36.4 30.80 5.502 21 ± 1 26 ± 1
30.6
15.9
2nd 17.4 14.6 2.910 38 ± 2 28 ± 1
10.5
In each batch three set of experiments were done.
22 Cultivation Practice of Pleurotus Fossulatus on Rice Straw

35 and 3.0-3.14 cm in diameter. Hymenial tissues are well

% of Biological Efficiency

30 differentiated. The gills of matured fruit body are

25
decurrent, uniformly arranged and white in color. The
20
15
number of gills varies from 248-257 (approx).
10 The development of P. fossulatus fruit body is
5 shown in Figs. 2 & 3. After initiation of primordia up to
0 1st Flush 2nd Flush 18th day of growth, the fruit body looks like two
18th Days 25th Days closely joined bulbous structures. The lower one is
Fig. 1 Comparison of BE of P. fossulatus harvested on 18th larger in size than the upper one. There has been no
days and 25th days.
sign of gill formation up to this time (18th day). As
3.2 Morphology and Development of P. Fossulatus fruit body get matured, the gills start appearing from
Fruit Body the junction of the upper bulbous structure (pileus)
expressing the gymnocarpic nature of the fruit body
The fruit body of P. fossulatus is stipitate. The pileus
development (Fig. 4). The lower part (stipe) becomes
is an oval flattened structure. The diameter of the pileus
elongated and the mature pileus gradually gets
is nearly 19.24 cm, white to slightly yellowish in color.
At first the outer surface of the pileus is of leathery compressed looking like a flattened oval saucer-like
texture but later becomes smooth. Stipe is short, structure. After disseminating spores the fruit body
unbranched, globose, white in colour, 2.5-3.5 cm long decays within 26-28 days.

A B

C D
Fig. 2 Different stages of sporophore development after primordia initiation of P. fossulatus on rice straw substrate.
A-2nd day. B-4th day. C-8th day. D-24th day.
 Cultivation Practice of Pleurotus Fossulatus on Rice Straw
Fig. 3 Diagrammatic representation of sporophore development after primordia initiation of P. fossulatus on rice straw
substrate.
A-4th day. B-8th day. C-12th day. D-24th day.
Pileus
Gills
Stipe
Fig. 4 Diagrammatic representation of longitudinal section
through mature sporophore showing arrangement of gills.
4. Discussion
P. fossulatus satisfactorily gives out fruit bodies on
rice straw and the initiation of primordia can been
observed on 21st day (Table 1). In Pleurotus sp. the
initiation of primordia is generally observed within
20-30 days after spawning [15-17]. Other researchers,
however, have reported that the time for this episode
(initiation of primordia) varies from changes in
substrate composition in same Pleurotus sp.. Das and
Mukherjee have reported that required time for
initiation of primordia of P. ostreatus usually varies
from 9.66 days to 14.33 days depending on the weed
substrates [4]. Tisdale et al. has reported that this time
requirement is much more when different woody trees
are chosen as substrates [18]. From initiation of
primordia to gill formation, P. fossulatus has consumed
about 20 days (in our experimental conditions) and
after the gill formation it remains fresh nearly for
another 7 days. The authors can therefore coin this
episode (starting from initiation of primordia to
deliquescence of the fruit body) as fruiting life. P.
23
fossulatus has shown the highest fruiting life than any
other Pleurotus sp. reported so far. Generally, the other
reported Pleurotus sp. devour 3-7 days from initation
of primordia to deliquescence [13]. The BE of this
mushroom (P. fossulatus) in first flush has been 30.8%
whereas in second flush it is only 14.6% (Table 1). The
BE of different Pleurotus sp., however, varies
depending on substrates and other physiological
parameters [5]. Das and Mukherjee have reported that
the BE of P. ostreatus on different weeds varies from
22.9% to 102.4% whereas the mixture of rice straw and
Leonotis spp. (in 1:1 ratio) gives 139% BE [4]. Obodai
et al have found much lower BE in P. ostreatus when
cultivated on fresh saw dust than on composted saw
dust / bran mixture [19].
Fig. 1 shows the comparative BE of P. fossulatus
before and after sporulation. 16% and 14% less BE
have been found in first flush and second flush,
respectively when the fruit bodies are harvested before
sporulation (i.e. in 18th days instead of 25th days after
primordia initiation) though the protein contents are
more or less same. The development of P. fossulatus
sporophore is different from other Pleurotus spp. (Figs.
2 & 3).
Though M.C. Cooke identified and named this
fungus as P. fossulatus in 1891, the species hasn’t been
in perform for commercial cultivation practices yet. In
recent past, Kong has reported P. fossulatus as similar
taxa of P. eryngii [20], but different fruit body
structures, developmental patterns and slower maturity
time in comparision to P. eryngii claim that both the
24 Cultivation Practice of Pleurotus Fossulatus on Rice Straw
species might be distantly related.
5. Conclusion
The developmental pattern of P. fossulatus is
markedly different and the fruiting life is more (26-28
days) in comparison to other species of Pleurotus. The
BE and protein content do not vary much before and
after gill formation ( sporulation). The BE may be
increased with variation of substrates and other
conditions to give it a commercially viable status to
cultivars. If harvested at 18th day (before sporulation),
the spore-related allergic symptoms can be alleviated.
Extensive studies are required to elucidate the factors
responsible for differentiation especially the gill
structure of this less studied mushroom.
Acknowledgment
This work was financially supported by Department
of Biotechnology, Govt. of India.
References
[1] F. Zadrazil, Cultivation of Pleurotus, in: S.T. Chang, W.A.
Hayes (Eds.), The Biology and Cultivation of Edible
Mushrooms, Academic Press, New York, 1978, pp.
521-558.
[2] S.T. Chang, World production of cultivated and medicinal
mushrooms in 1997 with emphasis on Lentinus edodes
(Berk) Sing, China, International Journal of Medicinal
Mushroom 1 (1999) 291-300.
[3] D.J. Royse, W.T. Rhodes, S. Ohga, E.J. Sanchez, Yield,
mushroom size and time to production of Pleurotus
cornucopiae (oyster mushroom) grown on switch grass
substrate spawned and supplemented at various rates,
Bioresource Technology 91 (2004) 85-91.
[4] N. Das, M. Mukherjee, Cultivation of Pleurotus ostreatus
on weed plants, Bioresource Technology 98 (2007)
2723-2726.
[5] A. Gregori, M. Šυagel, J. Pohleυen, Cultivation techniques
and medicinal properties of Pleurotus spp., Food
Technology and Biotechnology 45 (2007) 238-249.
[6] S. Kirbag, M. Akyuz, Evaluation of agricultural wastes for
the cultivation of Pleurotus eryngii (DC. Ex Fr.) Quel. Var.
ferulae Lanzi, African Journal of Biotechnology 7 (2008)
3660-3664.
[7] H.K. Schulz, B.M. Hausen, U. Noster, Allergy to spores of
Pleurotus florida, Lancet 5 (1974) 29.
[8] A.J. Olsen, Pleurotus spores as allergens, Mushroom
Journal 172 (1978) 115-117.
[9] W.E. Horner, E. Levetin, S.B. Lehrer, Basidiospore
allergen release: elution from intact spores, Journal of
Allergy and Clinical Immunology 92 (1993) 306-312.
[10] T.K. Chakraborty, N. Das, S. Sengupta, M. Mukherjee,
Accumulation of a natural substrate of laccase in gills of
Pleurotus florida during sporulation, Current
Microbiology 41 (2000) 167-171.
[11] T.K. Chakraborty, N. Das, M. Mukherjee, Evidences of
high carbon catabolic enzyme activities during
sporulation of Pleurotus ostreatus (Florida), Journal of
Basic Microbiology 43 (2003) 462-467.
[12] S. Ravishankar, M. Pandey, R.P. Tewari, V. Krishna,
Development of sporeless / low sporing strains of
Pleurotus through mutation, World Journal of
Microbiology and Biotechnology 22 (2006) 1021-1025.
[13] T.N. Kaul, Introduction to Mushroom Science
(Systematics), Oxford & IBH Publishing Co. Pvt. Ltd.,
New Delhi, India, 1999.
[14] M.M. Bradford, A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing
the principle of protein-dye binding, Analytical
Biochemistry 72 (1976) 248-254.
[15] R. Ragunathan, K. Swaminathan, Nutritional status of
Pleurotus spp. grown on various agro-wastes, Food
Chemistry 80 (2003) 371-375.
[16] A. Yildiz, M. Karakaplan, Evaluation of some agricultural
wastes for the cultivation of edible mushrooms (P.
ostreatus var salignus), Journal of Food Science
Technology 40 (2003) 290-292.
[17] P.K. Khanna, R. Bhandari, G.L. Soni, H.S. Garcha,
Evaluation of Pleurotus spp. for growth, nutritive value
and antifungal activity, Indian Journal of Microbiology 32
(1992) 197-200.
[18] T.E. Tisdale, S.C. Miyasaka, D.E. Hemmes, Cultivation of
the oyster mushroom (Pleurotus ostreatus) on wood
substrates in Hawaii, World Journal of Microbiology and
Biotechnology 22 (2006) 201-206.
[19] M. Obodai, J. Cleland-Okine, A.K. Vowotor, Comparative
study of the growth and yield of Pleurotus ostreatus on
different lignocellulosic by-products, Journal of Industrial
Microbiology and Biotechnology 30 (2003) 146-149.
[20] W. Kong, Descriptions of commercially important
Pleurotus species, Mushroom Growers Handbook I. Part
II. Oyster Mushrooms, Chapter 4, Rural Development
Administration, Korea, 2004, pp. 54-61.
Aug. 2010, Volume 4, No.5 (Serial No.30)
Journal of Life Sciences, ISSN 1934-7391, USA

Identification of Genes for Powdery Mildew Resistance

in Mungbean

Parinya Khajudparn1, 2, Sopone Wongkaew1 and Piyada Tantasawat1

1. School of Crop Production Technology, Suranaree University of Technology, Nakhon Ratchasima 30000, Thailand
2. Center for Agricultural Biotechnology (AG-BIO / PERDO-CHE), Bangkok 10330, Thailand

Received: April 23, 2010 / Accepted: June 30, 2010 / Published: August 30, 2010.

Abstract: Powdery mildew, which called Sphaerotheca phaseoli in Latin, is one of the major diseases of mungbean (Vigna radiata L.)
worldwide, causing up to 50% yield losses. Most mungbean varieties grown in Thailand are susceptible to the disease, therefore, new
resistant varieties are highly desirable. Three resistant mungbean lines, V4718, V4758 and V4785, were identified from the AVRDC
collection. In this study, the authors compared the resistance levels among these 3 lines and tested the allelic relationship among these
resistance genes. Three crosses, V4718 × V4758, V4718 × V4785 and V4758 × V4785, were made and the F1 hybrids were selfed to
generate the F2 populations and crossed to a susceptible variety, CN72 to generate the F1 × S populations. In the F1 × S and F2
populations, the resistance segregated in a ratio of 3 Resistant (R):1 Susceptible (S) and 15R:1S, respectively for all three crosses.
These results indicate that a single dominant gene confers resistance to powdery mildew in each resistant line and these resistance genes
are non-allelic. The authors are currently transferring these resistance genes into commercial varieties to provide durable resistance to
powdery mildew.

Key words: Allelism, resistance gene, Sphaerotheca phaseoli, Vigna radiata (L.).

1. Introduction cover on leaves, stems and inflorescences. This

covering layer prevents photosynthesis, causing leaf
Mungbean [Vigna radiata (L.) Wilczek] is native to
dryness and premature fall. The plant tissue underneath
the Indo-Burma region with India, Burma, Thailand
the mycelial patches is purplish in color. Mycelial
and Indonesia which produce almost 90% of the world
growth is amphigenous, thick, forming irregular white
production. The production of mungbean in Thailand is
patches, sometimes effuses to cover the whole leaf
adversely affected by many factors such as low genetic
surface and has poorly developed nipple-shaped single
potential of current varieties, environmental stresses,
appressorium [3]. Although effective chemical control
diseases, insect pests, and poor cultural practices. One
methods have been established, they are not
of the main foliar diseases that affect the production of
economical. Breeding for improved host resistance is
mungbean is powdery mildew, caused by Sphaerotheca
expected to be the most effective, efficient and
phaseoli. The disease causes heavy yield losses ranging
environmentally friendly method of control [4].
from 20 - 40% particularly in cool dry months [1]. The
At present, most mungbean cultivars recommended
crop incurs maximum damage when powdery mildew
to farmers in Thailand such as Chainat 72 (CN72),
infects plants just before the flowering stage [2].
Chainat 36 (CN36), Chainat 60 (CN60), Kamphaeng
The most typical symptom of powdery mildew is the
Saen 1 (KPS1), Kamphaeng Saen 2 (KPS2) are suscep-
presence of a white, epiphytic mycelia and conidia
tible (S) to the disease. Therefore, it is necessary to
Corresponding author: Piyada Tantasawat, Ph.D., associate develop resistant (R) varieties to reduce the production
professor, research fields: plant breeding and plant cost and to protect the environment.
biotechnology. E-mail: piyada@sut.ac.th.
26 Identification of Genes for Powdery Mildew Resistance in Mungbean
Allelic test is an efficient method to identify and
evaluate the inheritance of resistance genes. Kaushal
and Singh [5] studied the genetics of leaf spots
resistance caused by Colletotrichum truncatum (Schw.)
in urdbean (Vigna mungo (L.) Hepper) using allelic test.
The resistance was found to be controlled by single
dominant genes that were non-allelic. Recently,
Padmavathi et al. [6] used allelic test to identify blast
(Magnaporthe grisea) resistance genes in rice and
revealed that the resistance was also controlled by
single dominant genes.
The purpose of this study is to identify sources of
powdery mildew resistance and to study the mode of
inheritance of foliar resistance to this pathogen. Three
mungbean lines were identified as sources of resistance.
The genetics of resistance were studied using F1 (R1 ×
R2), F1 × S [(R1×R2) × S] and F2 populations of
different crosses.
2. Materials and Methods
The experiment was conducted in randomized
complete block design (RCB) with three replications at
Suranaree University of Technology research farm,
Nakhon Ratchasima, Northeast of Thailand. Three
resistant mungbean lines (V4718, V4758 and V4785
from the AVRDC, Thailand) were diallel crossed in all
combinations excluding reciprocals to produce F1
(V4718 × V4758, V4718 × V4785 and V4758 × V4785)
for testing the allelic relationships between resistance
genes. The F1s were selfed to produce F2 populations
and each F1 cross was also crossed to a powdery
mildew susceptible cultivar (CN 72; moderately
resistant to beanfly, high stability of yield and seed
weight) to obtain F1 × S [(V4718 × V4758) × CN72,
(V4718 × V4785) × CN72 and (V4758 × V4785) ×
CN72] populations. CN 72 variety was planted nearby
each plot as source of powdery mildew inoculums and
as a susceptible check. Plot size varied with
generations. Parental lines, F1s and F1 × Ss were grown
in single-row plots and F2s were grown in 3-row
plots with plants spaced 0.25 m within row, in 5 m row
length and 0.5 m between rows.
Enough seeds of P1, P2, F1 (R1 × R2), F1 × S [(R1 × R2)
× S] and F2 were sown to obtain at least 20, 20, 20, 20
and 60 plants per cross per replication, respectively, so
that the evaluation of powdery mildew resistance could
be completed. The plants were grown during winter
(from Dec. 2006 to Feb. 2007), the most appropriate
period for powdery mildew resistance evaluation. The
plants were inoculated naturally right after sowing and
natural infection occurred rapidly and regularly.
Disease scores were recorded 65 days after planting
according to a standard scoring procedure on a 1-9
scale developed by ICRISAT, as follows: 1 = no leaf
symptom, 2 = 2-3 wounds on lower part of leaf, 3 = 2-3
wounds on lower part of leaf where spore formation
can be observed, 4 = fully spore formation on lower
part of leaf and a few wound can be observed on middle
part of leaf, 5 = like four, chlorosis leaf and much of
spore formation can be observed, 6 = like five, fully
spore formation can be observed, 7 = spore formation
of all parts of leaf and 25% of dry leaf can be observed,
8 = like seven, 25 – 50% dry leaf can be observed and 9
= like seven, over 50% dry leaf can be observed. Based
on the observed resistance level of parental varieties,
individual plants were categorized into two categories:
resistant with rating 1-5 and susceptible with rating 6-9.
Chi-square statistic was used to test goodness of fit of
the observed ratio to expected ratio under various
genetic models.
The chi-square test (χ2) was used to study the
genetics of resistance to powdery mildew for 3:1 and
15:1 segregation, as suggested by Snedecor and
Cochran [7], as follows:
χ2 = ∑ (F0 – FE)2 / FE (1)
Where F0 = observed frequency, and FE = expected
frequency.
3. Results and Discussion
3.1 Genetic Analysis of Powdery Mildew Resistance
The distribution of disease rating scores and mean
scores for powdery mildew reaction of V4718, V4758
 Identification of Genes for Powdery Mildew Resistance in Mungbean 27

Table 1 Number of total plants in each powdery mildew disease score category and mean disease scores of the four parental
lines / varieties.
Disease scores
Lines / varieties Total Mean
1 2 3 4 5 6 7 8 9
V4718 0 7 24 58 32 4 0 0 0 125 4.06
V4758 2 2 14 19 34 23 21 0 0 115 5.10
V4785 5 38 39 30 5 3 0 0 0 120 3.53
CN72 0 0 0 0 0 4 48 17 2 71 7.36
Disease scores are based on 1-9 scale with 1 = no leaf symptom.

and V4785 lines and CN72 variety are shown in Table
1. The powdery mildew resistant lines V4718, V4758
and V4785 had the mean disease scores of 4.06, 5.10
and 3.53, respectively. V4785 had the lowest score of
3.53 while the susceptible variety CN72 had
consistently highest score (7.36) (Table 1). The F1
mean scores of disease of V4718 × V4758, V4718 ×
V4785 and V4758 × V4785 were 3.74, 3.25 and 3.81,
respectively (Table 2). In particular, the F1s from
V4718 × V4758 and V4718 × V4785 had lower
disease scores than the lowest parents, suggesting the
complementary effect between resistance loci.
In the F1 populations of V4718 × V4758, V4718 ×
V4785 and V4758 × V4785, 57, 60 and 59 plants were
resistant and 2, 0 and 2 were susceptible, respectively.
The simplest model was that one dominant genes
conferred resistance, and the accumulated effect of
these two genes made plants resistant (Table 3).
The segregation ratio of each F1 × S [(V4718 ×
V4758) × CN72, (V4718 × V4785) × CN72 and
(V4758 × V4785) × CN72] was observed at 3:1
(resistant : susceptible) which gave a good fit of a
model with one dominant resistant gene from each
resistant line as confirmed by chi-square test (Table 3).
The segregation in the F2 population of each cross
also fitted this model with one dominant gene for
resistance in each parent. The segregation ratio of 15:1
(resistant : susceptible) was observed and gave a good
fit of this model as confirmed by chi-square test (Table
3). These results confirm that the genetic control of
mungbean resistance to powdery mildew is associated
with a single gene with a dominant effect.
Table 2 Mean powdery mildew disease scores of P1, P2 and
F1 of all crosses.
Cross P1 P2 F1
V4718 × V4758 4.06 5.10 3.74
V4718 × V4785 4.06 3.53 3.25
V4758 × V4785 5.10 3.53 3.81
Disease scores are based on 1-9 scale with 1 = no leaf
symptom.
3.2 Allelic Test of Genes for Powdery Mildew
Resistance
To test the allelic relationships of genes for
resistance to S. phaseoli in V4718, V4758 and V4785,
the lines were crossed in all combinations excluding
reciprocals. The F2 generation of these crosses gave a
ratio of 15:1 (resistant : susceptible) indicating that two
independent dominant genes are involved in expression
and govern resistance against S. phaseoli and both are
non-allelic (Table 3). Data on the inheritance of disease
resistance from crosses between resistant F1 and
susceptible cultivar showed that resistance is simply
inherited. Resistance was dominant over susceptibility.
All mungbean lines possess single dominant genes for
resistance. Test for allelism showed that the genes for
resistance in each of tested lines are different from each
other indicating considerable diversity for resistance to
S. phaseoli which can be effectively exploited for
breeding resistant cultivars. In our previous work,
V4758 was used to cross with KPS2 (susceptible
cultivar). All F1 plants from this cross were resistant
and the segregation ratio of 3:1 (resistant : susceptible)
was observed in F2 which gave a good fit of a
model with one dominant resistance gene as confirmed
28 Identification of Genes for Powdery Mildew Resistance in Mungbean

Table 3 Observed segregation patterns of reaction to Sphaerotheca phaseoli of mungbean crosses and test for the goodness of
fit of inheritance models.

Total Observed Expected Chi-square test (Inheritance model)

Cross
number R S R S Expected ratio χ2 p0.05, 0.01
F1
V4718 × V4758 59 57 2 - - - - -
V4718 × V4785 60 60 0 - - - - -
V4758 × V4785 61 59 2 - - - - -
(V4718 × V4758) × CN72 61 46 15 45.75 15.25 3:1 0.005 3.84 - 6.63
(V4718 × V4785) × CN72 58 47 11 43.50 14.50 3:1 1.140 3.84 - 6.63
(V4758 × V4785) × CN72 60 50 10 45.00 15.00 3:1 2.220 3.84 - 6.63
F2
V4718 × V4758 186 170 16 174.38 11.63 15:1 1.760 3.84 - 6.63
V4718 × V4785 180 165 15 168.75 11.25 15:1 1.330 3.84 - 6.63
V4758 × V4785 180 165 15 168.75 11.25 15:1 1.330 3.84 - 6.63
2
R = resistant; S = susceptible; χ = the actual value of chi-square test for resistance / susceptibility ratios; p0.05, 0.01 = the differential
levels of chi-square test for the resistance / susceptibility ratios with the probabilities of 95-99%.

by chi-square test, substantiating the single resistance
gene inheritance of this variety (data not shown).
Similarly, Chaitieng [8] also studied the inheritance of
powdery mildew resistance in four crosses (CN36 ×
SUT4, CN36 × VC1210A, KPS1 × SUT4 and KPS1 ×
VC1210A) between resistant lines (SUT4 and
VC1210A) and susceptible varieties (CN36 and KPS1)
of mungbean. Frequency distributions for powdery
mildew reaction in F2 and BC1 were used to analyze for
segregation ratios and found that powdery mildew
resistant reaction of all four crosses was controlled by a
single dominant gene.
The authors are currently transferring these
resistance genes into commercial varieties to provide a
more durable and broad spectrum resistance to
powdery mildew by gene pyramiding which is a very
useful approach to maximize utilization of existing
gene resources. If these resistance genes confer
resistance to different races of the disease, pyramiding
them together could make a line with multi-race
resistance. Theoretically, this multi-race resistance
should be more durable than any single-race. Gene
pyramiding has been successfully applied in several
crop breeding programs, and many varieties and lines
possessing multiple attributes have been produced
[9-11]. The joint expression of pyramided genes was
even found to provide numerical increases or a broader
spectrum of resistance over that conferred by single
genes through gene interaction and quantitative
complementation [12, 13].
Acknowledgments
The authors are thankful to the AVRDC, Thailand
for providing the seeds of V4718, V4758 and V4785
resistant lines. This research is partially supported by
the Center for Agricultural Biotechnology,
Postgraduate Education and Research Development
Office, Commission on Higher Education, Ministry of
Education and grants from Suranaree University of
Technology, Thailand.
References
[1] J.A. Soria, F.C. Quebral, Occurrence and development of
powdery mildew on mungbean, Philippine Agric. 57
(1973) 158-177.
[2] J.M. Poehlman, The Mungbean, University of Missouri
Press, Missouri, USA, 1991.
[3] E.M. Soylu, S. Soylu, S. Kurt, First report of powdery
mildew caused by Podosphaera phaseoli (syn.
 Identification of Genes for Powdery Mildew Resistance in Mungbean
Sphaerotheca phaseoli) on cowpea (Vigna sinensis) in
Turkey, Plant Pathol. 53 (2004) 528.
[4] W. Erskine, M. Tufail, A. Russell, M.C. Tyagi, M.M.
Rahman, M.C. Saxena, Current and future strategies in
breeding lentil for resistance to biotic and abiotic stresses,
Euphytica 73 (1993) 127-135.
[5] R.P. Kaushal, B.M. Singh, Genetics of disease resistance
in urdbean (Vigna mungo (L.) Hepper) to the leaf spots
caused by Colletotrichum truncatum (Schw.) Andrus &
Moore, Euphytica 37 (1988) 279-281.
[6] R.P. Padmavathi, T. Ram, K. Satyanarayana, B. Mishra,
Identification of blast (Magnaporthe grisea) resistance
genes in rice, Curr. Sci. , 88 (4) (2005) 628-630.
[7] G.W. Snedecor, W.G. Cochran, Statistical Methods, 8th
ed., Iowa State University Press, Iowa, USA, 1990.
[8] B. Chaitieng, Inheritance of powdery mildew resistance in
mungbean and development of molecular markers for
marker-assisted selection, Suranaree University of
Technology, School of Crop Production Technology,
Nakhon Ratchasima, Thailand, 2002.
[9] N. Huang, E.R. Angeles, J. Domingo, G. Magpantay, S.
Singh, G. Zhang, N. Kumaravadivel, J. Bennett, G.S.
29
Khush, Pyramiding of bacterial blight resistance genes in
rice: marker-assisted selection using RFLP and PCR, TAG
Theor. and Appl. Genet. 95 (1997) 313-320.
[10] D.R. Porter, J.D. Burd, K.A. Shufran, J.A. Webster,
Efficacy of pyramiding greenbug (Homoptera: Aphididae)
resistance genes in wheat, J. Econ. Entomol. 93 (2000)
1315-1318.
[11] K. Samis, S. Bowley, B. McKersie, Pyramiding
Mn-superoxide dismutase transgenes to improve
persistence and biomass production in alfalfa, J. Exp. Bot.
53 (2002) 1343-1350.
[12] S. Singh, J.S. Sidhu, N. Huang, Y. Vikal, Z. Li, D.S. Brar,
H.S. Dhaliwal, G.S. Khush, Pyramiding three bacterial
blight resistance genes (xa5, xa13 and Xa21) using
marker-assisted selection into indica rice cultivar PR106,
TAG Theor. and Appl. Genet. 102 (2001) 1011-1015.
[13] S. Yoshimura, A. Yoshimura, N. Iwata, S.R. McCouch,
M.L. Abenes, M.R. Baraoidan, T.W. Mew, R.J. Nelson,
Tagging and combining bacterial blight resistance genes in
rice using RAPD and RFLP markers, Mol. Breed. 1 (1995)
375-387.
Aug. 2010, Volume 4, No.5 (Serial No.30)
Journal of Life Sciences, ISSN 1934-7391, USA

Expression of Recombinant Protein Bovine Prion

pCIp264 in COS-7 Cells and Its Detection

Yaozhong Ding, Yongsheng Liu, Wenqian Liu, Yanping Ma, Meng Wang, Shenghai Yang and Jie Zhang
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Public Health of Ministry of Agriculture, Key
Laboratory of Animal Virology of Ministry of Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural
Sciences, Lanzhou 730046, China

Received: April 6, 2010 / Accepted: May 5, 2010 / Published: August 30, 2010.

Abstract: Bovine spongiform encephalopathy (BSE) is thought to be caused by prions initially derived from sheep scrapie, and
epidemiological studies suggest that new viriant form of CJD manifest in Great Britain may be caused by BSE prions. PrPSc is
thought to pathogenic factor of transmissible spongiform encephalopathy (TSE), which invariably involve a post-translational
modification process of PrPC encoded by the host euchromosome PrP gene during the period it converted into the pathogenic form
(PrPSc), PrP is nomal cellular protein which has been found in both neuronal and nonneuronal tissues. Since the crucial infectious
event in protein-transmitted diseases is an induced misfolding of prion proteins (PrPc) catalyzed by already misfolded PrPSc, it is of
high importance that such collisions are enhanced by two-dimensional diffusion in cell membranes is of high importance compared
to three-dimensional diffusion in solution. The level of PrP mRNA in brain is higher than other tissue, but purification of PrPC from
rodent has been difficult. To understand the formation of PrPSc, it seemed useful to develop a system for produced a large quantities
of PrPC since there is no nature source of PrPC. The pCI-neo mammalian expression vector contains the neomycin phosphtransferase
gene which serves as a marker for the selection of stable transfected cells with G418. COS-7 cells constitutively express simian
viruse 40 (SV40) T-antigen and support replication of expression plasmids containing the SV40 origin of replication, amplifying the
introduced expression cassettes, now become important routine of expression a large number of heterologous gene products. In this
paper, the authors used pCI-neo vector to construct a recombnant pCIp264 (cotains mPrP, N-signalpeptide and C-GPI anchor)
plasmid to express it in the COS-7 cells and meanwhile detect the expression fusion using IN-ELISA, IN-IFA and western blot, and
obtain some approximative nature PrPC.

Key words: Bovine prion protein (boprp), COS-7 cells, indirect immunofluorescence assay (IFA).

1. Introduction in great Britain since 1986 [1]. Epidemiological

studies suggest that new viriant form of CJD manifest
The current epidemics of bovine spongiform
in Great Britain may be caused by BSE prions [2].
encephalopathy (BSE), or “mad cow disease”, is
BSE is caused by an infectious protein [3]. In 1996,
thought to be caused by prions initially derived from
when BSE outbroke again in England, it brought more
sheep scrapie [1, 2]. Among many other similar
panic to worldwide people.
diseases, include Kuru, Gerstman-Straussler-
Prions are defined as proteinaceous, infectious
Scheinker syndrome (GSS), Human prion disease,
particles which contain no nucleic acid and cause
Deer Chronic Wasting Disease and Sheep scrapie,
neurodegenerative disorders in arange of different
which has resulted in more than 160,000 cattle deaths
speicies [3], include prion protein (PrPC) and Scrapie
First author: Yaozhong Ding, master, research field: viral Prion protein (PrPSc), PrPSc is thought to pathogenic
molecular biology. E-mail: dyz1953@126.com. factor of transmissible spongiform encephalopathy
Corresponding author: Yongsheng Liu, Ph.D., associate
professor, research field: viral molecular biology. E-mail: (TSE) [2] which invariably involve a post-translational
liuyongshengvip@sina.com.
 Expression of Recombinant Protein Bovine Prion pCIp264 in COS-7 Cells and Its Detection
modification process of PrPC encoded by the host
euchromosome PrP gene during the period it
converted into the pathogenic form (PrPSc), PrP is
nomal cellular protein which has been found in both
neuronal and nonneuronal tissues [4]. It is located on
the exterior cell surface and is attached to the plasma
membrane by a glycosylphosphatidylinositol (GPI)
anchor. Fourier transform infrared (FTIR) and circular
dichroism (CD) spectroscopic studies show that PrPC
have 42% α-helical in structure with little β-sheet. In
contrast PrPSc has less α-helical structure and
substantial amounts of β-sheet, rise to 45%, because of
transform of α-helical to β-sheet [5-7].
Since the crucial infectious event in protein-
transmitted diseases is an induced misfolding of prion
proteins (PrPc) catalyzed by already misfolded PrPSc,
it is of high importance that such collisions are
enhanced by two-dimensional diffusion in cell
membranes is of high importance compared to
three-dimensional diffusion in solution [8]. The level
of PrP mRNA in brain is higher than other tissue, but
purification of PrPC from rodent has been difficult [9].
To understand better the formation of PrPSc, it seemed
useful to develop a system for produced a large
quantities of PrPC since there is no nature source of
PrPC. So, many resechers focused on cultured cells for
synthesis and expession of PrP recombinant vectors
into different cells [10-12].
The pCI-neo mammalian expression vector carries
the human cytomegaloviruse (CMV) immediate-early
enhancer / promoter region to promote constitutive
expression of cloned DNA inserts in mammalian cells.
This vector has a large multiple cloning region, the
capability to generate single-stranded DNA, and T7
and T3 RNA polymerase promoters for the synthesis
of RNA in vitro. In addition to these feature, this
vector contains the neomycin phosphtransferase gene
which serves as a marker for the selection of stable
transfected cells with G418.
COS cells have been used to transiently express a
large number of heterologous gene products.
31
Expression of functionally active antibodies in COS
cells was first reported in 1987 [13] and has now
become almost routine [14-17]. COS-7 cells
constitutively express simian virus 40 (SV40)
T-antigen and support replication of expression
plasmids containing the SV40 origin of replication,
amplifying the introduced expression cassettes [18].
In the previously study, the authors have described
some in vitro amplification method, but those studies
indicated that the expression of system have a number
of limitations [19-21]. In this paper, the authors used
pCI-neo vecter to construct a recombinant pCIp264
(cotains mPrP, N-signalpeptide and C-GPI anchor)
plasmid to express it in the COS-7 cells and
meanwhile detect the expression fusion using
in-ELISA, in-IFA and werstern blot, and obtain some
approximative nature PrPC.
2. Materials and Methods
2.1 Materials
The pCI-neo vector and lipofection provided by
Invitrogen life Sciences (USA), E. coli competent cells,
Taq DNA polymerase, T4 DNA ligase and Penicillin,
Streptomycin were from Takara (Japan). COS-7 cells
were from Shanghai Institute of Cell Biology, Chinese
Academy of Sciences (China).
2.2 Methods
2.2.1 Primer Design and PCR Reaction Conditions
The authors designed specific PCR primer pairs of
pCIp264, L1 was an up-primer containing a
EcoRⅠsite and a Kozak sequence, and L2 was a down-
primer adding a Sal I site (TaKaRa Biotechnology
company). L1: 5’ - ccggaattcgccgccatggtgaaaagccacat
- 3’ (the underlined nucleotides were the site). L2: 5’ -
acgcgtcgacctatcctatgagaaaaatgagg - 3’ (the underlined
nucleotides were Sal I site).
PCR was carried out Fermentas Taq DNA
polymerase master-mix in a 50 μL final reaction
volume. The master-mix contains per reaction 37.6 μL
deionized water, 5 μL 10 × PCR reaction buffer and 2
32 Expression of Recombinant Protein Bovine Prion pCIp264 in COS-7 Cells and Its Detection

µL 20 mM MgCl2, 2 μL 10 mM dNTP, 0.5 μL of each
primer, 0.4 µL Taq polymerase and 1 μL template.
PCR reactions were performed in a DNA Engine
MinicyclerTM (MJ Research Inc.) with 5 min activation
of Fermentas Taq DNA polymerase at 95 ℃, 1 min
template denaturing at 94 ℃, 55 s primer annealing at
55 ℃ and 50 s elongation at 72 ℃ for 40 cycles.
Amplification completion was achieved at 72 ℃ for 10
min. Amplified PCR products were analyzed by 0.8%
agarose-gel electrophoresis (Gene Tech LTD, China).
2.2.2 Generation of Expression Vectors
The pCIp264 recombinant vectors were generated
from the pCI-neo vector via SalⅠ- EcoRⅠdigested,
and ligatted the purified PCR product of PrP264 which
were digested with EcoRⅠ and SalI (Fig. 1).
Recombinant plasmid was transformed into E. coli
DH5a cells and confirmed by PCR, restriction enzyme
digestion, and DNA sequencing.
2.3 Cloning, Selection and Amplication
ori CMV I.E enhancer
1 1
intron
COS-7 cells were grown in DMEM (Hyclon, USA)
medium supplemented with 10% newborn calf serum
(PAA), seeded at 1 × 106 cells in the 6-well plates
(Corning, USA). After 24 h, each dish of cells was
trasfected with 3.5 µg of pCIp264 or pCIneo using
lipofection. The cells were grown in the presense of
100 µg/mL G418 (Sigma, USA), and thirty clones were
selected using 200 µg/mL and 300 µg/mL G418. The
surviving clones were analyzed the recombine protein.
2.4 Indirect Immunofluorescence (In-IFA) Analysis
COS-7 cells were grown in the presense of 100 µg/
mL G418 for 14 days in the 6-well plate, then detected
the expression of recombinant PrP using indirect-IFA:
(1) Discard the medium, and rinse once with PBS (pH
7.4) and discard PBS. (2) Add volumes of 2 mL 80%
acetone to each well of 6-well plate, incubate plates at
37 ℃ for 1 h. (3) Discard the acetone and rinse 3 times
with PBS-0.1% Tween-20 (PBST, pH 7.4), and then
lacZ
PrP264

T7 EcoR I
Ampr pCI-neo vector T3 Sal I PrP264-T vector
SV40 late poly(A)
5472bp 3484bp
Ampr

f1 ori
Synthetic poly(A) lacZ

SV40 enhancer PO
neo ori

ori CMV I.E.enhancer

1
T7
EcoR I
Ampr
pCIp264
PrP264

6224bp
Sal I
Synthetic poly(A)
T3
SV40 later poly(A)

neo fi ori
SV40 enhancer

Fig. 1 Construction of recombinant plasmid pCIp264.

 Expression of Recombinant Protein Bovine Prion pCIp264 in COS-7 Cells and Its Detection
incubated with 1:300 dilution of PrP (7B6 / D2) mouse
monocolonal IgG (santa cruz Biotechnology) using
PBST for 50 min at 37 ℃. (4) After a further wash,
they were incubated for 1 h in 50 µL of a 1:3,000
dilution of FITC-goat anti-mouse IgG using PBS. (5)
Detecting the expression of the rocombinent protein by
Fluorescence microscope (Olympus, BX51, Japan)
after three more washes.
2.5 Western Blot Analysis
Lysates of host cells containing parental vector, the
purified recombinant protein of PrP, were separated by
SDS-PAGE on 12% polyacrylamide, and were
transferred to a nitrocellulose membrane. Then the
membrane was blocked with 5% skim milk (Fluca,
Switzeland) and 2% BSA (Fluca) in PBST at 4 ℃ for
16 h, washed three times with PBST, and incubated
with 1:100 PrP (7B6 / D2) mouse monocolonal IgG at
37 ℃ for 2 h. After three washes in PBST, the
membranes were incubated with a 1:1,000 dilution of
anti-mouse IgG goat antibody conjugated with
horseradish peroxidase (Sigma) at 37 ℃ for 1 h.
Diaminobenzidine and 0.05% H2O2 (v / v) were used as
chromogen and substrate, respectively. The reaction
was stopped with distilled water after three washes as
mentioned above.
2.6 ELISA Analysis
ELISA was performed in the 96-well microtiter
plates were coated with recombinant pCIp264 protein
in 0.1 M carbonate / bicarbonate buffer, pH 9.4,
overnight at 4 ℃. Plates were blocked with 5% skim
milk in PBS and washed three times with PBS
containing 0.1% Tween-20 (PBST, pH 7.4). After three
washings, diluted PrP (7B6 / D2) mouse monocolonal
IgG (1:300) was added for 1 h at 37 ℃. The plates were
subsequently washed, and added horseradish
peroxidase conjugated goat anti- mouse IgG (1:3,000
dilution). After incubation for 1 h at room temperature,
the plates were washed again in PBST. After three
more washes, the ELISA reaction was developed by
33
the addition of ophenylenediamine-H2O2 for 20 min at
37 ℃. Meawhile, controls included blanks (PBS only),
known negative sera (negative control), positive sera
(positive control). The reaction was stopped by the
addition of 50 µL 1.5 M H2SO4 and the OD490 was
read by a plate reader (Bio-Rad, CA, USA).
3. Results
3.1 Results of PCR Amplication and Analysis of
Recombinant Plasmid
Electrophoresis showed the size of the PCR products
of the gene PrP was about 790 bp. This result was
consistent with the reality size of gene (792) of PrP.
Using the methods of PCR with L1 and L2 primers and
double enzyme digestion with SalⅠ- EcoRⅠin
identifying reconstruction plasmid pCIp264, the
electrophoresis results showed that the size of PCR
products was around 790 bp, and the product of
enzyme digestion, which was derived from pCIp264
was around 720 bp in length (Figs. 2 & 3). The results
showed that the gene of PrP was correctly inserted into
the vector pCI-neo.
3.2 Analysis of in-IFA
The expressions of the pCIp264 was examined by
IFA analysis. As shown in Fig. 4 indicated that
COS-7 cells infected with pCIp264 could be stained
with PrP (7B6 / D2) mouse monocolonal IgG and
goat anti- mouse IgG conjugated with fluorescein.
3.3 Results of ELISA Detection
In this paper, the authors established an in-ELISA
assay which can detect the expression fusion of
pCIp264. By checkerboard titration tests, the
concentration of coating antigen was 0.4 pg/well, and
the dilutions of the sera and HRP-IgG were 1:300 and
1:3,000, respectively. A mean P / N (OD the positive
sample / OD the negative control) of 1.461 with a
standard deviation (SD) of 0.196 was obtained from
30-negative sample including pCIneo vectors and
34 Expression of Recombinant Protein Bovine Prion pCIp264 in COS-7 Cells and Its Detection

M 1 2 3 Table 1 The expression of pCIp264 in in-ELISA.

Dilution 1:2 1:4 1:8
30B 1.259 1.095 0.886
5C2 0.205 0.175 0.155
Positive control 2.433 2.344 2.050
Negative conrrol 0.196 0.183 0.168
Black conrrol 0.037 0.034 0.040
Fig. 2 PCR analysis of PrP1-264.
M: 2000 marker. 3: PrP1-264. 30B is clone cells of pCIp264. 5C2 is clone cells of pCIne.
M 1 2 M
Table 2 Comparison of the in-ELISA with RT-PCR.
In-ELISA Positive Negative Total
Positive 19 0 19
Negative 1 6 7
Total 20 6 26

Fig. 3 The digestion of recombinant plasmid.

M (left): 10 kb marker. 1 & 2: SalⅠ+ EcoRⅠdigestion of
pCIp264. M (right): 2 kb marker.

Fig. 5 SDS-PAGE analysis of clone cells.

M: Protein molecular marker. 1: 30B is pCIp264 transfected
cells lysates. 2: 5C2 is pCIneo transfected cells lysates .
A B
Fig. 4 IFA analysis of the expression of pCIp264 protein. M
A: Cells transfected by pCIp264. B: Negative control.

COS-7 cells, so the cut-off value was adjusted to 2.1.

Namely, 2.1 times the OD490 value obtained from
reference negative serum was set as the criteria. A
sample was considered positive if its OD490 value was
over or equal to the criterion (Table 1).
To determine the specificity and sensitivity of the
in-ELISA, 26 known samples were tested and Fig. 6 Western blot analysis of pCIp264.
compared with the results of RT-PCR (Table 2), 20 M: Protein molecular marker. 1: 30B is pCIp264 transfected
samples are positive using PT-PCR, 1 was negative in cells lysates. 2: 5C2 is pCI-neo transfected cells lysates.

in-ELISA. For the corresponding negative serum
samples, nothing of 6 tested positive in in-ELISA. The
comparison of the tests gave a calculated sensitivity of
95% and a specificity of 100%.
3.4 Western Blot Assay of Recombinant Proteins
The expressions of the pCIp264 was examined by
western blot. As shown in Figs. 5 and 6, the specific
bands of 34 kDa were clearly observed in COS-7 cell
lysates of pCIp264, whereas no band was found in
COS-7 cell lysates of pCI-neo.
4. Discussion
A conformational change in the structure of PrP
 Expression of Recombinant Protein Bovine Prion pCIp264 in COS-7 Cells and Its Detection
seems to be the fundamental event underlying the prion
diseases [5]. PrP1-264aa contain the mature PrP, N
terminal signal peptide and C terminal GPI anchor
composition. The mature PrP (90-231) is PrP 27-30,
can be development of TSE [22] by transgenic mice
expressing [23]. The N terminus is believed to be
unnecessary for the development of prion
disease，while this region seems to be involved in the
cellular function of PrPC, because the N-terminal
2＋
domain displays high affinity for binding of Cu [24,
25], and bind different classes of macromolecules,
including sulfated glycans and RNA [26] which
stimulated PrPSc-dependent cell-free conversion of
PrPC into the proteinase K-resistant PrP isoform [27].
Because of its high affinity for Cu2 and its ability to
＋
bind cellular macromolecules, the N-terminal region
may affect the pathways of misfolding and influence
the conformational diversity of abnormal β-sheet-rich
isoforms generated in vivo. Thus, the lengths of
PK-resistant fragments generated upon treatment of
PrPSc were Cu2 -dependent [28]. It is reasonable to
＋
speculate, that the N-terminal region, although not
essential for infectivity, may in fact substantially
impact the conformational diversity of PrPSc strains
and subtypes and, therefore, assist in the cell-free
conversion of recombinant PrP into the infectious
isoform [29].
GPI-anchored PrPC is critical to TSEs, play an
important role in PrPSc formation. GPI anchoring may
limit the formation of large, higher order, highly stable
aggregates such as amyloid plaques and promote the
formation of smaller oligomeric assemblies that can
exhibit enhanced seeding activity, neurotoxic activity,
and infectivity [30, 31], and might spread readily
through the extracellular milieu. Intercellular transfer
of PrPC was demonstrated to be dependent on the GPI
anchor [32] and GPI anchoring facilitates the
propagation of prion diseases and provide direct
evidence of fundamental cell–cell aggregate-spreading
mechanisms thought to be required for propagation of
PrPSc in prion diseases [33].
35
To test the involvement of the GPI anchor and N
terminal signal peptide in the structural and functional
aspects of PrP, hence, the authors decided to express
PrP1-264aa in COS-7 cells system to generate a
amount of levels of PrPC that may prove essential for
dissecting the mechanism of PrPSc formation.
Acknowledgment
This work was supported by grants from the
National Natural Science Foundation (30671563,
30700597) and Key Project of Science and Technology
of Gansu Province (0801NKDA034) and by gifts from
the Development Planning Project of Science and
Technology of Lanzhou (07-2-12, 2008-1-167).
Reference
[1] J.W. Wilesmith, J.B.M. Ryan, M.J. Atkinson, Bovine
spongiform encephalopathy: epidemiological studies on
the origin, Vet. Rec. 128 (1991) 199-203.
[2] J.R. Silveira, G.J. Raymond, A.G. Hughson, R.E. Race,
V.L. Sim, The most infectious prion protein particles,
Nature 437 (7056) (2005) 257-261.
[3] G.L. Silverman, K. Qin, R.C. Moore, Y. Yang, P.
Mastrangelo, et al., Doppel is an N-glycosylated,
glycosylphosphatidylinositol-anchored protein,
Expression in testis and ectopic production in the brains of
Prnp (0 / 0) mice predisposed to Purkinje cellloss, J. Biol.
Chem. 275 (2000) 26834-26841.
[4] D.A. Harris, Cellular biology of prion diseases, Clinical
Microbiology Reviews 12 (3) (1999) 429-444.
[5] K.M. Pan, M. Baldwin, J. Nguyen, M. Gasset, A. Serban, et
al., Conversion of alpha-helices into beta-sheets features in
the formation of the scrapie prion proteins, Proc. Natl. Acad.
Sci. USA 90 (1993) 10962-10966.
[6] P. Pergami, H. Jaffe, J. Safar, Semipreparative
chromatographic method to purify the normal cellular
isoform of the prion protein in nondenatured form, Anal.
Biochem. 236 (1996) 63-73.
[7] R. Riek, S. Hornemann, G. Wider, M. Billeter, R.
Glockshuber, et al., NMR structure of the mouse prion
protein domain PrP (121-231), Nature 382 (1996)
180-182.
[8] D.L. Cox, R.R.P. Sing, S.C. Yang, Prion disease:
exponential growth requires membrane binding,
Biophysical Journal 90 (11) (2006) 177-179.
[9] M. Gasset, M.A. Baldwin, R.J. Fletterick, S.B. Prusiner,
Perturbation of the secondary structure of the scrapie prion
protein under cond itions that alter infectivity, Proc. Natl.
36 Expression of Recombinant Protein Bovine Prion pCIp264 in COS-7 Cells and Its Detection
Acad. Sci. USA 90 (1993) 1-5.
[10] C. Hundt, S. Weiss, The prion-like protein Doppel fails to
interact with itself, the prion protein and the 37 kDa / 67
kDa laminin receptor in the yeast two-hybrid system,
Biochim. Biophys. Acta. 1689 (1) (2004) 1-5.
[11] E. Turk, D.B. Teplow, L.E. Hood, S.B. Prusiner,
Purification and properties of the cellular and scrapie
hamster prion proteins, Eur. J. Biochem. 176 (1988)
21-30.
[12] T.C. Blochberger, C. Cooper, D. Peretz, J. Tatzelt, O.H.
Griffith, M.A. Baldwin, et al., Prion protein expression in
Chinese hamster ovary cells using a glutamine synthetase
selection and amplification system, Protein Engineering
10 (12) 1997 1465-1473.
[13] U.H. Weidle, A. Borgya, R. Mattes, H. Lenz, P. Bucket,
Reconstitution of functionally active antibodydirected
against creativekinase from expressed heavy and light
chains in non-lymphoid cells, Gene 51 (1987) 21-29.
[14] D. Kanga, J.-H. Laa, E.-J. Kima, J.-Y. Parka, S.-G. Honga,
et al., An endogenous acid-sensitive K+ channel expressed
in COS-7 cells, Biochemical and Biophysical Research
Communications 341 (4) (2006) 1231-1236.
[15] K. Shimizu, T. Fujino, K. Ando, M. Hayakawa,
Overexpression of oxidized protein hydrolase protects
COS-7 cells from oxidative stress-induced inhibition of
cell growth and survival, Biochemical and Biophysical
Research Communications 304 (4) (2003) 766-771.
[16] S.R. Nelson, M.Y. Ali, K.M. Trybus, D.M. Warshaw,
Random walk of processive, quantum dot-labeled myosin
Va molecules within the actin cortex of COS-7 cells,
Biophys. J. 97 (2009) 509-518.
[17] C.M. Yonamine, A.R.B. Prieto-da-Silva, G.S. Magalhaes,
G. Rádis-Baptistad, L. Morgantia, et al., Cloning of serine
protease cDNA from Crotalus durissus terrificus venom
gland and expression of a functional Gyroxin homologue
in COS-7 cells, Toxin 54 (2009) 110-120.
[18] B.L. Daugherty, J.A. Law deMartino, M.F. Kawka, D.W.
Singer II, G.E. Mark, Polymerase chain reaction facilitates
the clouin- ing,CDR-grafting, and rapid expression of a
murine monoclonal antibody directed against the CD18
component of leukocyte inlegrins, Nucleic Acids Res. 19
(1991) 2471-2476.
[19] W. Lu, P. Zhang, J. Zhang, Y.S. Liu, G.S. Wei, et al.,
Cloning and expression of bovine prion protein 27-30
gene, Chinese J. Preventive Veterinary Medicine 29 (4)
(2007) 277-280.
[20] Y.Z. Ding, J. Zhang, Y.S. Liu, H.T. Chen, L.N. Ma, et al.,
Stable expression of bovine prion protein (boprp) in CHO /
dhfr- cells, Actab Agricultural Jiangxi 21 (4) (2009)
101-103.
[21] Y.Z. Ding, J. Zhang, Y.S. Liu, H.T. Chen, L.N. Ma, et al.,
Detection and expression of bovine prion protein (boprp)
in COS-7 cells, Jiangsu Journal of Agricultural Sciences,
in press.
[22] S.B. Prusiner, M.P. McKinley, K.A. Bowman, D.C. lton,
P.E. Bendheim, et al., Scrapie prions aggregate to form
amyloid-like birefringent rods, Cell 35 (1983) 349-358.
[23] M. Fischer, T. Rulicke, A. Raeber, A. Sailer, M. Moser, et
al., Prion protein (PrP) with aminoproximal deletions
restoring susceptibility of PrP knockout mice to scrapie,
EMBO J. 15 (1996) 1255-1264.
[24] E. Aronoff-Spencer, C.S. Burns, N.I. Avdievich, G.J.
Gerfen, et al., Identification of the Cu2＋ binding sites in
the N-terminal domain of the prion protein by EPR and
CD spectroscopy, Biochemistry 39 (2000) 13760-13771.
[25] J.H. Viles, F.E. Cohen, S.B. Prusiner, D.B. Goodin, P.E.
Wright, et al., Copper binding to the prion protein:
structural implications of four identical cooperative
binding sites, Proc. Natl Acad. Sci. USA 96 (1999)
2042-2047.
[26] R. Gonzalez-Iglesias, M.A. Pajares, C.O.J. Espinosa, B.
Oesch, M. Gasset, Prion protein interaction with
glycosaminoglycan occurs with the formation of
oligomeric complexes stabilized by Cu(II) bridges, J. Mol.
Biol. 319 (2002) 527-540.
[27] N.R. Deleault, R.W. Lucassen, S. Supattapone, RNA
molecules stimulate prion protein conversion, Nature 425
(2003) 717-720.
[28] J.D.F. Wadsworth, A.F. Hill, S. Joiner, G.S. Jackson, A.R.
Clarke, et al., Strain-specific prion-protein conformation
determined by metal ions, Nature Cell Biol. 1 (1999)
55-59.
[29] O.V. Bocharova, L. Breydo, A.S. Parfenov, V.V. Salnikov,
I.V. Baskakov, In vitro conversion of full-length
mammalian prion protein produces amyloid form with
physical properties of PrPSc, J. Mol. Biol. 346 (2005)
645-659.
[30] F. Chiti, C.M. Dobson, Protein misfolding, functional
amyloid and human disease, Annu. Rev. Biochem. 75
(2006) 333-366.
[31] M. Tanaka, S.R. Collins, B.H. Toyama, J.S. Weissman,
The physical basis of how prion conformations determine
strain phenotypes, Nature 442 (2006) 585-589.
[32] T. Liu, R. Li, T. Pan, D. Liu, R.B. Petersen, B.S. Wong, P.
Gambetti, M.S. Sy, Intercellular transfer of the cellular
prion protein, J. Biol. Chem. 277 (2002) 47671-47678.
[33] J.O. Speare, D.K. Offerdahl, A. Hasenkrug, A.B. Carmody,
G.S. Baron, GPI anchoring facilitates propagation and
spread of misfolded Sup35 aggregates in mammalian cells,
The EMBO Journal 29 (2010) 782-794.
Aug. 2010, Volume 4, No.5 (Serial No.30)
Journal of Life Sciences, ISSN 1934-7391, USA

The Influence of Magnetite Nanoparticles on Human

Leukocyte Activity

Anežka Džarová1, Martina Dubničková2, Vlasta Závišová1, Martina Koneracká1, Peter Kopčanský1, Hubert
Gojzewski3 and Milan Timko1
1. Institute of Experimental Physics, Slovak Academy of Sciences, Košice 040 01, Slovakia
2. Departments of Cell and Molecular Biology of Drugs, Faculty of Pharmacy, Comenius University, Bratislava 832 32, Slovakia
3. Institute of Physics, Poznan University of Technology, Poznan 60-965, Poland

Received: April 20, 2010 / Accepted: June 30, 2010 / Published: August 30, 2010.

Abstract: In this contribution the influence of chemically synthesized magnetite particles coated by sodium oleate and PEG (MPEG),
and magnetosomes (MS) was gradually tested on the process of phagocytosis and the metabolic activity (lysozyme and peroxidase
activity) in leukocyte. Lysozyme activity is oxygen-independent liquidation mechanisms of engulfed microorganism, peroxidase
activity is oxygen-dependent one. The both tested samples MS and MPEG lysed leukocyte cells during incubation. MPEG with
concentration 10 and 20 μg/mL lysed almost all leukocytes and their cell viability was in the 14 ± 0.05% range. On the other hand, MS
begin to influence leukocytes activity at the concentration of 1 μg/mL and this influence grows with increasing concentration up to
20 μg/mL. MS are more suitable for biological applications than MPEG which are more aggressive material than MS and their using is
unavailable for these types of the test mainly for the concentration 10 - 20 μg/mL.

Key words: Human leukocytes activity, magnetosomes, magnetite particles, sodium oleate, PEG.

1. Introduction properties, solubility and low own toxicity [4]. The

important factors, which determine the biocompatibi-
Nanomedicine (such as magnetic drug delivery for
lity and toxicity of magnetic microspheres, are the
example) and nanodiagnostics are believed to offer
magnetically responsive components such as magnetite,
hope with some of the most intractable challenges in
iron, nickel, cobalt, neodymium-iron-boron or
human health [1]. Biocompatible ferrimagnetic and
samarium-cobalt, and the size of the particles, their
ferromagnetic nanoparticles are widely used in experi-
matrix substance and the coating used. Iron oxide
mental biology and clinical medicine [2, 3]. Magnetic
particles seem to be generally well tolerated [5].
nanoparticles can be applied to special medical techni-
Nanotechnology makes use of the special surface
ques for example: separation, immunoassay, magnetic
properties of extremely small particles. In this rapidly
resonance imaging (MRI), drug delivery, and hyper-
growing field, many different materials are produced
thermia. These applications impose strict requirements
for a multitude of diverse applications. Possible
on the particles physical, chemical and pharmacolo-
adverse health effects of these materials however are so
gical properties, including chemical composition,
far scarcely investigated and are therefore a special task
granulometric uniformity, crystal structure, stability of
of toxicology. Although strategies for risk emphasize
magnetic properties, surface structure, adsorption
the fact, that on the cellular, subcellular and molecular
levels, interactions between nanoparticles and target
Corresponding author: Anežka Džarová, Ph.D., research cells relevant for the induction of possible adverse
fields: biophysics, nanofluid, nanoparticles, bacterial magnetic
nanoparticles. E-mail: dzarova@saske.sk. health. These effects are poorly understood.
38 The Influence of Magnetite Nanoparticles on Human Leukocyte Activity
The objective of this study was to test effects of
concentrations of two different kinds of magnetic
particles (chemically synthesized magnetite particles
coated by sodium oleate and PEG and magnetosomes-
bacterial magnetic nanoparticles) on human leukocyte
activities in vitro. Phagocytic and metabolic activity of
human leukocytes was studied.
2. Experimental Methods
Two types of nanoparticles were used in the
experiment: the chemically synthesized magnetite
nanoparticles prepared by coprecipitation method
coated by sodium oleate and PEG (MPEG) and by
biomineralization process from magnetotactic bacteria
- biological magnetic particles - magnetosomes (MS).
2.1 Preparation of Magnetic Nanoparticles
2.1.1 Spherical Magnetic Nanoparticles
The synthesis of the spherical magnetic
nanoparticles was based on coprecipitation of Fe2+ and
Fe3+ salts in alkali medium. To obtain a Fe3O4
precipitate, FeCl2·4H2O and FeCl3·6H2O were
dissolved in deionized water by vigorous stirring (the
ratio [Fe3+]:[Fe2+] was 2:1). The solution was heated to
80 ℃ and 25% NH4OH was added. The precipitate
was isolated from solution by magnetic decantation by
washing with demineralization water. Then surfactant
sodium oleate (C17H33COONa) was added to the
mixture to prevent agglomeration of the magnetic
particles. Mixture was heated until the boiling point
was reached and continuously stirred. Agglomerates
were removed by centrifugation (9000 RPM for 30
minutes). To improve biocompatibility of magnetic
fluid neutral and hydrophilic compound poly-ethylene
glycol (PEG) was added (at 50 ℃, under the stirring).
2.1.2 Bacterial Magnetosome
Bacterial magnetosomes investigated in this
contribution were synthesized by biomineralization
process of magnetotactic bacteria Magnetospirillum
strain AMB-1. The bacteria are a Gram - negative
α-proteobacterium that is more oxygen-tolerant
bacteria. The medium for Magnetospirillum sp.
AMB-1 consisted of (per 1L medium): 10 mL Wolfe’s
vitamin solution, 5 mL Wolfe’s mineral solution, 0.68
g KH2PO4, 0.848 g sodium succinate hexahydrate,
0.575 g sodium tartrate dihydrate, 0.083 g sodium
acetate trihydrate, 0.225 mL 0.2% (w / v) resazurin
(aqueous), 0.17 g NaNO3, 0.04 g ascorbic acid, 2 mL
0.01 M ferric quinate [6]. Resazurin was added to
media as colorimetric indicator of redox potential. The
pH was adjusted to 6.75 with NaOH. This medium was
bubbled under nitrogen for a period of 1 hour, using
copper as a reducing agent, and was subsequently
dispensed into culture tubes in an anaerobic hood.
Inoculated tubes were incubated at 25 ℃ for a period of
4 days.
Techniques for the isolation and purification of
magnetosome particles from Magnetospirillum species
are based on magnetic separation [7, 8] or a
combination of a sucrose-gradient centrifugation and a
magnetic separation technique [9]. These procedures
leave the surrounding membrane intact and
magnetosome preparations are apparently free of
contaminating material. Owing to the presence of the
enveloping membrane, isolated magnetosome particles
form stable, well-dispersed suspensions. After
solubilization of the membrane by a detergent, the
remaining inorganic crystals tend to agglomerate as a
result of magnetic attractive forces.
Typically, 2.6 mg bacterial magnetite can be derived
from a 1,000 mL culture of Magnetospirillum sp.
Fig. 1 TEM image of spherical magnetic particles.
 The Influence of Magnetite Nanoparticles on Human Leukocyte Activity
AMB-1. For the isolation of the magnetosome particles,
we have used the modified method described by
Grünberg et al. [7]. For the isolation of magnetosomes
approximately 10 g (wet weight) cells of
Magnetotacticum magnetospirillum suspended in 100
mL of 20 mM HEPES - 4 mM EDTA, pH 7.4, was split
up (disrupted) by sonification. The unbroken cells and
the cell debris were removed from the sample by
centrifugation (10 min, 3,036 rpm). The cell extract
was placed on to a magnet (NdFeB - magnets, 1 h). The
black magnetosomes sedimented at the bottom of the
tube and the residual contaminating cellular material
was retained in upper part tube. The residual
contaminating cellular material was decanted. To
eliminate the electrostatically bound contamination,
the magnetic particles were rinsed first with 50 mL of
10 mM HEPES - 200 mM NaCl, pH 7.4, and
subsequently with 100 mL of 10 mM HEPES, pH 7.4.
After removal of the cell extract from the magnets, the
magnetic particles were flushed with 10 mM HEPES
buffer. The magnetosome suspension (black sediment)
was centrifugated (18,000 rpm, 30 min at 4 ℃). After
centrifugation the cell extract was placed on the magnet
for 30 minutes. The magnetic particles were
sedimented at the bottom of the tube, whereas residual
contaminating cellular material was retained in upper
part tube. The last procedure was repeated ten - times to
obtain well purified magnetosomes.
The following notation for prepared samples was
used:
CS - control sample;
MS - sample of leukocytes with magnetosomes
(bacterial magnetite nanoparticles) of concentration:
0.1, 1, 10, 20 μg/mL;
MPEG - sample of leukocyte with chemically
synthesized magnetite particles coated by sodium
oleate and PEG, of concentration: 0.1, 1, 10, 50 μg/mL.
2.2 Isolation of Human Leucocytes
Human leucocytes from 6 - 8 healthy volunteers
(OHT - Derer‘s Hospital, Bratislava, Slovakia) were
isolated and purified by HistoPaque - 1077 (Sigma,
39
Fig. 2 TEM image of bacterial magnetosomes.
(OHT - Derer‘s Hospital, Bratislava, Slovakia) were
isolated and purified by HistoPaque - 1077 (Sigma,
USA) according to Boyum [10]. In the next step, they
were cultivated for 18 h exposed to concentrations of
synthetic magnetic particles and magnetosomes-
bacterial magnetite nanoparticles according to
Bukovský et al. [11]. Control samples contained
human leucocytes that were not affected by
modulators.
The phagocytic activity and index of leucocytes
were determined by a standard method. The phagocytic
activity was determined as percentage of the
phagocytosing cells; the phagocytic index was
calculated as the average number of engulfed
Streptococcus faecalis for 100 phagocytes. For the both
data we used 100 phagocytes per coverslip. Next the
lysozyme activity by lysis of M. luteus cells was
determined. It was measured spectrophotometrically at
410 nm in 0-20 min period and detected as changes in
absorbance. The peroxidase activity was stopped after
20 min by H2SO4 and changes in A490 were measured
by MR 5000 spectrophotometer (Dynatech). Particular
results showed the influence of synthetic magnetic
particles as well as magnetosomes on the response of
nonspecific immunity of human leukocytes in vitro.
2.3 Phagocytic Index
The phagocytic index was determined
microscopically. A suspension of 100 μL of human
leucocytes (2 × 106 cells/mL) was incubated for 1 h at
37 ℃ with 50 μL of heat inactivated Streptococcus
40 The Influence of Magnetite Nanoparticles on Human Leukocyte Activity
faecalis cells (5 × 108/mL) [11]. Wright‘s staining of
the suspension was performed according to the
conventional methodology. The numbers of engulfed
bacteria were counted for 100 leucocytes per coverslip.
2.4 Metabolic Activities
The ultrasonically disintegrated leucocytes (18 kHz,
10 s - desintegrator Soniprep 150) were centrifuged
(3,900 rpm, 10 min, 4 ℃). The supernatant (150 μL)
was mixed with 50 μL of a suspension of Micrococcus
luteus ATCC 4698 (OD410 = 0.8) in phosphate buffer
(pH = 6.2, 0.07 mol/L KH2PO4 and 0.07 mol/L
Na2HPO4 × 12 H2O) or 50 μl of peroxidase substrate
(benzene-1,2-diamine 5 mg/10 mL, freshly diluted
H2O2 100 μL/10 mL and 0.1 M tribasic sodium citrate
dihydrate in distilled H2O, pH 5.0). The lysozyme
activity was measured spectrophotometrically (λ = 410
nm) in 96 wells / plate over a 20-minute period. The
peroxidase reaction was stopped after 20 min with
H2SO4 (50 μL, 4 mol/L) and changes in A490 were
measured (MR 5000 spectrophotometer, Dynatech).
2.5 Statistical Analysis
The results are presented as mean of experimental
values ± standard deviations and as relative activities
(%). Statistical comparisons were made based on
repeated measurements (4-6 parallels) by Student’s t
test; a value P < 0.05 was regarded as statistically
significant.
3. Results and Discussion
The aim of experiment was to find out the influence
of chemically synthesized magnetite particles coated
by sodium oleate and PEG (MPEG) and magnetosomes
(MS) on biological activity of human leukocyte in vitro.
The examined biological activities of leukocytes
belong to the first defensive mechanism of organism to
dangerous matter. The influence on the process of
phagocytosis and the metabolic activity in human’s
leukocyte was gradually tested. Lysozyme activity is
organized into oxygen-independent liquidation
mechanisms of engulfed microorganism and
peroxidase activity into oxygen-dependent one. The
both of this activity belong to nonspecific immunity.
It was observed the leukocyte cell count in
dependence on concentration of nanoparticles during
the 18 hours incubation in RPMI-1640 with 10% fetal
bovine serum under the 5% CO2 at 37 ℃. Control
sample (CS) contains 3.4 × 106 cells. As it is seen in Fig.
3, increasing concentration MPEG and MS caused
decrease cell number in all samples in comparison to
CS. The both tested samples MS and MPEG lysed
leukocyte cells during incubation. As it can be seen
MPEG with concentration 10 - 20 μg/mL lysed almost
all leukocytes during 18 hours incubation and their cell
viability was in the 14 ± 0.05% range. On the other
hand, MS begin to influence leukocyte activity at the
concentration of 1 μg/mL and this influence grows
with increasing concentration up to 20 μg/mL.
The experiment confirms the results obtain by Häfeli
and Pauer [5]. The control incubation of the cells with
FeCl3 solutions showed a small effect on cell growth.
At concentrations below 5 μg/mL, no toxicity was seen.
Iron concentrations between 10 – 2,000 μg/mL showed
lymphoma cell survival of about 80 ± 20%. Higher iron
concentrations led to complete cell kill. The human
prostate cells were more susceptible to iron than were
the lymphoma cells. Their cell viability between 10 –
500 μg/mL was in the 60 ± 20% range, decreasing then
rapidly to no survival at the 10,000 μg/mL iron
concentration. Depending on the size and the materials
number of cells
100% *
** *** *** *** *** *** ***
50%
0%
PE 1 0
50
S
M 1
10
PE 20
M 0.1
PE 1
0.
C
M G
S
M
PE
S
G
M
M
M
M
Fig. 3 Number of leukocytes for incubation in CO2 at 37 ℃,
n=10.
statistical significance: * = P < 0.05; ** = P < 0.01; *** = P <
0.001. (The same with Figs. 4-9).
 The Influence of Magnetite Nanoparticles on Human Leukocyte Activity 41

used to prepare the magnetic microspheres, different

phagocytic activity
** ** *** * * ***
100%
paths of toxicity are expected [5].
The magnetic nanoparticles interact with human 50%
viable cells without any further specific groups,
0%
attached to the cell surface and are incorporated into

10

20

1
0.
0.
C

G
vesicles via endocytotic mechanisms. Most of the

S
M

PE
S

G
M

M
M

PE

M
M
nanoparticles are retained in the cells within vesicles,
mainly phagosomes. The interaction of the magnetic
Fig. 4 Number of phagocytosing cells from 100 phagocytes,
nanoparticles with cells depends on various parameters, n=6.
e.g. cell type, duration of incubation or presence of

number of engulfed
inhibiting or supporting agents [12]. The internalize- 10

cell/leukocyte
***
tion process depends upon the nanoparticles concentra- *** *** ***
***
5
tion and the nanoparticles hydrodynamic radii [13].
0
3.1 Phagocytic Activity of Human’s Leukocytes

1
1
S

10

20
1

0.
0.
C

EG
S

EG
M
S
The phagocytic activity was expressed as percentage

P
M

of the phagocytosing cells of all phagocytes and also as
phagocyte index, which was the number of the cells
Streptococcus faecalis engulfed by one phagocytic cell.
Phagocytosis (phagocytic activity and phagocyte index)
was suppressed in all samples what means, that in the
case of phagocytic activity as a mechanism nonspecific
immunity, the immunosuppression was demonstrated.
The phagocytes of MPEG samples at concentrations 10
- 50 μg/mL could not be observed the on coverslip (not
showed) (Figs. 4 & 5). These structures of MPEG and
MS were enabled avoidance of phagocytosis.
In the contribution of Revell [14], nanoparticles
were not membrane bound, are internalized in the cell.
The mechanism of internalization of nanoparticles is a
fusion of a cell or pinocytosis into it. It was also found
that the proportion of large nanoparticles was present
as a layer on the surface of cells and, depending on
their size, shape or electrical charge [14]. So the theory
of layers of nanoparticles on the surface of cells could
give rise to a suppression of phagocytosis, e.g., sterical
obstruction of particle (Streptococcus faecalis)
transition into cells.
3.2 Lysozyme Activity of Human’s Leukocytes
In the next step the lysozyme activity was studied.
M
P
M
Fig. 5 Number of engulfed cells per one leukocyte, n=6.
Lysozyme activity was stimulated only in the samples
MS for concentration higher than 1 μg/mL (Fig. 6).
Stimulation for liquidation mechanisms of engulfed
microorganism, which is mechanism independent of
oxygen, was increased with growing concentration.
The data of lysozyme activity of samples MPEG 10 -
50 μg/mL were not able to transform as the results. The
reason was the black colour and dense of liquid MPEG
sample for given concentrations.
The numbers of production unit lysozyme per 1 mL
were unchanged in all samples (Fig. 7). By the
comparison numbers of lysozyme unit per mL sample
and lysozyme activity showed that numbers of unit this
enzyme was 15 U/mL (average values with
experimental mistake). It can be concluded that number
of unit has not impact on immunomodulatory activities.
3.3 Peroxidase Activity of Human’s Leukocytes
On the other hand, peroxidase activity was stimula-
ted only in the samples MS of concentration 20 μg/mL.
The other samples show inhibition of their activity (Fig.
8). It follows that defensive mechanism (dependent
on oxygen) of engulfed microorganism destroying in
42 The Influence of Magnetite Nanoparticles on Human Leukocyte Activity
change of absorbance

0.08 * *** *** 0.002

*
**

min-1
*** ***
0-20 min

0.04 0.001 *** ***

***
***
0 0

M 0 .1
1

P 10
50
1
10

20
S

M G1
1

1
M S

10

P 20
1

1
0.

0.
0.
C

EG

C
S

EG

EG
S

E
EG
M

EG

M
S
S

M
P

P
M

P
M
P

M
M
Fig. 6 Lysozyme activity expressed change of absorbance M Fig. 9 Rate of peroxidase activity, n=6.
(410 nm) after 20 minutes of reaction, n=6.
treatment of bacterial infections because of the low rate
of bacterial resistance to these agents.
30
The use of antimicrobial enzymes covalently
U/ml

15 attached to nanoparticles is of special interest, resulting

in enhanced stability of protein-nanoparticle
0
conjugates and the possibility of targeted delivery. The
S

10

20

1
0.
0.

current article by Satishkumar and Vertegel [15]

C

G
S

S
M

PE
S

G
M

M
M

PE

explores the potential for targeted delivery of

M

antibacterial enzymes covalently attached to polymeric

Fig. 7 Number of lysozyme units/mL in the samples, n=6.
nanoparticles. Since bacterial cell walls are negatively
charged, nanoparticle charge can be used to control
change of absorbance

0.2 *
* bacteriolytic activity of covalently attached lysozyme.
0-20 min

0.1 When attached to positively charged nanoparticles,

** *** ***
*** covalently bound lysozyme shows significantly higher
0
antimicrobial activity than free lysozyme. At the same
1

10

50
1
1
S

time, lysozyme attached to negatively charged

10

P 20
1

0.
0.
C

EG
S

EG

EG
S

S
EG
M
S

P
M

nanoparticles shows much lower antimicrobial activity

P

P
M
M

M
M

than free enzyme. The observed effect can be used for

Fig. 8 Peroxidase activity expressed change of absorbance
development of novel antibacterial, “antibiotic - free”
(490 nm) after 20 minutes of reaction, n=3-4.
protein - nanoparticle conjugates [15].
leukocyte was stimulated only at higher MS
4. Conclusions
concentration. At lower concentration the suppression
of the activity was observed. It would be good to The effects of volume concentrations of two
emphasize that for sample MPEG with concentration 1 different kinds of prepared magnetic particles,
μg/mL this activity was very noticeable decreased. chemically synthesized magnetite particles coated by
The rate of peroxidase reaction (Fig. 9) was reduced sodium oleate and PEG (MPEG) and magnetosomes-
for all concentrations, too. In the case sample MS was bacterial magnetic nanoparticles (MS), on human
observed to decrease of this rate with decreasing of leukocyte activities in vitro were reported.
concentration. On the other hand, the significant The both tested samples of nanoparticles MPEG and
reduction of reaction rate for sample MPEG was MS lysed leukocyte cells during incubation. From
observed for higher concentration. obtained results follow that MPEG are more aggressive
Natural antimicrobial enzymes have recently material than MS and their using is unavailable for this
attracted much attention as promising candidates in the type of the test mainly in the range of the concentration
 The Influence of Magnetite Nanoparticles on Human Leukocyte Activity
10 - 50 μg/mL as a consequence of their toxicity. The
sample concentration of 0.1 μg/mL is practically not
effective for both samples.
In the case of the MPEG, leukocytes activity
decreases with growing concentration of magnetic
particles. The higher concentrations of MPEG than
10 μg/mL are not suitable as a consequence of their
toxicity.
MS begin to influence leukocyte activity at the
concentration of 1 μg/mL and this influence grows
with increasing concentration up to 20 μg/mL. At the
metabolic activity the effect is changing from
inhibition to stimulation. With respect of obtained
results for metabolic activities of human leukocyte, it
can be concluded that magnetosomes (MS) are more
suitable for biological applications than chemically
synthesized magnetite particles coated by sodium
oleate and PEG (MPEG).
Acknowledgments
This work was supported by the Slovak Academy of
Sciences (grants VEGA Nos. 2 / 0077 / 09, 1 / 4290 / 07,
2 / 0051 / 09 and Nanofluid, Centre of Excellence) and
Development of Technology of Magnetic Fluids for
Biomedical Applications Project No. 26220220005.
References
[1] European Technology Platform on NanoMedicine, Vision
Paper and Basis for a Strategic Research Agenda for
NanoMedicine, European Commission, Brussels, 2005.
[2] A.S. Lübbe, Ch. Bergemann, W. Huhnt, T. Fricke, H.
Riess, J.W. Brock, et al., Clinical experiences with
magnetic drug targeting: A phase I study with 4 -
Epidoxorubicin in 14 patients with advanced solid tumors,
Cancer Research 56 (1996) 4686-4693.
[3] A.S. Lübbe, Ch. Bergemann, W. Huhnt, T. Fricke, H.
Riess, J.W. Brock, et al., Preclinical experiences with
magnetic drug targeting: Tolerance and efficacy, Cancer
Research 56 (1996) 4694-4701.
[4] O.A. Kuznetsov, N.A. Brusentsov, A.A. Kuznetsov, N.Y.
43
Yurchenko, N.E. Osipov, F.S. Bayburtskiy, Correlation of
the coagulation rates and toxicity of biocompatible
ferromagnetic microparticles, JMMM 194 (1999) 83-89.
[5] U.O. Häfeli, G.J. Pauer, In vitro and in vivo toxicity of
magnetic microspheres, JMMM 194 (1999) 76-82.
[6] M. J. Wolin, E.A. Wolin, R.S. Wolfe, Formation of
methane by bacterial extracts, J. Biol. Chem. 238 (1963)
2882-2886.
[7] K. Grünberg, C. Wawer, B.M. Tebo, D. Schüler, A large
gene cluster encoding several magnetosome proteins is
conserved in different species of magnetotactic bacteria,
Appl. Environ. Microbiol. 67 (2001) 4573-4582.
[8] Y. Okuda, K. Denda, Y. Fukumori, Cloning and
sequencing of a gene encoding a new member of the
tetratricopeptide protein family from magnetosomes of
Magnetospirillum magnetotacticum, Gene 171 (1996)
99-102.
[9] D. Schüler, E. Baeuerlein, The biomineralization of
magnetite in magnetic bacteria, in: A. Trautwein (Ed.),
Bioinorganic Chemistry: Transition Metals in Biology and
Coordination Chemistry / Deutsche
Forschungsgemeinschaft, Wiley-VCH, Weinheim, New
York, Chichester, Brisbane, Singapore, Toronto, 1997a,
pp. 24-36.
[10] A. Boyum, Isolation of leucocytes from human blood,
Further observations, Methylcellulose, dextran and ficoll
as erythrocyteaggregating agents, Scand. J. Clin. Lab.
Invest. 97 (1968) 31-50.
[11] M. Bukovský, D. Mlynarčík, H. Koščová, Change of
immunomodulating properties of Escherichia coli caused
by artificial resistance to amine oxides (in Slovak), Farm.
Obzor. 57 (1998) 59-68.
[12] M. Schwalbea, C. Jorkea, N. Buskeb, K. Hoffkena, K.
Pachmanna, J.H. Clementa, Selective reduction of the
interaction of magnetic nanoparticles with leukocytes and
tumor cells by human plasma, JMMM 293 (2005)
433-437.
[13] M.A. Soler, S.N. Báo, G.B. Alcântara, V.H. Tibúrcio, G.R.
Paludo, J.F. Santana, et al., Interaction of erythrocytes
with magnetic nanoparticles, J. Nanosci. Nanotechnol. 7
(2007) 1069-1071.
[14] P.A. Revell, The biological effects of nanoparticles,
Nanotechnology Perceptions 2 (2006) 283-298.
[15] R. Satishkumar, A. Vertegel, Conjugation to nanoparticles
can increase antimicrobial activity of lysozyme,
Biotechnol. Bioeng. 100 (2008) 403-412.
Aug. 2010, Volume 4, No.5 (Serial No.30)
Journal of Life Sciences, ISSN 1934-7391, USA

The Hepatoprotective Effects of Solanum Incanum on

Acetaminophen-Induced Hepatotoxicity in Guinea Pigs

Yahya Saleh Al-Awthan1, Mohammed A. Salama2 and Ahmed M. Helal3

1. Department of Biology, Faculty of Science, Ibb University, Ibb 70270, Yemen
2. Department of Zoology, Faculty of Science, Al-Azhar University, Cairo1150049, Egypt
3. Department of Zoology, Faculty of Science, Al-Zaqaziq University, Banha 44519, Egypt

Received: April 26, 2010 / Accepted: June 30, 2010 / Published: August 30, 2010.

Abstract: Solanum incanum, a shrubby herb, is widely distributed and used as analgesic, antitoxic, and antispasmodic in folk medicine.
In the present study, the protective effects of aqueous extract of S. incanum against acetaminophen induced acute liver damage were
evaluated in guinea pigs. Animals were orally administered with S. incanum extract (50 and 100 mg / kg bw) and silymarin (100 mg / kg
bw) respectively for 6 days followed by acetaminophen administration (2 g / kg bw) at the 7th day. The results showed that the
treatment with S. incanum extract significantly lowered the acetaminophen-induced serum levels of hepatic marker enzymes (AST,
ALT, and ALP). Liver histopathology also showed that S. incanum extract reduced the incidence of liver lesions including the swelling
of hepatic cells, lymphocytes infiltration, nucleus condensation, and hepatic necrosis induced by acetaminophen treatment in guinea
pigs. The S. incanum extract at a dose of 100 mg / kg bw was more effective in suppressing the oxidative damage than the extract at a
dose of 50 mg / kg bw. Therefore, the results of this study suggest that S. incanum extract could protect liver against the
acetaminophen-induced oxidative damage.

Key words: Solanum incanum extract, acetaminophen, hepatoprotection, guinea pigs.

1. Introduction genus Solanum are known to exhibit strong antioxidant

properties, in addition, it has been reported to have
In the recent years, there has been a global trend
potential antitumor activities [6]. Recent studies
toward the use of natural substances present in fruits,
reported that the extract of Solanum plants showed
vegetables, oilseeds, and herbs as antioxidants and
hepatoprotective effects and effective free radical
functional foods [1, 2]. Several of these substances are
scavenging activities [7-9]. Previous investigations
believed to have potential value as therapeutic agents
showed that the plant extract have a protective effect
within the human body. For example, some vitamins
against CCl4 - induced hepatic injury [10]. However,
and their derivatives have important biological roles
the mechanism of this hepatoprotective effect is still
related to cancer prevention and free radical
unknown, and there is little information available
scavenging [3]. Solanum incanum (SI) (Family:
concerning the possible hepatoprotective effects of SI
Solanaceae), a shrubby herb, is widely distributed and
on other hepatotoxicants. Acetaminophen (paracetamol)
used to treat thoracic, ear, and teeth pain, snake and
is one of the most widely used analgesic in most
scorpion bites, syphilis, skin and fungus diseases, and
countries of the world, and overdose can induce severe
inflammation of animal reproductive system in Yemeni
hepatotoxicity in experimental animals and humans [11,
folk medicine [4, 5]. Several plants belonging to the
12]. Liver damage is always associated with cellular
Corresponding author: Yahya Saleh Al-Awthan, Ph.D., necrosis, increase in tissue lipid peroxidation and
assistant professor, research field: animal physiology. E-mail: depletion in the tissue GSH levels. In addition, serum
yahea55@yahoo.com.
 The Hepatoprotective Effects of Solanum Incanum on Acetaminophen-Induced Hepatotoxicity in Guinea
Pigs
levels of many biochemical markers like SGOT, SGPT,
triglycerides, cholesterol, bilirubin, alkaline
phosphatase, are elevated [13].
The present study was planned to study the changes
in some physiological activities and hsitopathological
alterations which might occur as a result of
acetaminophen intoxication in experimental animals.
In addition, to study the hepatoprotective effects of the
aqueous extract of SI against acetaminophen-induced
acute liver injury in guinea pigs, the protection activity
of the plant extract was compared with silymarin,
which has been used for over 20 years in clinical
practice for the treatment of toxic liver disease [14].
Also, it has been described to be an antioxidant and
exhibits anti-inflammatory, anti-carcinogenic,
growth-modulatory and hepatoprotection effects [15].
2. Materials and Methods
2.1 Plant Material
The whole plant of SI was collected during the
period of February to March 2008 from Ibb, Yemen.
The plant was authenticated by comparison with
reference specimens preserved at the Herbarium of
Biology Department, Ibb University, Yemen. Voucher
specimens were kept in the Herbarium for future
references.
2.2 Preparation of the Aqueous Extracts
The plants were washed, cut into small pieces, shade
dried for 5 days, and then dried overnight in an oven.
The dried plants (200 g) were boiled for 30 min with
distilled water (2,000 mL). The resulting water extract
was filtered and subsequently concentrated with a
water bath (90 ℃) until it became creamy, and then
dried in an oven (60 ℃), finally gave 30 g (15% of
initial amount) of powder. The dried extracts were
dissolved in saline and administrated orally when
experiments were performed.
2.3 Animals and Treatments
Adult male guinea pigs (350 ± 50 g) were obtained
45
from the animal house of Biology Department, Ibb
University, Yemen and kept for 1 week on a
commercial diet in environmentally controlled
conditions (25 ± 5 ℃, 55 ± 5% humidity and 12 h
light-dark cycle) with free access to diet and water ad
libitum. Animals were divided into five groups of five
each. Animals of group I received oral administration
of 5 mL/kg of the normal saline daily and served as
controls. The animals of group II received normal
saline for 6 days in succession followed by single oral
administration of paracetamol (2 g/kg p.o.). The
animals of group III & IV were given the pretreatment
of aqueous extracts of SI (50 and 100 mg / kg p.o.)
dissolved in normal saline once daily for 6 days in
succession followed by single administration of
paracetamol 2 g/kg p.o., 1 h after aqueous extract
administration. The animals of group V were given the
pretreatment of silymarin (100 mg/kg p.o.) suspended
in normal saline once daily for 6 days followed by
single administration of paracetamol 2 g/kg p.o., 1 h
after silymarin administration. 24 hs after the toxin
administration, the animals of each group were
anaesthetized with ether and blood was collected
directly from the portal vein. The blood sample of each
animal was divided in two tubes, one of them mixed
with heparin to prevent coagulation and the other was
allowed to clot at room temperature for 1 h, and then
centrifuged at 3,000 rpm and 4 ℃ for 15 min to obtain
sera. The separated serum was sampled into clean tubes
and kept in a deep-freezer at －24 ℃ for further
analysis.
2.4 Determination of AST, ALT and ALP Activity
Serum aspartate aminotransferase (AST) and Serum
alanine aminotransferase (ALT) were determined
using Medichem Middle East Diagnostics kits (Syria)
according to the method of Tietz [16]. The activity of
serum alkaline phosphatase (ALP) was determined
using Reactivos GPL Diagnostics kits (Spain)
according to the method of King [17].The enzyme
activity was expressed as U/L.
46 The Hepatoprotective Effects of Solanum Incanum on Acetaminophen-Induced Hepatotoxicity in Guinea
Pigs

Table 1 Effect of aqueous extract of SI extract on serum AST, ALT and ALP levels in guinea pig intoxicated with
acetaminophen.
Groups AST (U/L) ALT (U/L) ALP (U/L)
Control 38.80 ± 8.23 83.00 ± 13.17 58.20 ± 9.41
a a
Acetaminophen (2 g/kg) 85.40 ± 5.59 176.40 ± 2.12 168.80 ± 17.97 a
b
Acetaminophen + 50 mg/kg SI 71.00 ± 8.22 140.80 ± 14.13 117.60 ± 16.07 b
Acetaminophen + 100 mg/kg SI 56.00 ± 7.41 c 120.20 ± 14.23 c 89.00 ± 15.57 c
c c
Acetaminophen + 100 mg/kg silymarin 38.80 ± 9.98 109.80 ± 17.46 75.80 ± 16.84 c
a
Values represent mean ± SD of five animals in each group. P < 0.05 vs. control. b P < 0.05 vs. acetaminophen. c P < 0.001 vs.
acetaminophen.

2.5 Hsitopathological Examination of aqueous extracts of SI extract exhibited a significant

Control and experimental animals were put under
light ether anaesthesis, dissected as quickly as possible,
and then livers were removed. Small pieces were fixed
in 10% neutral formalin for 24 hours, then washed by
the running tap water, and stored in 70% ethyl alcohol,
until further processing. Blocks of about 5 × 5 mm size
were dehydrated, cleared and embedded in paraffin
wax. Paraffin sections of 5 µm thickness were cut using
rotary microtome (Leica, Germany) and sections were
flattened on the surface of warm water using a water
bath. Slides were then dried on a hot plate for 30
minutes and stored in the incubator at 37 ℃ and stained
with Ehrlich’s haematoxylin and counter-stained with
eosin. Then mounted in Canada balsam, labeled and
became ready for microscopic examination.
2.6 Statistical Analysis
Results of the biochemical estimations are reported
as mean ± S.D. Total variation, present in a set of data
was estimated by one-way analysis of variance
(ANOVA). Differences with a P-value of <0.05 were
considered as statistically significant.
3. Results
3.1 Results of Liver Enzymes (AST, ALT and ALP)
The results of the present study show that the serum
levels of AST, ALT and ALP were significantly
elevated (P < 0.05) in the acetaminophen-treated
guinea pigs when compared with the control group.
Pretreatment of guinea pigs with 50 and 100 mg/kg p.o.
(P < 0.05) reduction in the paracetamol-induced
increase in the levels of AST activity as compared with
those of acetaminophen treatment group. Silymarin
(100 mg / kg body weight) also lowered significantly
the serum enzyme activity and showed a similar effect
as that observed with the high dose SI extract (Table 1).
3.2 Results of Liver Morphological Changes
Examination of liver sections obtained from guinea
pigs treated with acetaminophen showed many
pathological alterations where marked leukocytic
infiltration, and vacuolation were observed. The
hepatic cells were found to be swelling with marked
region of necrosis; cytoplasmic vacuolization and
nucleus condensation were observed in central zone
and mid-zone. The protective effect of SI extract was
dose-dependent and 50 and 100 mg / kg p.o. of aqueous
extracts of SI extract produced 40 and 60% inhibition
in inflammatory changes against 80% inhibition
observed in silymarin treated group (Fig. 1).
4. Discussion
A number of previous studies suggest that the
extracts or isolated compounds obtained from SI show
a broad spectrum of biological activity, including
anticancer, antifungal, bactericidal, antinociceptive,
anti-inflammatory, antispasmodic, vasorelaxant and
hypoglycemic effects, which are mostly due to
alkaloids and / or flavonoids [18-20]. Furthermore,
ethnopharmacological studies with plants of the genus
Solanum have shown hepatoprotective effects in
 The Hepatoprotective Effects of Solanum Incanum on Acetaminophen-Induced Hepatotoxicity in Guinea 47
Pigs

a b c

d e

Fig. 1 Hepatoprotective effect of SI against acetaminophen-induced hepatotoxicity in guinea pigs. Liver sections were stained
with H &E: (a) normal; (b) acetaminophen (2 g/kg body wt) treated animals; (c) SE (50 mg / kg body wt) + acetaminophen; (d)
SE (100 mg / kg body wt) + acetaminophen; (e) Silymarin (100 mg / kg body wt) + acetaminophen, magnification 400 X. (H)
hepatocytes, (CV) central vein, (N) nucleus, (S) sinusodial space, (BH) ballooning hepatocytes.

toxicants induced liver damage [7-9]. The results of
this study demonstrate that SI treatment can decrease
acetaminophen-induced liver injuries in guinea pigs.
The hepatoprotective effect was shown by decreases in
the activities of AST, ALT and ALP, as well as
hsitopathological observations in liver tissue.
Acetaminophen is a common analgesic agent, which is
safe in therapeutic doses but can produce fatal hepatic
necrosis in man, rats and mice with toxic doses [21, 22].
Protection against acetaminophen -induced toxicity has
been used as a test for potential hepatoprotective
activity by several investigators [23, 24]. An obvious
sign of hepatic injury is leakage of cellular enzyme into
plasma [25]. When the liver cell plasma membrane is
damaged, a variety of enzymes normally located in the
cytosol are released into blood stream. Their estimation
in the serum is a useful quantitative marker for the
extent and type of hepatocellular damage [26]. The
aqueous extract of SI used in this study preserved the
structural integrity of the hepatocellular membrane in a
dose dependent manner as evident from the protection
provided as compared to the enzyme level in the
hepatotoxin treated guinea pigs.
SI treatment also decreased the hsitopathological of
liver induced by acetaminophen administration in vivo.
These findings suggest that SI can interact directly with
acetaminophen metabolites or induce a protective
event to reduce the hepatotoxicity of acetaminophen.
The probable mechanism by which SI exerts its
protective action against acetaminophen-induced
hepatocellular metabolic alterations could be by the
stimulation of hepatic regeneration through accelerated
detoxification and excretion. The SI contains an
alkaloid solamargine [18], flavonoids and chlorogenic
acids [27]. One or more of these compounds have
potential hapatoprotective activity.
5. Conclusion
SI extract protected liver against injury induced by
acetaminophen in guinea pigs. Therefore there is a
possibility that the plant extract may possess
antioxidant property, which may be involved in the
48 The Hepatoprotective Effects of Solanum Incanum on Acetaminophen-Induced Hepatotoxicity in Guinea
Pigs
hepatoprotective property. In addition, it is necessary
to carry out further studies to rule out if treatment with
Solanum extract is able to inhibit oxidation of
acetaminophen.
Acknowledgments
The authors would like to thank Ibb University for a
grant that enabled us to do this work.
References
[1] D.R. Farr, Functional foods, Cancer Letters 114 (1997)
59-63.
[2] H. Wang, G. Cao, R.L. Prior, Oxygen radical absorbing
capacity of anthrocyanins, J. Agri. Food Chem. 45 (1997)
304-309.
[3] G. van Poppel, H. van den Berg, Vitamins and cancer,
Cancer Letters 114 (1997) 195-202.
[4] A.S. Badib, The Medicinal Plants of Yemen, Alirshad
Library, Sana’a, 1993, pp. 150-151. (in Arabic)
[5] A.S. Al-Dubai, A.A. Al-Khulaidi, Medical and Aromatic
Plants of Yemen, Obadi Center for Studies and Publishing,
Sana’a, Yemen, 1996. (in Arabic)
[6] P. Vijayan, V. Preethi, S.H. Prashanth, H. Raghu
Chandrashekhar, G. Ashok, B. Shrishailappa, Cytotoxic
activity of the total alkaloids isolated from different parts
of Solanum pseudocapsicum, Biol. Pharm. Bull. 27 (2004)
528-530.
[7] K.H. Han, N. Hashimoto, K. Shimada, M. Sekikawa, T.
Noda, H. Yamauchi, et al., Hepatoprotective effects of
purple potato extract against D-galactosamine-induced
liver injury in rats, Biosci. Biotechnol. Biochem. 70 (6)
(2006) 1432-1437.
[8] S.O. Salawu, A.A. Akindahunsi, Protective effect of some
tropical vegetables against CCl4-induced hepatic damage,
J. Med. Food (2) (2007) 350-355.
[9] H.M. Lin, H.C. Tseng, C.J. Wang, J.J. Lin, C.W. Lo, F.P.
Chou, Hepatoprotective effects of Solanum nigrum Linn
extract against CCl4-induced oxidative damage in rats,
Chem. Biol. Interact. 171 (3) (2008) 283-293.
[10] H.F. Chiu, C.C. Lin, C.C. Yang, F. Yang, The
pharmacological and pathological studies on several
hepatic protective crude drugs from Taiwan (II), Am. J.
Chin. Med. 17 (1-2) (1989) 17-23.
[11] S.H.L. Thomas, Paracetamol (acetaminophen) poisoning,
Pharmacol. Ther. 60 (1993) 91-120.
[12] O. Mirochnitchenko, M. Weisbrot-Lefkowitz, K. Reuhl, L.
Chen, C. Yang, M. Inouye, Acetaminophen toxicity:
opposite effects of two forms of glutathione peroxidase, J.
Biol. Chem. 274 (1999) 10349-10355.
[13] N. Mascolo, R. Sharma, S.C. Jain, F. Capasso,
Ethnopharmacology of Calotropis procera flowers, J.
Ethnopharmacol. 22 (1998) 211-221.
[14] M. Messner, P. Brissot, Traditional management of liver
disorders, Drugs 40 (1990) 45-57.
[15] K. Flora, M. Hahn, H. Rosen, K. Benner, Milk thistle
(Silybum Marianum) for the therapy of liver disease, Am. J.
Gastroenterol. 93 (1998) 139-143.
[16] N.W. Tietz, Fundamental of Clinical Chemistry, W.B.
Saunders Co., 1982, p. 674.
[17] J. King, The hydrolases-acid and alkaline phosphatases, in:
Practical Clinical Enzymology, Nostrand Company
Limited, London, 1965, pp. 191-208.
[18] K.W. Kuo, S.H. Hsu, Y.P. Li, W.L. Lin, L.F. Liu, L.C.
Chang, et al., Anticancer activity evaluation of the
solanum glycoalkaloid solamargine, triggering apoptosis
in human hepatoma cells, Biochem. Pharmacol. 60 (12)
(2000) 1865-1873.
[19] C.T. Musabayane, P.T. Bwititi, J.A. Ojewole, Effects of
oral administration of some herbal extracts on food
consumption and blood glucose levels in normal and
streptozotocin-treated diabetic rats, Methods Find Exp.
Clin. Pharmacol. 28 (4) (2006) 223-228.
[20] M. Al-Fatimi, M. Wurster, G. Schröder, U. Lindequist,
Antioxidant, antimicrobial and cytotoxic activities of
selected medicinal plants from Yemen, J. Ethnopharmacol.
111 (3) (2007) 657-666.
[21] S. Kuma, D. Rex, Failure of physicians to recognize
acetaminophen hepatotoxicity in chronic alcoholics, Arch.
Int. Med. 151 (1991) 1189-1191.
[22] L. Eriksson, U. Broome, M. Kahn, M. Lindholm,
Hepatotoxicity due to repeated intake of low doses of
paracetamol, J. Int. Med. 231 (1992) 567-570.
[23] A. Singh, S.S. Handa, Hepatoprotective activity of Apium
graveolens and Hydrophila auriculata against
paracetamol and thioacetamide intoxication in rats, J.
Ethnopharmacol. 49 (1995) 119-126.
[24] M.B. Ahmed, M.R. Khater, Evaluation of the protective
potential of Ambrosia maritima extract on
acetaminophen-induced liver damage, J. Ethnopharmacol.
75 (2001) 169-174.
[25] E. Schmidt, F.W. Schmidt, J. Mohr, P. Otto, I. Vido, K.
Wrogeman, et al., Liver morphology and enzyme release,
Further studies in the isolated perfused rat liver, in: D.
Keppler (Ed.), Pathogenesis and Mechanism of Liver Cell
Necrosis, Medical and Technical Publishing Co. Ltd.,
Lancaster, 1975, p. 147.
[26] R.A. Ansari, S.C. Tripathi, G.K. Patnaik, B.N. Dhawan,
Antihepatotoxic properties of picroliv, an active fraction
from rhizomes of Picrorhiza kurroa, J. Ethnopharmacol.
34 (1991) 61-68.
[27] Y.L. Lin, W.L. Wang, Y.H. Kuo, C.F. Chen, Nonsteroidal
constituents from Solanum incanum L., J. Chinese Chem.
Soci. 74 (2000) 247-251.
Aug. 2010, Volume 4, No.5 (Serial No.30)
Journal of Life Sciences, ISSN 1934-7391, USA

Prolonged Production of L-DOPA Using Immobilized

Aspergillus Terreus

Sankar Lal Poddar1 and Sharmila Chattopadhyay2

1. Department of Clinical and Experimental Pharmacology, School of Tropical Medicine, Kolkata 700 073, India
2. Indian Institute of Chemical Biology, 4, Kolkata 700 032, India

Received: October 1, 2009 / Accepted: January 21, 2010 / Published: August 30, 2010.

Abstract: The objective of this study is to improve the production of L-DOPA from fungal source like Aspergillus terreus that can be
further used to large-scale commercial production of this important drug from microbial sources. L-DOPA, a dopamine precursor that
can pass the blood-brain barrier, is presently the drug of choice for Parkinson’s disease. Microbial production and isolation of L-DOPA
from natural sources is yet to be achieved an economical process. In this study, the mycelial pellets of Aspergillus terreus 104 were
entrapped in 2% calcium alginate and were studied for their capacity for L-3, 4-dihydroxyphenylalanine production. Results showed
that the immobilized pellets produced L-DOPA to the extent of 0.74 mg·G-1 biomass while the free pellets produced 0.8 mg·G-1
biomass. Further, storage of immobilized pellets for 96 h at 4 ℃ resulted in the reduction of the original L-DOPA producing activity of
the gel beads only 40% and that of free pellets lost completely. In order to improve the production yield, further experiments were
designed. It was found that L-DOPA production could be prolonged with repeated batch wise use of immobilized mycelial pellets in
calcium alginate retaining 80% of their L-DOPA producing capacity for a period of 72 h while free pellets lost completely within 24 h.
Results of this kind therefore is interesting and promising for commercial scale production of L-DOPA from microbial sources.

Key words: L-DOPA, tyrosinase, Aspergillus terreus 104, immobilized pellets, 96 h storage.

1. Introduction efficient and economical production of the drug is

urgently required. The isolation of L-DOPA from
The London physician Dr. James Parkinson first
natural sources and its production by chemical
described the symptoms and features of the disease,
synthesis and by plant cell and tissue culture have long
which was to be named after him in his 1817 “Essay on
been reported but an economical process is yet to be
the shaking palsy”. The disease is triggered by a loss of
achieved [2]. Although microbial synthesis of
the dopamine and noradrenaline producing brain cells
L-DOPA was first detected from fungal sources in
located in the substantial nigra and locus cereleus areas
1969, most of the current supply of L-DOPA is
of the brain. Dopamine cannot be given directly to
produced chemically [3]. The recent investigations
patients because it cannot pass the blood-brain barrier;
have also been centered upon both fungal and bacterial
therefore, Parkinson’s disease is treated with pills of
production of L-DOPA [4, 5]. However, the
L-DOPA, a dopamine precursor that can pass the
microbiological production of L-DOPA could be
blood-brain barrier. L-DOPA has been the preferred
expensive due to the removal of proteins and hormones.
drug for treatment of Parkinson’s disease since 1967
Another alternative method is production of L-DOPA
[1]. To meet the market demands of L-DOPA as a
from L-tyrosine with immobilized tyrosinase [6-8]. As
miracle drug for the treatment of Parkinson’s disease,
tyrosinase is an expensive enzyme, therefore, suitable
alternative for commercial production is in search.
Corresponding author: Sharmila Chattopadhyay, Ph.D.,
research field: life science. E-mail: chattopadhyay62@gmail. Immobilized biocatalysts such as enzymes,
com.
50 Prolonged Production of L-DOPA Using Immobilized Aspergillus Terreus
microorganisms, plant and animal cells have added
new dimensions to the application potential of the
rapidly advancing frontier of biotechnology. Amongst
these the application of immobilized whole cells
represents an attractive alternative in view of the
numerous advantages they can offer [9, 10].
However, reports on the production of L-DOPA
from a fungal source in an immobilized state are not
common. Aspergillus spp. can produce L-DOPA from
L-tyrosine by one step oxidation reaction catalyzed by
tyrosinase or tyrosine hydroxylase [11]. The aim of this
paper was to investigate the ability of long-term
efficient production of L-DOPA by A. terreus 104
strain immobilized in calcium alginate gel beads.
2. Experiment
2.1 Microorganism and Culture Conditions
A high L-DOPA producing strain of Aspergillus
terreus 104 previously selected from fungal isolates
derived from soil source (Chattopadhyay and Das,
1990) was used in the present investigation. It was
grown in 250 mL Erlenmeyer flasks, each with 40 mL
medium containing (g·L-1): malt extract 0.05, yeast
extract 0.025, glucose 0.1 (pH 6.5). Each flask was
inoculated with spores (107 - 108 spores·mL-1) and
placed on rotatory shaker (150 rpm) at 28 ± 1 ℃ for 72
h of cultivation.
2.2 Immobilization
Following incubation pellets were harvested and
washed with physiological saline. 350 mg mycelial
pellets (=100 mg DW) were suspended in sterile 20 mL
of 2% (w / v) sodium alginate solution. The alginate
cell mixture was then placed in a separating funnel and
added drop wise to a stirred 3% (w / v) CaCl2 solution
at 8 ℃ [12]. After 1 h the beads (3 - 4 mm diameter)
were collected, washed with ice-cold water and used
for L-DOPA production.
2.3 Analytical Method
Tyrosinase activity of free and immobilized cells
was analyzed by determining the amount of L-DOPA
produced from L-tyrosine in the reaction mixture
containing 5 mL L-tyrosine, 10 mg L-ascorbic acid and
100 mg mycelial pellets (DW) or 3 g of gel beads
(WW). Following incubation under mild shaking at
45 ℃ for 60 min the reaction was stopped by adding
0.05 ml of 2 M HCl and the L-DOPA formed was
estimated by Arnow’s method as described before [11].
In brief, the L-DOPA content in 1.0 mL of the reaction
mixture was determined in the following manner: each
sample contained, in order, 1.0 mL of 2 M HCl, 1.0 mL
of 2 M NaOH and 1.0 mL of solution containing 10%
sodium molybdate and 10% sodium nitrite mixed in
equal proportion. The HCl inactivated residual free
tyrosinase stopping the formation of L-DOPA. Sodium
hydroxide was added to prevent bubbling and stabilize
the sample. Sodium nitrite reacts with L-DOPA to
yield nitrous acid (a yellow solution), which may be
detected spectrophotometrically. Sodium molybdate
was added to prevent decomposition of the sample. The
absorbency was read at 540 nm preciously just one
hour after the addition of sodium molybdate because
the formation of the colored L-DOPA complex is time
dependent.
2.4 Batch Productions
30 g beads were suspended in 50 mL conversion
medium containing 50 mL acetate buffer (0.2 M, pH
3.5), 50 mg L-tyrosine, 100 mg L-ascorbic acid in 250
mL Erlenmeyer flask. The fermentation was carried out
at 45 ℃ under agitation (150 rpm) and at every 12 h
interval the fermented broth was collected and
analyzed for L-DOPA activity. Biocatalyst beads were
washed with 20 mL physiological saline and replaced
in fresh 50 mL conversion medium for the second cycle
of batch production.
2.5 Chemicals
L-DOPA, L-ascorbic and L-tyrosine were purchased
from Sigma, USA. Malt extract, yeast extract and agar
were procured from HIMEDIA, India. All other
 Prolonged Production of L-DOPA Using Immobilized Aspergillus Terreus
chemicals were of analytical grade.
3. Results and Discussion
3.1 L-DOPA Production by Free and Immobilized
Pellets
Two series of experiments were designed for the
production of L-DOPA from L-tyrosine as a substrate
using Aspergillus terreus 104 biocatalyst beads. In the
first one, the 72 h grown mycelial pellet embedded in
2% sodium alginate as well as free mycelial pellets
were stored at 4 ℃ to study the stability of tyrosinase
activity. Samples were taken out at 24 h intervals and
tested for L-DOPA production capacity. For each test 3
g gel beads or 350 mg (WW) of mycelial pellets were
suspended in 5 mL of conversion medium and
L-DOPA produced therein was determined. Control
experiments of both free and immobilized pellets were
also set up similarly by taking samples just before
storage at 4 ℃. L-DOPA concentrations of the samples
were determined as percent conversion as well. Results
showed that the highest yield of L-DOPA with free
pellets system at 0.8 mg·G-1 biomass whereas that of
immobilized pellets system 0.74 mg·G-1 biomass. In
percent conversion 0.5% was noted with immobilized
pellets after 96 h of storage at 4 ℃ in comparison to
that of free pellets of 0.0% (Fig. 1).
0.9
0.8
L-DOPA concentration mg/g
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
0 24 48
period of storage (hours)
Fig. 1 L-DOPA production in free ( - ) and immobilized
(♦-♦) mycelial pellets of A. terreus 104 after storage at 4 ℃.
51
3.2 Repeated Batch Production
In the second series of experiments, repeated batch
wise use of entrapped pellets was performed for the
production of L-DOPA from L-tyrosine. 30 g of
immobilized beads were added in 50 mL of conversion
medium in 250 mL flask. These cultures were shaken
in a water bath at 45 ℃ and the medium was changed
(after rinsing the beads with 20 mL physiological saline)
and analyzed in every 12 h. For comparison, in a
parallel series of experiments, repeated batch
productions experiments were performed with free
mycelial pellets in a similar way. 72 h old mycelial
pellets were collected by centrifugation and washed
with equal volume of physiological saline. The pellets
(3.5 g) were suspended in 50 mL conversion medium.
The medium was changed and analyzed in every 12 h
for their L-DOPA producing capacity. It was observed
that the free mycelial pellets of A. terreus 104 strain
lost their L-DOPA producing capacity by the second
cycle (1.0 days) while the embedded cells retained
about 80% of their L-DOPA producing capacity over
six cycles (3 days) as represented in Fig. 2. For the
calculation of the relative activities, the L-DOPA
concentration in the first cycle was taken as 100%.
These immobilized cells could be kept at a minimum
growing state preserving the metabolically active state
of A. terreus 104 cells within the gel matrix by
supplying the suitable nutrients periodically and thus
enabling the cells to retain their enzymatic activities for
L-DOPA production for a long time.
Previous studies reported the immobilization of
tyrosinase on various sources like glass bead [13],
eggshell powder coated with PEI [8], synthetic polymer,
natural polymer, nylon etc. in order to produce to
L-DOPA. However, enzyme is an expensive source as
substrate. Moreover, partial conversion of unreacted
L-tyrosine is a drawback of this process. Use of the
72 96 microbial cells has also been reported which can be
sensitive to the precursor and to the fermentation
conditions [11]. Therefore, the stabilization of the cells,
which act as source of enzyme, is essential. In this study
52 Prolonged Production of L-DOPA Using Immobilized Aspergillus Terreus
100
relative activity (%)
50
0
0 1
ferm entation cycle num ber
Fig. 2 Progress curve of the repeated batch production of L-DOPA. Free ( - ) and immobilized (♦-♦) mycelial pellets of A.
terreus 104.
the authors have developed effective method to
produce L-DOPA from L-tyrosine using fungal cell as
an efficient source of tyrosinase. This is of particular
importance because immediate oxidation of L-DOPA
to dopaquinone and subsequent non-enzymatic
polymerization of the quinones to dark colored melanin
is limited by the entrapment of fungal cells. Further
more, results of this investigation clearly showed that
the free pellets lost their L-DOPA producing capacity
within 96 hours of storage whereas immobilized pellets
retain 60% of their capacity under the same period
which may be due to the minimization of oxidation of
L-DOPA to dopaquinone.
4. Conclusions
The present results have demonstrated that the
mycelial pellets of A. terreus 104 can be successfully
immobilized in calcium alginate for long time
production to obtain appreciable yield of L-DOPA.
Furthermore, the entrapment can protect the cell from
the harmful environment as well as keep them viable
for a long time to obtain enhanced production of
L-DOPA. Future investigation is underway for pilot
scale production of L-DOPA using immobilized fungal
mass.
Acknowledgment
The authors are grateful to the Director, School of
Tropical Medicine, Kolkata, India for his support.
2 3 4 5 6
References
[1] S. Ates, E. Cortenlioglu, E. Bayraktar, U. Mehmetoglu,
Production of L-DOPA using Cu-alginate gel immobilized
tyrosinase in a batch and packed bed reactor, Enz.
Microbial. Technol. 40 (4) (2007) 683-687.
[2] S. Chattopadhyay, S.K. Datta, S.B. Mahato, Production of
L-DOPA from cell suspension culture of Mucuna pruriens
f. pruriens, Plant Cell Rep. 13 (1994) 519-522.
[3] W.S. Knowles, Asymetric hydrogenations, Adanc.
Synthetic. Catalyst. 345 (2003) 3-13.
[4] A. Sikander, Ikram-ul-Haq, M.A. Qadeer, Novel
technique for microbial production of L-3, 4-dihydroxy
Phenyl L-alanine by a mutant strain of Aspergillus oryzae,
Electron. J. Biotechnol. 5 (2002) 118-124.
[5] T. Kyanagi, T. Katayama, H. Suzuli, Effective production
of 3,4-dihydroxyphenyl-l-alanine (L-DOPA) with Erwinia
herbicola cells carrying a mutant transcriptional regulator
TyrR., J. Biotechnol. 115 (2005) 303-306.
[6] G.M. Carvalho, T.L. Alves, D.M. Freire, L-DOPA
production by immobilized tyrosinase, Applied. Biochem.
Biotechnol. 84 (2000) 791-800.
[7] G. Seetharam, B.A. Saville, L-DOPA production from
tyrosinase immobilized on zeolite, Enz. Microbial.
Technol. 31 (2002) 747-753.
[8] D. Norouzian, A. Akbarzadeh, M. Mirdamadi, S. Khetami,
A. Farhanghi, Immobilization of mushroom tyrosinase by
different methods in order to transform L-tyrosinase to
L-3,4 Dihydroxyphenylalanine (L-DOPA), Biotechnol. 6
(2007) 436-439.
[9] C. Hemachander, N. Box, R. Puvanakrishnan, Whole cell
immobilization of Ralstonia pickettii for lipase production,
Process Biochem. 36 (2001) 629-633.
[10] K. Ban, S. Hama, K. Nishizuka, M. Kaieda, T. Matsomoto,
A. Kondo, Repeated use of whole cell biocatalysts
immobilized within biomass support particle for biodiesel
fuel production, J. Molecul. Catal. B: Enz. 17 (2002)
157-165.
[11] S. Chattopadhyay, A. Das, Production of L-DOPA by
Aspergillus terreus, FEMS Microbiol. Lett. 72 (1990)
195-199.
[12] H.L. Holland, S.L. Poddar, B. Tripet, Effect of cell
immobilization and organic solvents on sulfoxidation and
steroid hydroxylation by Mortierella isabellina, J. Indust.
Microbiol. 10 (1992) 195-197.
[13] J.C. Warrington, B.A. Saville, Tyrosinase inactivation in
organic solvent, Biotechnol. Bioengineer. 65 (1999)
325-333.
Aug. 2010, Volume 4, No.5 (Serial No.30)
Journal of Life Sciences, ISSN 1934-7391, USA

Medicinal Solid Fermentation Engineering of Chinese

Traditional Medicinal Fungal

Yi Zhuang

Received: August 27, 2009 / Accepted: October 9, 2009 / Published: August 30, 2010.

Abstract: Medicinal solid fermentation technology of fungal was unique within the traditional Chinese medicine (TCM) and one of the
oldest bio-pharmaceutical technology in the history, for example, the production of medicated leaven named “Shenqu”, the history of
which had continued for more than 1,500 years. These kinds of productions were widly used and had a close relationship with TCM.
The development of this technology had through stages of “yeast production”, “solid culture”, “solid fermentation”, and nowadays
toward a series engineering of solid fermentation with promising prospects. The author described the development of its history briefly,
and the representative products and the characteristics of production process of every stage, respectively. This research focused on
taking “Trametes robinioplila fermented substance”, “T. robinioplila & A. membranaceus fermented substance” and “T. wilfordii
Hook.f. & G. lucidum fermented substance” as examples to introduce R & D ideas and important findings of “common fermentation”
and “bi-directional fermentation” which were recommended as studying hotspots. There were many unique and important functions in
the fields of TCM about all kinds of “fermentation substances”. It is infered that there may exist some other innovate technologies such
as “Multi-fungal fermentation”, “Special elements fermentation”, etc. which are remained to be researched and developed continuely.
All kinds of “fermentation substances” are looked forward to show unique and important roles in the fields of TCM.

Key words: Solid fermentation, fungal medicine, yeast production, solid culture, common fermentation, bi-directional fermentation.

1. Introduction characteristics and tastes, function position, curative

effects, etc. The herbalists would make different
Traditional Chinese Medicine (TCM) is an
prescriptions with different combinations of TCM
important part of the 5,000 years of Chinese
materials and doses for different patients and diseases,
civilization, especially the fungus medicine. They have
the prescriptions are often decocted to TCM soup, and
many traditional characteristics, for example, firstly,
some are made to pellet, powder, paste, cinnabar, etc.
medicine materials are from nature. So far, the
for clinical medical treatment.
material species have reached a total of 12,807 which
include 11,146 plant medicines, 1,581 animal 2. The Relationships Between Fungi and
medicines and 80 mineral medicines [1]. Generally TCM
speaking, fungi medicines belong to plant medicines.
There are little fungi TCMs - only about 50 kinds
Secondly, the descriptions about TCM include
(the kinds which havn’t been successfully developed
yet or formally approved for medicine but are
Corresponding author: Yi Zhuang, researcher, Consultant
of Medicinal Fungi Professional Group, Chinese considered to possess certain medicinal values, and the
Pharmaceutical Association and Professional Committee of
Medicinal Fungi, Mycological Society of China; Visiting
mushroom which are rich in nutrient with certain health
Professor of Jiangxi University of Traditional Chinese functions are not included.), because of its microscopic
Medicine and Tianjin University of Traditional Chinese
Medicine; Former Head of Institute of Medicinal Fungi and
characteristics and polymorphism subjectively, and
Chinese Medicine Biotechnology, Nanjing University of low level of life sciences’ technological development
Chinese Medicine, research fields: mycological medicines,
antifungal medicine research. E-mail: njzhuangyi_2008
objectively [2]. The relationships between fungi TCMs
@163.com.
54 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicinal Fungal
and TCM can be summarized in three points which are
listed as following.
2.1 Long History
The history of medicinal fungi are more than 2,000
years. Poria, Ganoderma lucidum, Omphalia
lapidescens Schroet, Bombyx Batryticatus and
Polyporus, etc. had been described in the book titled
“Shen Nong's Herbal” which was published during the
period of AD 25 to 220 years.
2.2 Close Relation
It is reported that the fungi Poria was one of the most
popular component in TCM prescriptions. Ganoderma
lucidum, Tremella and Cordyceps sinensis are very
popular, too.
2.3 Wide Range of Uses
Fungi TCMs are used widely. They can be used as
oral and topical medicines which have the functions of
antimicrobial, insecticidal, anti-inflammatory, pain,
bleeding, sedative, anti-tumor, anti-virus, etc [3].
3. Two Basic Ways of Fungus TCMs within
the Range of TCM
3.1 Medicinal Fungi
Medicinal Fungi mean the medicines take fungi
tissues like sporocarp, sclerotia, etc. as materials. There
are about 30 kinds of fungi like Ganoderma and Poria
belong to medicinal fungi, most of them belong to
Higher Fungi and Macrofungi, and are widely used in
compound decoction and TCM. There are wild and
cultivated fungi.
3.2 Fungus TCMs
Fungus TCMs is the products fermented by fungi in
solid state materials contained water which are called
“fermentation media” nowadays. For example, the
ancient Divine Comedy and red yeast rice, sauce, wine
(BRANDIED), etc. can be produced through "koji
process" during the early history of China. Hericium
erinaceus preparation tablets, Armillaria mellea
preparation tablets, etc. are produced through "Solid
culture", and Trametes robinioplila Murr. fermentation
substance, Trametes robinioplila Murr. particles, etc.
are produced through “Solid fermentation” during the
modern times. Generally speaking, Fungus TCMs can
be produced from Strains of medicinal fungi through
“Solid state fermentation (SSF)” .
In fact, "medicinal fungi" and "fungus TCMs" are
from the common source, which belong to "fungus
TCM" (they are suggested to be called "fungi
medicine" recently [4], the same as the following). This
article focus on introduce "fungal medicine" and their
production " Solid state fermentation engineering
(SSFE)" [5].
4. SSFE for Medicinal Fungi and the
Production of Fungal Medicine
4.1 Characteristics and Advantages
Firstly, SSFE is the inherent production technology
within the Range of TCM, which is not proprietary for
TCM, but it is found in the solid state fermentation
industry of Chinese medicinal fungi only.
Secondly, only SSFE was applied and developed
within the Range of TCM, although there are many
biological technologies related to TCM, like cell
engineering, genetic engineering and fermentation
engineering, etc.
Thirdly, on one hand, the description about
characteristics of fungal medicine include tastes,
function position, curative effects, etc., because its
application and development are guided by
philosophies, ideas and experiences of TCM for
long-time, on the other hand, the R&D of new varieties,
the using of modern medicine researches and
experimental methods meet the requirements of
modern medicine.
Fourthly, fungal drug production technologies have
long history which from the koji process, the solid
culture, to "SSFE series" at the beginning of 21st
century, and with good development and prospects.
 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicinal Fungal 55

4.2 The Ancient "Koji Process" and Its Early the color changed to mulberry). Interestingly, because
Representative Products [6] of the new development of modern special elements,
for example, rice rich in Se, strains mutated and
According to the record of book “Medicinal Theory”,
screened, etc. a new kind can be produced which is
TCM “Shenqu” had begun to be produced by extensive
“Hongqu rich in Se” (also known as “Tianqu”).
SSF for medicinal purposes 1500 years ago, this is the
4.2.3 Others
earliest record. Since then until the 1960s, the other
Some other examples of early fungus TCMs include:
fungi medicines such as varieties of Qu (Hongqu),
Distiller's grains (Herbal Supplements, Tang Dynasty),
sauce, wine (BRANDIED), etc. were produced. The
Semen Sojae Praeparatum (Materia Medica words,
early production techniques collectively referred to as
Ming Dynasty), fermented bean curd (A Supplement to
“Koji process”, Table 1 shows the representative
the Compendium of Materia Medica, Qing Dynasty).
productions.
Furthermore, there are some special varieties produced
Table 1 shows some fungus TCMs made by ancient
in special places, such as “Pien Tze Huang” produced
"koji process". The techniques are extensive, without
in Fujian [7].
sterilization treatment or aseptic operation, materials
are ordinary, strains are natural induced, temperature is 4.3 The Modern Solid Culture and Its Representative
hard to control, so the fermentation was always done Products
during the seasons/times with optimum temperature,
During the period of 1960s to the middle of 1980s,
usually the products are medicinal and edible.
the R&D and production of fungus TCMs come into
4.2.1 Shenqu (like “yeast flakes”) Recorded in
the stage of “solid culture”, which is characterized by
“Medicinal Theory” (Tang Dynasty)
artificial operation, taking agricultural byproducts (like
Shenqu is one of earliestly-applicated fungus TCMs
corn cobs, bagasse, rice bran, wheat bran, corn powder)
in China, which has been used for more than 1500
as materials, bottle fermentation, high-temperature
years. It was usually produced during spring and
sterilization, aseptic operation, separation and
summer in ancient times. Wheat bran, flour, red bean,
purification of special strains and constant temperature.
almonds (peeled), and Polygonum, Artemisia annua,
The products were always named “Cultured
Xanthium and other herbswere were used as
substances”. It is considered that medicines efficacy
fermentated materials. The method is, materials were
was dominated by strains, because they include a large
ground into powder and mixed (mixtures are different
amount of Mycelium which possess the similar
in different places), made them into paste,
efficacy with Fruiting body. Their application was
sub-packaged, heat preservated, and let them cultured.
divided into two types according to the nature of the
The mixture should be dried when mycelium appeared
base materials which were “direct application” and
on its surface. Shenqu is used widely, mainly for
“application after extraction”. Production process
indigestion.
improved significantly compared with “Koji process”.
Furthermore, Shenqu is important and noteworthy in
But the fundamental problem is the process is “culture”,
Bidirectional, Multi-strains fermentation which
not “fermentation”, the nature of them is different, and
belonged to modern SSFE.
it is lack of terminologies which affect the scientific
4.2.2 Hongqu (Fermented by Monascus) Recorded
expression. Some representative medicines produced
in Ming Yi Bie Lu (Liang Dynasty)
by Modern solid “culture” were shown in Table 2.
Hongqu had been medicinal used for more than 800
It had begun to pay attention to some important basic
years. Fermentation method is, steamed white Japonica
R&D of modern medicines during the period of
rice were fermented under 30 ℃ for about 3 d (when
56 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicinal Fungal

Table 1 Representative productions of "fungal medicines" produced by ancient "koji process".

Name Record origin Application Fermentation Fermented Fermentation Characteristics, Indications
year (A.D.) strains materials conditions organs the
medicines work
on
Shenqu Medicinal About 500 Multi-strain Mixed Natural Sweet and acrid, Promoting digestion to
Theory (Tang induced by materials optimum warm, spleen eliminate stagnation,
Dynasty) nature (yeast), temperature and stomach invigorating the spleen
etc. (N.O.T.) and increasing the
appetite
Sauce Ming Yi Bie About 900 Naturally Soybean, N.O.T. Salty, good taste Heat-clearing and
Lu * (Liang induced (A. wheat flour spleen and detoxication
Dynasty) flavus), etc. stomach
Hongqu Precautions of About 1300 Add Monascus White N.O.T. Sweet, slightly Invigorating the spleen
Drinking and artificially Japonica rice warm and promoting
Eating (Yuan spleen, large digestion, Promoting
Dynasty) intestine, liver blood circulation and
dissipate stasis
BRANDIED Gang Mu About 1700 Add Distiller's Glutinous N.O.T. Sweet and acrid, Reinforcing qi,
Shi Yi (Qing yeast artificially rice warm regenerate body fluid,
Dynasty) promoting blood
circulation
* mens “Another Record of Famous Medicine” in English. ** means A Supplement to the Compendium of Materia Medica.

Table 2 Representative medicines produced by Modern “solid culture”.

T Characteristics, organs
Name Strains Materials Applications Indications
(℃) the medicines work on
Armillariella Direct application Tonifying the blood
Armillaria Corn flour 25 Warm, sweet
mellea (Armillaria tablet) and replenishing qi
Water extraction Invigorating the
Cane
Hericium 22 - (Hericium tablet) Nature, sweet spleen and
Hericium bagasse, rice
erinaceus 26 Ethanol extraction spleen and stomach increasing the
bran
(Weilening tablet)* appetite
* means “work on stomach”.
Note: Characteristics, organs the medicines work on, and indications are similar with their fruiting bodies.

modern “solid culture”. For example, the study on
Hericium got a good achievement.
Some examples of other similar products in this
period: Marasmius androsacus (anluotone tablet),
Polystictus versicolor (versicolor tablet), and
Armillariella tabescens (Armillariella tablet), etc.
4.4 Basic Contents of Modern SSFE
Since the late 1980s, the production techniques of
fungi medicines had changed from “solid culture” to
“solid fermentation”, in addition to the developing and
updating of the concept, fungi medicines has been
clearly belonged to TCM because of the promulgating
of “Provisions for new drugs approval” in China. The
positioning of R&D of new products has come to be
reasonable, which is implemented according to
requirements of R&D of TCM. On one hand, the
products of SSF maintained the features and
advantages of TCM, on the other hand, the technique
adopted the modern drug R&D requirements and
experimental methods, all of these make SSFE
gradually matured. Such as the R&D of “Trametes
robinioplila Murr. fermentation substance” and
Trametes robinioplila Murr. particles.
5. SSF and Solid Culture
It is seemed that there isn’t significant difference
between culture and fermentation. But actually, either
nature or role of them are different. Take Trametes
robiniophila as example, the culture is taking corn cob
 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicinal Fungal
and wheat bran as culture materials, the products
“Cultured substances” include a large amount of
mycelium which is considered to possess medicinal
functions and the wastes of culture materials in which
the nutrient has been depleted, but they couldn’t be
separated technically, of which the application can only
be mixed. This is unreasonable in theory, and the
products couldn’t be passed the “Provisions for new
drugs approval”, except the products don’t include any
wastes. Fermentation technology solved this problem.
The basic concept of fermentation is, microorganisms
(fungi) carry out its/ their physiological activities under
certain conditions, the organic matter (fermentation
media) is decomposited and transformed to various
nutrients like C, N, vitamin by enzyme which can be
used by strain growth, the strain would secrete various
secondary metabolites (such as polysaccharide)
(include intracellular and extracellular) some of which
may be active ingredients. So the fermented products
include mycelium and secondary metabolites which
collectively referred to as “strains fermentation
substance”, and may can be medicinal used. Therefore,
culture and fermentation are different from each other
[8]. (See Fig. 1).
B (Substrate) is also called Fermentation media. *
means strains fermentation subs tance. A, B, C are the
basic elements of SSFE, in which any element changed
importantly may affect, in varying degrees,
characteristics and efficacy of fermentation and
products.
5.1 The Combinations, Cycle, the End of Fermentation
Fermentation media can be divided into two kinds by
characters which are “Nutritional media” (made up of
agricultural by-products like corn cob, sugar cane
bagasse, wheat bran, corn powder) and “Medicinal
media” (made up of Chinese herbal medicines
including herbal dregs). There are also media which
include both of the above materials which called
“N&M media”. “Fermented combinations” are made
up of strains and media, the combinations are
57
fermented under certain conditions, after a certain
fermentation cycle (days), produce qualified fermented
substances. The fermentation cycle and ending can be
determinated by media, fermented substances
components and dynamic changes of their efficacy, the
related product quality standards also can be refered.
5.2 Categories and Naming of Fermented Substances
(FS)
FS are the products of SSF, their categories depend
on the characters of media. Fermentation carry out in
nutritional media is called “Common fermentation”,
the products are named by strain names, such as
Trametes robinioplila fermentation substance.
Fermentation carry out in medicinal media or “N&M
media” is called “bi-directional fermentation”, the
products are named by both of the strain name and
media name, for example, Trametes robinioplila
fermented in “N&M media” which include Astragalus,
the product are nemed “Trametes robinioplila &
Astragalus fermented substance”. The techniques of
“bi-directional fermentation” is bi-directed, because on
one hand, the media provide nutrients to fungi, on the
other hand, the crude medicine in media can be
decomposed and transformed to some new active
ingredients, the characters and efficacy maybe
different from the original media. And thus the SSF of
fungi medicines are developed toward series of
techniques. [9]
5.3 Process of SSFE
The process of SSFE are showed in Fig. 2.
6. The Series of Modern SSFE and Their
Representative Species
Modern SSFE of medicinal fungi has been
developed for 20 years from the R&D of T.
robinioplila fermented substance in late 1980s,
Production process of strains fermented substances had
basically basically realized mechanization, automation,
and accepted fermentation idea of SSF and some
58 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicinal Fungal

Mycelium ×
Fer Aut Inoc Tem Culture Cultured Wastes can’t be
Culture materials (corn men ocla ulate pera substances
separated
cob, wheat bran + water) ted ve d ture
Fermentation media bottl strai *
e ns Mycelium
Fermenta Substance √
Secondary
tion ** Active
metabolites
ingredien
t
Fig. 1 Comparison of solid culture and SSF.
* means Natural optimum temperature; ** means strains fermentation substance.

Fig. 2 SSF process of medicinal fungi.

terminologies etc. at the same time. “Provisions for
new drugs approval” promulgated in 1985 clearly
defined quality standards of techniques,
physio-chemistry, pharmacology, toxicology and clinic,
etc. Examination and approval of new medicines were
unified by the state. Table 3 showed the development
of SSF, and suggest the existence of the innovation
space.
It is noted that the current successful technique is
common fermentation (T. robinioplila fermented
substance) which is more suitable for R&D of new
strains, and is also worth exploring the possibilities of
using medicinal fermented substances to instead of its
medicinal fungi. Bi-directional fermentation is in R&D,
the products may possess new components with new
functions. In addition to ○F, there were “T. wilfordii &
G. lucidum fermented substance” and “T. wilfordii & A.
membranaceus fermented substance” which had been
reported. Multi-strains fermentation and Special
elements fermentation are in exploring and studying.
6.1 T. robinioplila Fermented Substance ( (Common
Fermentation of SSFE): Preparation - T. robinioplila
Granules)
6.1.1 Identification, Textual Studies
T. robinioplila Murr. is recorded as “edible tree
fungus grown on locust tree” by Ge Hong (about AD
500) according to “Compendium of Materia Medica”,
and as “Trametes” in “Tang Materia Medica” (about
AD 900). The functions are recorded as “treating
diseases caused by wind”, “tonifying the blood” and
“good for body strength”. But it hadn’t been recorded
since Qing Dynasty (about AD 1900). It recorded as
“Auricularia auricula” grown on locust tree by mistake
in modern “Dictionary of Chinese Medicine”. It has
been confirmed to possess the function of anti-cancer,
and with the scientific name “Trametes robiniophila
Murr.” [7] (Polyporaceae). It is produced in Shandong,
Henan, Hebei, etc. (China), and usually grown on
Sophora japonica.
6.1.2 Biological Characteristics and Construction of
Production Process
The research project of T. robinioplila Murr. is
approved by Chinese Ministry of Health and
implemented by Nanjing University of Chinese
Medicine (NJUTCM) in 1978. The Fruiting body was
picked from S. japonica, then used for separating and
purification strains, and multiplication of T.
robinioplila Murr. had succeeded. Because of rare wild
resources, complex artificial cultivation techniques and
 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicinal Fungal 59

Table 3 Brief Introduction of series of modern SSFE.

SSFE name Bacteria Media Conditions Fermented Representative Major functions Technique Application
substances product characteristics direction
Common One kind Nutritional N.O.T., Medicinal T. robinioplila Anti-cancer Combination, R&d of new
fermentation (Such as media dark used fermented optimization strains
Trametes) fermented substance
substances
Bi-directional One kind N&M N.O.T., Medicinal F
○ Anti-virus Optimization R&D of new
fermentation (Such as media or dark fermented T. wilfordii & Immuno- of combined fermented
Trametes) medicinal substances G. lucidum suppression media combinations
media fermented
(such as substance
astragalus)
Multi-strains Multi-strains Open N.O.T., Multi-strain Fermented In R&D Multi-strains In
fermentation with high dark fermented substances M
○ exploration
quality substances
Special One or Open N.O.T., etc. Special Fermented In R&D Special In
elements Multi-strains elements substances ○
S conditions exploration
fermentation fermented
substances
F means “T. robinioplila & A. membranaceus fermented substance”.
○

long development cycle of up to 3 years lead to low
biological effects and shortage in medicinal supply, a
new production technique was developed which was
fermentation. Two kinds of fermentation techniques -
liquid (shake flasks) and solid (inside bottle) - were
designed according to the biological characteristics like
nutrients of T. robinioplila [10]. A special method
“method of dynamic comparative (include
fermentation matrix, fungi components and medicinal
efficacy) during fermentation process” which use
agriculture by-products as nutritional matrix was
proposed to establish a standardized reasonable
solid-state fermentation technique of “T. robinioplila
fermented substances” [11]. Take the products of liquid
and solid fermentation for tumor (S180) inhibition test,
and the tumor inhibition rate is < 12% and > 30%,
respectively. The results mean that SSF technique is
better.
6.1.3 Project Planning and R&D of New Medicines
According to “Provisions for new drugs approval”,
more than 20 basic researches should be completed, the
fermented substances should be extracted to produce
“T. robinioplila granules” for clinical test. Furthermore,
concept, theory and terminologies about “Solid-state
fermentation” should be clarified and make the
necessary amendments. And it is noted that secondary
metabolites in fermented substances contained active
ingredients which exist both extracellular and
intracellular. So the hole fermented substances can be
used as medicine. In 1992, T. robinioplila fermented
substances and granules passed the examination of
Chinese Health Ministry and were approved as
medicines which belong to TCM [12]. They were trial
produced by Gaitianli Pharmaceutical Co., Ltd. Jiangsu
(China) for the treatment of primary liver cancer, then
full produced in 1995. The products got ministerial
second prize of State Administration of Traditional in
1995, Third Prize of National Science & Technology
Advance Prize in 1998, the national invention patents
in 2001, which had been produced for more than 15
years and listed in Public health services of China. The
clinical indications of lung cancer, breast cancer,
gastrointestinal cancer, etc. had been approved for
expanded studying in 2008.
6.1.4 Using for Compound Proprietary Chinese
Medicines (CPCM)
T. robinioplila fermented substance can acted as
component of CPCM under the guidance of the theory
of Chinese medicine. For example, a CPCM called
“Huan-er-jin particles” (SFDA Approval No.
B20020074) mainly include T. robinioplila fermented
substances, medlar and astragalus, which can be used
60 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicinal Fungal
to adjust the immune function of adults, treat weak
constitution and repeated cold of children, etc.
6.2 T. robinioplila & A. membranaceus Fermented
Substance (Bi-directional SSFE: N&M Media -
Medicinal Fermented Substance)
6.2.1 Trial Treatment of Chronic Hepatitis B
T. robinioplila & A. membranaceus fermented
substance is planned to expand the trial in the treatment
of chronic hepatitis B according to the good role of T.
robinioplila on a number of important immune
functions such as inducing of IFN, based on the results
of clinical background tests, negative rate 33% of
HBeAg-positive patients, and significant effect on
anti-duck DHBV-DNA (waved after stopping
medicines, not significant on chemical liver injury, and
needs further study).
6.2.2 Basis and Ideas of Bi-directional SSF
TCM materials were easy to lose medicinal
functions according to enzymes of fungi in air like
Penicillium sp., Mucor sp., etc. This phenomenon
inspired the researchers thinking. If took medicinal
fungi (T. robinioplila) and TCM material (Medicinal
media) as fermentation combination which is solid
fermented. Because Medicinal media supply nutrition
to fungi, Fungal metabolism leads change of
components in Medicinal media, so the fermentation is
bidirectional. In theory, different fungi have different
enzyme systems (the known fungi enzymes are more
than 300), the composition of various TCM materials
are also different, so successful cross-portfolio
fermentation may produce various fermented
substances possess different special characteristics.
Furthermore, TCM materials can be N&M media, too
which may enrich the fermented substances.
6.2.3 Selection of Medicinal Media
NJUTCM started the project of medicinal media
materials’ selection funded by The National New Drug
Research Foundation of China in 1991. Take T.
robinioplila Murr. as fermenting strain, and take 101
kinds of medicinal herbs as medicinal media materials
for selection. “Three-layer fermenting combination
Optimization method” (3+1 Optimization method) was
used to choose suitable medicinal media. Finally, A.
membranaceus Bge. Var. mongholicus (Bge.) Hsiao
was proved to be the optimal selection against virus
[13].
6.2.4 The Standard Formula Research of Media
Add appropriate amount of Astragalus into T.
robinioplila nutrition media could significantly
improve fermented substances’ medicinal efficacy.
The optimal dosage of Astragalus in this N&M media
was determined according to the daily dose of T.
robinioplila fermented substances for an adult.
Furthermore, by-products of Astragalus residues after
producing of Astragalus oral liquid can be used as
media material. The experiment of optimal dosage
should be completed in advance. So Bi-directional SSF
may be acted as a new approach of secondary
development of TCM which is valued to research [14].
6.2.5 Post-processing of Fermented Substances
T. robinioplila & A. membranaceus fermented
substance belong to medicinal fermented substance, its
post-processing is drying. The optimal method is
electric drying below 70 ℃. If dried by the sun, it
should be dried within three consecutive sunny days in
summer.
6.2.6 Characteristics and Efficacy Comparison of T.
Robinioplila and T. Robinioplila & A. Membranaceus
Fermented Substances
The part of 6.1.2 have described the new method of
producing T. Robinioplila fermented substance, and its
physical and chemical properties and extraction
process of compositions have also been fully studied.
Table 4 showed detailed characteristics and efficacy
comparison of T. robinioplila and T. robinioplila & A.
membranaceus fermented substances.
Table 4 showed that if add some Astragalus to T.
Robinioplila fermentation nutritional media, the meida
would be changed to N&M media, and the production
would be more efficacious on improving the body
immune activity, against DHBV-DNA,
 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicinal Fungal 61

Table 4 Characteristics and efficacy comparison of T. robinioplila and T. robinioplila & A. membranaceus fermented
substances.
Fermented substances name
Medicinal characteristics and efficacy T. robinioplila & A.
T. robinioplila Positive control
membranaceus fermented
fermented substance group CK+
substances
Macrophage function, serum lysozyme levels,
Good Excellent CK+ test in each
lymphocyte transformation, serum interferon
Strong Very strong group qualified
inducing such as antibody producing
Hepatoprotective effect (chemical, immunological
Immune Not significant Significant Significant - PSK
liver injury)
Significant effect More significant effect
Significant -
Anti-duck hepatitis virus DHBV-DNA Fluctuat after stop Don’t fluctuat after stop
acyclovir
taking medicines taking medicines
HBeAg negative rate of clinical background
Efficacy 33 49 31 - IL - Ⅱ
experiment (%)
S-180 tumor inhibitive rate of animals
Note 46 40
transplanted tumor experiment (%)

hepatoprotective and clinical efficacy significantly.
The application of T. Robinioplila have developed
from anti-tumor to anti-virus, which could expand its
clinical indications.
Thus most of basic research about a promising
anti-viral medicinal fungal fermented substances have
been completed, the writing paper “New type of solid
fermentation engineering of medicinal fungi and
development of HuaiQi fungal substance” has won
numerous awards. Its further researches need to be
continued. According to this idea, process, etc., the
production of no-dregs type of "G. lucidum & A.
Membranaceus fermented substances" trial in the
prevention and control of chicken avian influenza got
good efficacy [15].
6.3 T. wilfordii & G. lucidum Fermented Substance
(Bi-directional SSFE: Medicinal Media - Medicinal
Fermented Substance)
6.3.1 Brief Introduction of TCM Tripterygium
wilfordii Hook.f.
Tripterygium wilfordii hook.f. possess the functions
of immunosuppressive, anti-inflammatory,
antibacterial, antiviral, anti-tumor, etc. which can be
used in contraception, too. Currently, it is used in more
than 50 clinical diseases such as rheumatoid arthritis
and other autoimmune diseases, organ transplant
rejection and cancer, etc. But It is highly toxic at the
same time. It would cause multiple systems organ
damage or even death. Its most active ingredients are
toxic, mainly of Triptolide the LD50 of which is 1.19 +
0.204 mg/kg (oral) is highly toxic. The effective dose
and toxic dose is very close which greatly limits its
application. There are various detoxification methods
in TCM, for example, removed cortex (the most toxic
part) from roots (medicinal part) before application.
And many experiments have been done to reduce
toxicity at home and abroad, but non satisfying
toxicity-reducing and efficacy-maintaining method
have been got.
6.3.2 Bi-directional SSF & T. wilfordii & G. lucidum
Fermented Substance
Use “Bi-directional SSF” to do the toxicity-reducing
and efficacy-maintaining study. Take root (with cortex)
as medicinal media fermented with 22 strains which
may form 22 fermentation combination. Finally, G.
lucidum was chosen to be the optimal strain by “3+1
Optimization method”. Optimal fermention process
was found out by “method of dynamic comparative
during the fermentation” [16], the production is called
“T. wilfordii & G. lucidum fermented substance”.
Compared with T. wilfordii herbal CK1, Triptolide
content decreased significantly, a new peak appeared
near Triptolide chromatography, toxicity decreased
and LD50 increased simultaneously. Many immunity
tests have been done. For example, use tube
62 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicinal Fungal
agglutination test antibody titer, use serum hemolysin
test the effect on humoral immune, use lymphocyte
transformation test and 2,4,6-trinitrochlorobenzene
induce mice delayed type hypersensitivity (DTH)
determine the effect on cellular immunity, the results
showed a certain immunosuppressive efficacy. Use
mouse spleen cells determine the effect of samples on
the capability of spleen cells secrete IL-2 induced by
ConA, the result showed inhibition on cytokines [17].
All of the above fully illustrated that taking G.
lucidum as bi-directional SSF preferred species played
very important role in the toxicity-reducing and
efficacy-maintaining of T. wilfordii. This research won
the national invention patent of China in 2005. Further
study was conducted by Fungi Pharmaceutical
Research Center of Jiangxi University of Traditional
Chinese Medicine. It was lised as a project of
international cooperation of National Science and
Technology Ministry in 2006, which have got new
research progress [18, 19].
7. Conclusion
Fungal medicinal SFE had experienced some
developing stages such as “koji process”, “solid
culture”, etc., which is the sole and long historic
biopharmaceutical technology in the range of TCM. Its
developing and improving benefits of the guide of
TCM philosophy and experience, the technology and
applications with Chinese characteristics had the
characteristics of TCM, too. So far, many
biotechnologies applicated in modern TCM such as
Common and Bi-directional fermentation are still
practical nowadays. Furthermore, the traditional
fermentation techniques have integrated modern
medicine R&D techniques, the research become to
more mature. Some new research such as
“Multi-strains and Special elements fermentation”
have been started, and fungal medicinal fermentation
have entered the period of “series of solid state
fermentation engineering” which with good prospects.
It is also the excellent experimental fields to integrate
with western medicine. The researches about fungal
TCM need policy and financial support to accelerate its
development and improvement, while maintaining the
traditional characteristics of TCM at the same time.
References
[1] Ci Hai Editorial Board, Ci Hai: A Comprehensive Chinese
Lexical-Encyclopaedic Dictionary (Small prints), (1997
edition), Shanghai Dictionary Publishing House, 1980. (in
Chinese)
[2] Y. Zhuang, Mycology and medicine, Edible Fungi of
China 23 (3) (2004) 3-6. (in Chinese)
[3] Y. Zhuang, Overview of Chinese medicinal fungi, Edible
Fungi of China 20 (2) (2001) 3-5. (in Chinese)
[4] Y. Zhuang, J. Hong, Y.L. Xu, Fungal medicine in the
Traditional Chinese Medicine, World Science and
Technology - Modernization of Traditional Chinese
Medicine 11 (6) (2009) 777-782. (in Chinese)
[5] Y. Zhuang, Solid fermentation of medicinal fungi, Chinese
Pharmaceutical Journal 26 (2) (1991) 80-82. (in Chinese)
[6] State Administration of Traditional Chinese Materia
Medica Editorial Board, Chinese Materia Medica,
Shanghai Science and Technology Press, Shanghai, China
1999 p. 52. (in Chinese)
[7] S.Q. Lin, Production and Product Development of Chinese
Medicinal Fungi, China Agriculture Press, Beijing 2000 p.
11. (in Chinese)
[8] Y. Zhuang, Fungi fermented substances - a new field of
TCM, Traditional Chinese Drug Research & Clinical
Pharmacology 8 (2) (1992) 49-51. (in Chinese)
[9] Y. Zhuang, Identification and verification of Trametes
robinioplila Murr., Edible Fungi of China 13 (6) (1993)
22-23. (in Chinese)
[10] J.T. Xu (Chief Editor), Chinese Medicinal Mycology,
Chinese Academy of Medical Sciences & Pe-king Union
Medical College Press, Beijing 1997 pp. 693-697. (in
Chinese)
[11] Y. Zhuang, Study on a new anti-cancer medicine Trametes
granules, Chinese Pharmaceutical Journal 33 (5) (1998)
273-275. (in Chinese)
[12] Y. Zhuang, Research and produce of Trametes granules
against cancer, Chinese Tumor 8 (12) (1998) 540-543. (in
Chinese)
[13] Y. Zhuang, Y.M. Chi, S.B. Chen, Z.D. Min, New type of
solid fermentation engineering of medicinal fungi and
development of HuaiQi fungal substance, Chinese
Pharmaceutical Journal 3 (29) (2004) 175-178. (in
Chinese)
[14] Y. Zhuang, J. Hong, Medicinal fungal bi-directional solid
fermentation engineering and further development of
 Medicinal Solid Fermentation Engineering of Chinese Traditional Medicinal Fungal
TCM dregs, China Journal of Chinese Materia Medica 3 (2)
(2006) 1918-1919. (in Chinese)
[15] L.Y. Zhang, Y.F. Zhou, D.L. Zhang, Fungi go into
veterinary drug field & fungal substance resist Avian
Influenza, Edible Fungi of China 25 (2) (2006) 3-6. (in
Chinese)
[16] Y. Zhuang, Basic research methods of medicinal fungi
solid fermentation upstream engineering building, Edible
Fungi of China 28 (4) (2009) 8-10. (in Chinese)
[17] Y. Zhuang, X.M. Xie, Primary studies of toxicity-reducing
and efficacy-maintaining action of fungal fermentative
63
products in T. wilfordii by a novel bi-directional solid-state
fungal fermentation, Chinese Pharmaceutical Journal 34
(16) (2009) 2083-2087. (in Chinese)
[18] M.S. Shu, X.M. Xie, H.D. Luo, Establishment of
bi-directional fermentation process of toxicity-reducing
and efficacy-maintaining of T. wilfordii, Mycosystema 29
(2) (2010) 294-299. (in Chinese)
[19] X.M. Xie, J. He, H.D. Luo, The toxicity-reducing and
efficacy-maintaining efficacy of T. wilfordii fermented
with G. lucidum, Chinese Traditional and Herbal Drugs 40
(12) (2009) 3-5. (in Chinese)
 Call for Paper

Descriptions
The Journal of Life Sciences, a double monthly professional academic journal, is striving to provide the best
platform for researchers and scholars worldwide to exchange their latest findings and results.

Instructions for Authors

1. The manuscript should be original, and has not been published previously. Please don’t submit material that is
currently being considered by another journal.
2. Manuscripts may be 3,000-8,000 words or longer if approved by the editor, including abstract, text, tables,
footnotes, appendixes, and references. The title should not be exceeding 15 words, and abstract should not be
exceeding 150 words. 3-8 keywords or key phrases are required.
3. Authors should submit manuscripts online at http://www.davidpublishing.com or send them to Managing Editor
by e-mail. A manuscript file in MS Word version 2003 (or some other word processing format) is required. If using
MS Word, you must submit a .doc file. Please do not submit .docx files as they cannnot be processed by the
submission system. Although there are no file size limitations, note that large files will take longer to upload and
download depending on the Internet connection. Please try to keep the maximum .doc file size less than 5 MB.
4. Figures are in grayscale status in printed journals which can be colored in e-journal. So if there are color figures in
your paper, you can use different lines or symbols to instead of colors if necessary.
5. The manuscript should be in MS Word format, submitted as an email attachment to our email address.

Peer Review Policy

Journal of Life Sciences is a refereed journal. All research articles in this journal undergo rigorous peer review,
based on initial editor screening and anonymised refereeing by at least two anonymous referees.

Editorial Procedures
All papers considered appropriate for this journal are reviewed anonymously by at least two outside reviewers. The
review process usually takes two to three weeks. Papers are accepted for publication subject to no substantive,
stylistic editing. The Editor reserves the right to make any necessary changes in the papers, or request the author to
do so, or reject the paper submitted. A copy of the edited paper along with the first proofs will be sent to the author
for proofreading. They should be corrected and returned to the Editor within seven days. Once the final version of
the paper has been accepted, authors are requested not to make further changes to the text.

Submitting of Manuscripts
All manuscripts submitted will be considered for publication. Please visit our website at www.davidpublishing.com
for our automatic paper submission systems or as an email attachment to life-sciences@davidpublishing.com and
life-sciences@hotmail.com.
Welcome to visit our website at http://www.davidpublishing.com.