Supplemental Material can be found at:
http://www.jbc.org/content/suppl/2008/01/11/M707224200.DC1.html
Programmed Cell Death 4 (PDCD4) Is an Important Functional
Target of the MicroRNA miR-21 in Breast Cancer Cells*□
Received for publication, August 28, 2007, and in revised form, November 8, 2007 Published, JBC Papers in Press, November 8, 2007, DOI 10.1074/jbc.M707224200
Lisa B. Frankel‡, Nanna R. Christoffersen‡, Anders Jacobsen‡§, Morten Lindow‡§1, Anders Krogh‡§,
and Anders H. Lund‡¶2
From the ‡Biotech Research and Innovation Centre, §Bioinformatics Centre, Institute of Molecular Biology, and ¶Centre for
Epigenetics, University of Copenhagen, DK-2200 N Copenhagen, Denmark
MicroRNAs are emerging as important regulators of cancer-
related processes. The miR-21 microRNA is overexpressed in a
wide variety of cancers and has been causally linked to cellular
proliferation, apoptosis, and migration. Inhibition of mir-21 in
MCF-7 breast cancer cells causes reduced cell growth. Using
array expression analysis of MCF-7 cells depleted of miR-21, we
have identified mRNA targets of mir-21 and have shown a link
between miR-21 and the p53 tumor suppressor protein. We fur-
thermore found that the tumor suppressor protein Pro-
grammed Cell Death 4 (PDCD4) is regulated by miR-21 and
demonstrated that PDCD4 is a functionally important target for
miR-21 in breast cancer cells.
Since their discovery (1– 4), microRNAs (miRNAs)3 have
emerged as integrated and important post-transcriptional reg-
ulators of gene expression in animals and plants (5, 6). In ani-
mals, miRNAs bind to partly complementary sequence motifs
present predominantly within the 3⬘-untranslated regions
(UTRs) and mediate translational repression, sometimes
involving degradation of the target mRNA (7–9). miRNAs have
been found implicated in a multitude of cellular processes
including proliferation, differentiation, migration, and apopto-
sis (10 –12). Accordingly, aberrant miRNA expression has been
linked to diseases, including cancer (13–15). Evidence for the
causal involvement of miRNAs in cancer comes from several
sources. First, mapping of fragile sites and chromosomal
regions lost or amplified in cancer displays an intriguing over-
lap with the localization of miRNA genes (16, 17), and detailed
mapping studies have demonstrated loss of the miR-15/miR-16
genes in chronic lymphocytic leukemia and of the miR-34a
* This work was supported by the Biotech Research and Innovation Centre,
the Vilhelm Pedersen and Hustrus Foundation, The Danish National
Research Foundation, The Danish Medical Research Council, the Danish
Cancer Research Foundation, the Danish Cancer Society, The Association
for International Cancer Research, and the Novo Nordisk Foundation. The
costs of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked “advertise-
ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
□S
The on-line version of this article (available at http://www.jbc.org) contains
supplemental Figs. S1–S5 and Table S1.
1
Present address: Santaris Pharma A/S, DK-2970 Hørsholm, Denmark.
2
To whom correspondence should be addressed: Biotech Research and Inno-
vation Centre, Ole Maaløes Vej 5, DK-2200 Copenhagen, Denmark. Tel.:
45-3532-5657; Fax: 45-3532-5669; E-mail: anders.lund@bric.dk.
3
The abbreviations used are: miRNA, microRNA; UTR, untranslated region;
PTEN, phosphatase and tensin homolog; HEK, human embryonic kidney;
siRNA, small interference RNA; PI3K, phosphatidylinositol 3-kinase; mTOR,
mammalian target of rapamycin; LNA, locked nucleic acid.
1026 JOURNAL OF BIOLOGICAL CHEMISTRY
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 2, pp. 1026 –1033, January 11, 2008
© 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
S
gene in neuroblastomas (18, 19). Reintroduction of these
“tumor suppressor” miRNAs stalls the proliferation of cancer
cells or induces apoptosis (18, 20 –22). Second, genetic studies
in model organisms have led to the identification of miRNAs
with relevance for human cancer. This is exemplified by the
analysis of let-7, which in Caenorhabditis elegans targets let-60/
RAS and in humans is lost in some lung cancers, leading to
Downloaded from www.jbc.org by guest, on September 28, 2010
overexpression of N-RAS (23). Third, forward genetic studies
have demonstrated a role for the miR-17–92 cluster in lym-
phoma development in mice predisposed to cancer (24), and
screenings of miRNA expression libraries in cell culture models
of cancer have identified miR-372/373 and miR-221/222 as
cancer-promoting miRNAs via repression of the tumor sup-
pressor proteins LATS2 and p27, respectively (25, 26).
MicroRNA profiling studies of human tumors have shown
cancer type-specific deregulation of miRNA expression and
have identified a number of miRNAs with putative tumor sup-
pressor or oncogenic functions (13, 15). Interestingly, miR-21
stands out as the miRNA most often found overexpressed in
solid tumors (27), and increased levels of miR-21 have been
found in very diverse cancer types including glioblastoma,
breast, liver, and pancreatic cancers (11, 27–30). Furthermore,
causal links between miR-21 expression and cancer-related
processes such as proliferation, migration, apoptosis, and
tumor growth have been demonstrated in human hepatocellu-
lar and breast cancer cells (11, 31).
Previously identified targets for miR-21 include the tumor
suppressors tropomyosin 1 in breast cancer cells (32) and phos-
phatase and tensin homolog (PTEN) in hepatocellular carcino-
mas (11, 33). The widespread occurrence of miR-21 overex-
pression in cancer and the relatively few experimentally defined
targets prompted us to perform expression array analyses of
breast cancer cells transfected with miR-21 inhibitors to iden-
tify and functionally validate additional targets of miR-21.
EXPERIMENTAL PROCEDURES
Antibodies and Western Blot Analysis—MCF-7 cells were
seeded in 6-well plates and transfected the following 2 days. The
cells were harvested 5 days after the first transfection, washed
once in phosphate-buffered saline, and lysed in radioimmune
precipitation buffer (150 mM NaCl, 1% Nonidet P-40, 0.5%
sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl, pH 8, 2 mM
EDTA) containing 1 mM dithiothreitol, 1 mM Pefabloc (Roche
Applied Science), 1⫻ Complete Mini protease inhibitor mix-
ture (Roche Applied Science), 1 mM NaVO3, 10 mM NaF, 10 mM
pyrophosphate, and 50 mM ␤-glycerophosphate. 15 ␮g of pro-
VOLUME 283 • NUMBER 2 • JANUARY 11, 2008
 Supplemental Material can be found at:
http://www.jbc.org/content/suppl/2008/01/11/M707224200.DC1.html
miR-21 Targets PDCD4 in Human Breast Cancer Cells
tein/lane was separated on a 4 –12% NuPAGE Bis-Tris gel
(Invitrogen) and transferred to a nitrocellulose membrane. The
PDCD4 antibody was kindly provided by Dr. Iwata Ozaki,
Japan. The p53 and CDK6 antibodies were purchased from
Santa Cruz Biotechnology. The cofilin 2 antibody was pur-
chased from Cell Signaling and the vinculin antibody from
Sigma-Aldrich.
miRNA Precursors, Anti-miRNA Oligonucleotides, and
siRNAs—The locked nucleic acid (LNA)-modified oligonucleo-
tide inhibitors used for miRNA knock down were purchased
from Exiqon. The miRNA precursor hairpins were pur-
chased from Ambion. The PDCD4 SMARTpool siRNA was
purchased from Dharmacon.
Cell Culture—HEK293 and MCF-7 cells were maintained in
Dulbecco’s modified Eagle’s medium with 10% fetal bovine
serum (Biochrom), 100 units/ml penicillin, and 100 ␮g/ml
streptomycin (Invitrogen) and incubated at 37 °C in 5% CO2.
MCF-7 cells expressing an ecotropic receptor were transduced
with pRetroSuper-shp53 (34) or the empty pRetroSuper virus to
obtain the MCF-7 shp53 and MCF-7 EV cell lines, respectively. For
proliferation assays, MCF-7 cells were transferred to 1.0% fetal
bovine serum prior to transfections with miRNA inhibitors.
Vector Construction and Reporter Assays—A multiple clon-
ing site was inserted into the pGL3 control vector (Invitrogen)
at the XbaI site 3⬘ of the luciferase gene (hereafter pGL3). Six
different fragments were PCR-amplified from human genomic
DNA and cloned into pGL3. The primer sequences used for
PCR amplification were as follows (restriction sites are under-
lined). SOCS5 FW, 5⬘-gggagatctgactgctaatgtatgtttct-3⬘; SOCS5
RV, 5⬘-gggctcgagtactgatctattacaaattc-3⬘. IL6R FW, 5⬘-gggagat-
ctctgcagtaagggtgattctg-3⬘; IL6R RV, 5⬘-gggctcgagccagcaggataa-
gctgtcgta-3⬘. BTG2 FW, 5⬘-gggagatctgtattgccttcccagacctg-3⬘;
BTG2 RV, 5⬘-gggctcgagaaggtgtacatttgtccata-3⬘. CDK6 FW, 5⬘-
gggagatcttcaagttgttctacatttgc-3⬘; CDK6 RV, 5⬘-gggctcgagcagg-
cactggtctctgcctg-3⬘. BMPRII FW, 5⬘-gggagatcttatgtaagctggaat-
catcc-3⬘; BMPRII RV, 5⬘-gggctcgagtagtggcttaatgtcagctt-3⬘.
PDCD4 FW, 5⬘-gggtctagagacattttataaacctacat-3⬘; PDCD4 RV,
5⬘-aatcaatactgcttcacatg-3⬘.
The QuikChange site-directed mutagenesis kit (Stratagene)
was used to introduce one or two point mutations into the seed
region of pGL3-PDCD4, giving pGL3-PDCD4MUT1 and
pGL3-PDCD4MUT2, respectively. Mutagenesis primers used
were as follows. MUT1 FW, 5⬘-gtggaatattctaataaggtaccttttgta-
agtgccatg-3⬘; MUT1 RV, 5⬘-catggcacttacaaaaggtaccttattagaata-
ttccac-3⬘. MUT2 FW, 5⬘-gtggaatattctaataacgtaccttttgtaagtgcc-
atg-3⬘; MUT2 RV, 5⬘-catggcacttacaaaaggtacgttattagaatattccac-
3⬘. The pmiR-21-luc reporter vector was constructed by
inserting an oligo complementary to the mature miR-21
sequence into the pMIR-REPORT luciferase vector (Ambion).
HEK293 and MCF-7 cells were seeded in 96-well plates and
transfected with 50 nM miRNA precursor or LNA, 100 –150 ng
of luciferase vector (pGL3 constructs), and 25 ng of Renilla
vector (pRL-TK) using Lipofectamine 2000 (Invitrogen). 24 h
after transfection, cells were harvested and luciferase activity
was measured using the Dual-Glo luciferase assay (Promega).
Quantitative PCR Analysis—Total RNA from transfected
cells was isolated with TRIzol reagent (Invitrogen) according to
the manufacturer’s protocol. Quantitative reverse transcription
JANUARY 11, 2008 • VOLUME 283 • NUMBER 2
PCR was performed using the TaqMan reverse transcription kit
(Applied Biosystems) and Sybr Green 2⫻ quantitative PCR
master mix (Applied Biosystems). PCR primers used were as
follows: FAM3C FW, 5⬘-gctgggaggccggagcata-3⬘ and RV, 5⬘-
tgcagcacctgctaccctcatg-3⬘. HIPK3 FW, 5⬘-ctctacccaggagcct-
tggagtat-3⬘ and RV, 5⬘-tgttctcctggcaaaccttgagtct-3⬘; PRRG4
FW, 5⬘-atgcgggagaagaagtgtttacatca-3⬘ and RV, 5⬘-gggagtga-
agagctccagatcaaatc-3⬘. RP2 FW, 5⬘-tcagcgcgagaaggttgatcc-3⬘
and RV, 5⬘-caggtaagcgacctactgtttcatcc-3⬘. SGK3 FW, 5⬘-gtt-
ctggtttcagtgggaagaagtga-3⬘ and RV, 5⬘-agggccatagcaggaaac-
tgtttt-3⬘. GLCCI1 FW, 5⬘-cggaggagcagctcacctgag-3⬘ and RV,
5⬘-cgtggccactgtcctgtgaggta-3⬘. SLC16A10 FW, 5⬘-tggtcttta-
agacagcatgggtaggt-3⬘ and RV, 5⬘-tgaagacgctgactattgggcag-
3⬘. BMPR-II FW, 5⬘-atctgtgagcccaacagtcaatcca-3⬘ and RV,
5⬘-gaccaatttttggcacacgccta-3⬘. BTG2 FW, 5⬘-cgtgagcgagcag-
aggcttaag-3⬘ and RV, 5⬘-tggacggcttttcgggaa-3⬘. CDK6 FW,
5⬘-ctgcccaaccaattgagaagtttg-3⬘ and RV, 5⬘-cagggcactgtaggc-
agatattcttt-3⬘. IL6R FW, 5⬘-gggctctgaaggaaggcaagaca-3⬘ and
RV, 5⬘-cggtggggagatgagaggaaca-3⬘. SOCS5 FW, 5⬘-atctgtaa-
Downloaded from www.jbc.org by guest, on September 28, 2010
cctcccactgcatcagaa-3⬘ and RV, 5⬘-gatggtccccaaaccaataaatgg-
3⬘. PDCD4 FW, 5⬘-tatgatgtggaggaggtggatgtga-3⬘ and RV, 5⬘-
cctttcatccaaaggcaaaactacac-3⬘. ACTA2 FW, 5⬘-agcacatggaa-
aagatctggcacc-3⬘ and RV, 5⬘-ttttctcccggttggccttg-3⬘. APAF-1
FW, 5⬘-tctgatgcttcgcaaacaccca-3⬘ and RV, 5⬘-ctttcaacaccca-
agagtcccaaa-3⬘. FAS FW, 5⬘-cctccaggtgaaaggaaagctagg-3⬘ and
RV, 5⬘-ttcttggcagggcacgca-3⬘. SESN1 FW, 5⬘-actacattggaataat-
ggctgcgg-3⬘ and RV, 5⬘-ccccaccaacatgaaggaaatcat-3⬘. CDKN1A
FW, 5⬘-ggcagaccagcatgacagatttc-3⬘ and RV, 5⬘-cggatta-
gggcttcctcttgg-3⬘.
Growth Curves and Viability Assays—MCF-7 cells were seeded
in 24-well plates and transfected the following day with 50 nM LNA
or siRNA using Lipofectamine 2000. Cells were fixed at indicated
time points in 4% paraformaldehyde, stained in a 0.1% crystal vio-
let solution, and resuspended in 10% acetic acid. Sample absorb-
ance was measured at 620 nm. For cell viability assays, MCF-7 cells
were seeded in 24-well plates and transfected the following day
with 50 nM LNA or siRNA using Lipofectamine 2000. After 5–6
days of growth, cells were incubated for 4 h at 37 °C with 0.5
mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (Sigma-Aldrich). After incubation, supernatants were
discarded and formazan crystals were dissolved in a 10% formic
acid, 90% isopropanol solution. Sample absorbance was meas-
ured at 570 nm with a reference wavelength of 690 nm.
Affymetrix Microarray—MCF-7 wells were seeded in 10-cm
plates in Dulbecco’s modified Eagle’s medium containing 10%
fetal calf serum and triplicate independent transfections per-
formed the following day with either 50 nM LNA-miR-21 or
scrambled control LNA using Lipofectamine 2000. Total RNA
was harvested 24 h post-transfection using TRIzol reagent.
Affymetrix microarray analysis (HG-U133 Plus 2.0 human) was
performed at the Microarray Center, Rigshospitalet, Copenha-
gen University Hospital. Briefly, 2 ␮g of total RNA was used to
synthesize double-stranded cDNA using Superscript威 Choice
System (Invitrogen) with an oligo(dT) primer containing a T7
RNA polymerase promoter. The cDNA was subsequently used
as template for an “in vitro” transcription reaction generating
biotin-labeled antisense cRNA (BioArrayTM High Yield RNA
Transcript Labeling kit; Enzo Diagnostics, Farmingdale, NY).
JOURNAL OF BIOLOGICAL CHEMISTRY 1027
 Supplemental Material can be found at:
http://www.jbc.org/content/suppl/2008/01/11/M707224200.DC1.html
miR-21 Targets PDCD4 in Human Breast Cancer Cells
A B
FIGURE 1. miR-21 inhibition reduces proliferation. A, MCF-7 cells transfected with increasing amounts of
LNA-miR-21 exhibit a dose-dependent reduction in cellular proliferation. This effect is specific to miR-21
because it is not observed for a scrambled control LNA (B). Data are shown as the mean ⫾ S.D. of three
replicates and are representative of three independent experiments.
After fragmentation at 94 °C for 35 min in 40 mM Tris, 30 mM
MgOAc, 10 mM KOAc, samples were hybridized for 16 h to
Affymetrix HG-U133 2.0 human arrays (Affymetrix, Santa
Clara, CA). The arrays were washed and stained with phyco-
erythrin-conjugated streptavidin (SAPE), and the arrays were
scanned in the Affymetrix GeneArray威 2500 scanner, exactly as
described in the Affymetrix GeneChip威 protocol.
Bioinformatic Analyses—The expression data were processed
using the “affy” package in BioConductor. Probe set intensities
were summarized using the Robust Multichip Average method
and then transformed to generalized log values (approaches the
natural logarithm for high values) with the variance stable VSN
method (35). In a final step, the six arrays were qspline-normalized.
Differentially expressed genes were selected by a t test (p ⬍
0.05), and two sets of probe sets were defined, the up and down-
regulated, by additionally requiring reasonable average ex-
pression intensities (⬎2.87, 1st quartile) and high -fold
changes (⬎ ⫾ 0.168, mean ⫾ 2 ⫻ S.D.) (supplemental Table
S1, a and b). A third set of probe sets that do not change from
control to experiment was defined by selecting probe sets
with stable expression intensities (p ⬎ 0.95 and expression
intensity S.D. ⬍ 0.06) and reasonable expression (⬎2.87)
(supplemental Table S1c). The up, down, and no-change sets
comprised 339, 258, and 195 probe sets, respectively.
The probe sets were subsequently mapped to Ensembl tran-
scripts (version 45) using the mappings provided at BioMart.
Probe sets that mapped to two different Ensembl genes were
discarded. Transcripts with 3⬘-UTR sequences shorter than 50
nucleotides and copies of transcript isoforms of the same gene
with matching 3⬘-UTR sequences were discarded. The up,
down, and no-change sets comprised 402, 335, and 262 tran-
scripts, corresponding to 272, 215, and 164 genes. For the anal-
ysis of seed site enrichment, miRNA sequences from miRBase
version 9.2 were used (36). The 3⬘-UTRs of the transcripts were
scanned for matching 6-, 7-1A, 7-, and 8-mer (perfect 8-nucle-
otide match) miRNA seed sites (37). In the definition used, seed
sites are contained in each other, that is, a given 6-mer site
always also corresponds to a 7 mer and 8 mer. Note that this
definition is different from the seed sites reported at TargetScan.
The difference in the fraction of transcripts having seed sites in
the up, down, and no-change sets was evaluated using one-
1028 JOURNAL OF BIOLOGICAL CHEMISTRY
sided p values from Fisher’s exact
test. When comparing all miRBase
miRNAs, the -fold enrichment for a
given miRNA is calculated by divid-
ing the fraction of transcripts with a
7-mer seed site in the up set with the
same fraction in the down (or no-
change) set.
In an unbiased word analysis, all
words of length 7 were investigated
for over-representation in the up
versus the down sets. The words
were ranked by p values from Fish-
ers exact test.
RESULTS
Suppression of MCF-7 Cell
Growth by Inhibition of miR-21—Several studies have demon-
strated that miR-21 is an oncogenic miRNA with anti-apoptotic
Downloaded from www.jbc.org by guest, on September 28, 2010
potential. Inhibition of miR-21 leads to growth suppression and
apoptosis in glioblastoma and breast cancer cell lines, and loss
of miR-21 can inhibit MCF-7 cell-derived tumor growth in vivo
(30, 31, 33). MCF-7 cells express substantial amounts of miR-21
(supplemental Fig. S1), and consistent with previous findings,
we observed a dose-dependent suppression of MCF-7 cell
growth upon inhibition of miR-21 with an LNA-derived oligo-
nucleotide inhibitor (Fig. 1A). Co-transfection of the LNA
inhibitor with a luciferase reporter containing perfect comple-
mentarity to the mature miR-21 sequence (pmiR-21-luc)
results in marked de-repression of luciferase activity, demon-
strating a highly effective inhibition of endogenous miR-21
mediated by the LNA inhibitor (supplemental Fig. S2). The
underlying mechanism of the role of miR-21 in tumorigenesis
remains unclear, as only few targets for this miRNA have been
experimentally verified (11, 32). Meng et al. (11) have recently
shown that the tumor suppressor PTEN is a direct functional
target of miR-21 in human hepatocellular cancer cell lines.
Given the importance of PTEN in regulating the PI3K/AKT
pathway and the frequency of PTEN mutations or silencing in a
variety of cancers (38), this constitutes an appealing explana-
tion for the overexpression of miR-21 observed in many cancer
types (27, 28). To investigate the role of the PTEN-miR-21
interaction in breast cancer cells, we transfected MCF-7 cells
with a miR-21 precursor, a miR-21 inhibitor, and appropriate
controls. Interestingly, these treatments caused only subtle
changes in PTEN protein levels (supplemental Fig. S3), suggest-
ing that cell- and tissue type-specific differences may result in
different functional miR-21 targets.
Identification and Validation of miR-21 Targets by Microar-
ray Analysis—To identify targets of miR-21 that can explain the
proliferation defect observed upon miR-21 inhibition in breast
cancers cells, we performed microarray expression analyses
using total RNA harvested from MCF-7 cells 24 h after trans-
fection with either LNA-miR-21 or a scrambled control LNA
not affecting cellular proliferation (Fig. 1B). We reasoned that
cellular mRNAs subjected to increased degradation due to
binding of endogenous miR-21 would be up-regulated upon
miR-21 inhibition and that specific inhibition of the endoge-
VOLUME 283 • NUMBER 2 • JANUARY 11, 2008
 Supplemental Material can be found at:
http://www.jbc.org/content/suppl/2008/01/11/M707224200.DC1.html

miR-21 Targets PDCD4 in Human Breast Cancer Cells

one miR-21 7-mer seed match, two
contained a 6-mer, and six did not
contain miR-21 seed matches in
their 3⬘-UTR. All 18 genes showed,
to varying degrees, increased mRNA
expression levels upon miR-21 inhi-
bition (Fig. 2B). It is unclear whether
the mRNAs without matches to the
miR-21 seed sequence are direct
targets or whether their regulation
is a result of secondary effects.
To get a qualitative assessment of
the data, we analyzed for the pres-
ence of different types of miR-21
seed matches among the genes reg-
ulated by miR-21 inhibition. Nota-
bly, we found very significant over-
representations of all miR-21 seed
match categories among the genes

Downloaded from www.jbc.org by guest, on September 28, 2010

up-regulated by miR-21 inhibition
relative to gene sets that exhibited
no change or down-regulated ex-
pression, strongly suggesting that
inhibition of endogenous miRNAs
can be used to identify bona fide tar-
gets (Fig. 2C). In effect, the motif
complementary to a 7-mer miR-21
seed sequence (or miR-590, holding
the exact same seed sequence) is
by far the most prevalent motif
when analyzing the 3⬘-UTRs of the
up-regulated transcripts against
all seed sequences present in
miRBase (36) (Fig. 2D). In addi-
tion, an unbiased analysis for the
frequency of all possible 7-mer
sequence motifs, regardless of
FIGURE 2. Identification of miR-21 targets. A, cluster heat map of Affymetrix microarray analyses of six whether these match known mi-
independent biological samples showing the 402 transcripts significantly up-regulated by miR-21 inhibition in
red and the 335 significantly down-regulated transcripts in blue. B, quantitative reverse transcription PCR RNAs, shows that the miR-21
validation of 18 up-regulated transcripts from an independent transfection experiment. CDKN1A, FAS, FAM3C, complementary motif is very
HIPK3, PRRG4, and ACTA2 do not contain matches to the miR-21 seed region, BTG2 and SESN1 contain a 6-mer highly enriched (p ⬍ 4 ⫻ 10⫺12)
seed match, and the remaining mRNAs harbor at least one 7-mer seed match. For each transcript the values are
normalized to the LNA-scrambled control samples, and error bars represent ⫾ S.D. of three replicates. C, the and represents the most fre-
relative fraction of transcripts among the up-, down-, or non-regulated transcripts containing the indicated quently occurring sequence motif
type of seed match. ***, one-tailed p values from Fisher’s exact test are: 6-mer up versus no-change, p ⬍ 1 ⫻
10⫺13; 7-mer-1A up versus no-change, p ⬍ 1.5 ⫻ 10⫺12; 7-mer up versus no change, p ⬍ 6.1 ⫻ 10⫺16; 8-mer up in the 3⬘-UTRs of the up-regulated
versus down, p ⬍ 9.6 ⫻ 10⫺6. D, frequency distribution of 7-mer seed matches for all miRNAs in miRBase versus the down-regulated tran-
showing a marked over-representation of the miR-21 seed match in the up- versus down-regulated genes. scripts. Hence, the data strongly
miR-590 and miR-21 have identical seed sequences.
suggest that expression array anal-
ysis following inhibition of endog-
nous miR-21 may cause fewer off-target effects than transfec- enous miRNAs is a strong tool to identify miRNA targets
tion with exogenous miRNA. Following normalization and sta- subjected to increased mRNA degradation.
tistical analysis we found 737 transcripts with significantly Potential Involvement of p53 in the miR-21 Pathway—
different expression between the LNA-miR-21-transfected Among the transcripts up-regulated upon miR-21 inhibition
cells and the controls, of which 402 (55%) were up-regulated we noticed the presence of several mRNAs known to be regu-
and 335 (45%) down-regulated upon miR-21 inhibition (Fig. 2A lated by the p53 tumor suppressor, including FAM3C, ACTA2,
and supplemental Table S1). To verify the array analysis, 18 APAF1, BTG2, FAS, CDKN1A (p21), and SESN1. We validated
up-regulated mRNAs were validated by quantitative reverse the up-regulation of these p53-regulated mRNAs by quantita-
transcription PCR analysis of RNA from an independent exper- tive reverse transcription PCR (Fig. 2B). A connection between
iment. Ten of the genes chosen for validation contained at least miR-21 and p53 was further substantiated using the Ingenuity

JANUARY 11, 2008 • VOLUME 283 • NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 1029
 Supplemental Material can be found at:
http://www.jbc.org/content/suppl/2008/01/11/M707224200.DC1.html

miR-21 Targets PDCD4 in Human Breast Cancer Cells

A B p < 0.001 in luciferase expression upon LNA-
120
miR-21 treatment relative to scram-
bled LNA (p ⬍ 0.001), suggesting
100 that additional mechanisms control
MCF-7 shp53

the expression of the remaining

MCF-7 EV

constructs (Fig. 4B).

Relative cell number

80
To investigate miR-21 regulation
of endogenous target proteins, three
LNA scramble
60 targets for which functional anti-
LNA miR-21
p53 bodies could be obtained were con-
40 firmed by Western blot analysis.
Upon transfection with the miR-21
Vinculin precursor, PDCD4, CDK6, and cofi-
20 lin 2 protein levels were all reduced
relative to the lin-4 control. In addi-
0 tion, miR-21 inhibition led to a cor-
MCF-7 EV MCF-7 shp53 responding increase in endogenous
FIGURE 3. Linking miR-21 to the p53 pathway. A, Western blot analysis shows significantly reduced p53 protein levels relative to the effect of
protein levels in MCF-7 shp53 relative to MCF-7 cells transduced with an empty control vector, MCF-7 EV. the scrambled control (Fig. 4C).

Downloaded from www.jbc.org by guest, on September 28, 2010

B, growth assay in MCF-7 shp53 and MCF-7 EV cells transfected with a miR-21 inhibitory LNA or a scrambled
control LNA. Cell number was quantified 5 days after transfection. Data are shown as the mean ⫾ S.D. of three Depletion of PDCD4 Abrogates
replicates. The p value was calculated using a two-tailed t test. the LNA-miR-21-mediated Pheno-
type in MCF-7 Cells—PDCD4 is a
Systems威 pathway analysis program (data not shown). Given tumor suppressor known to be up-regulated during apoptosis
the pivotal importance of p53 in protecting cells from cancer- (40) and down-regulated in several cancer forms (41– 43). The
promoting events such as genomic instability and aberrant predicted interaction between the PDCD4 3⬘-UTR and miR-21
oncogene activation (39) and the high frequency of miR-21 is illustrated in Fig. 5A. To further substantiate a direct regula-
overexpression found in a broad variety of tumors, we specu- tion of pGL3-PDCD4 by miR-21 we introduced a single (pGL3-
lated that pathways affected by miR-21 and p53 could be inter- PDCD4MUT1) or double (pGL3-PDCD4MUT2) point muta-
connected. To address the importance of p53 in mediating the tion in the seed sequence of pGL3-PDCD4. Whereas miR-21
proliferation effects observed upon miR-21 inhibition, we caused only a slight regulation of pGL3-PDCD4MUT1, pGL3-
developed a stable p53 knockdown cell line (MCF-7 shp53) by PDCD4MUT2 remained unaffected by miR-21, suggesting a
retroviral transduction with a pRetroSuper short hairpin RNA direct interaction between miR-21 and PDCD4 mediated
construct directed against p53 (Fig. 3A). We did not observe through the seed region (Fig. 5B). Given the evidence presented
any difference in the proliferative capacity of MCF-7 shp53 rel- above of PDCD4 regulation by miR-21 at both the RNA and the
ative to MCF-7 EV (not shown). Importantly, the MCF-7 shp53 protein levels and considering the reported tumor suppressor
cells were significantly less sensitive to the growth inhibitory activity of PDCD4, we speculated that PDCD4 could be a func-
effect of LNA-miR-21 (p ⬍ 0.001), relative to control MCF-7 tionally important target of miR-21. To investigate the biolog-
cells transduced with an empty vector (Fig. 3B). Although we ical importance of PDCD4 as a target of miR-21, we depleted
did not observe a significant change in p53 protein levels MCF-7 cells of PDCD4 protein by siRNA and assayed the effect
following miR-21 inhibition or overexpression (supplemen- of miR-21 inhibition (Fig. 5, C and D). Although PDCD4 deple-
tal Fig. S4), the data suggest that miR-21 antagonizes the p53 tion itself had no effect on cellular proliferation (supplemental
pathway by inhibiting expression of p53-regulated genes, Fig. S5), it significantly alleviated the anti-proliferative effect of
demonstrating an important functional link between these miR-21 inhibition from 58 to 87% of control levels (p ⬍ 0.003)
two signaling pathways. (Fig. 5D). The data therefore suggest an essential role for
Putative Targets Are Directly Regulated by miR-21—To sub- PDCD4 as a mediator of the biological effects of miR-21 in
stantiate that miR-21 is a direct regulator of the up-regulated breast cancer cells.
transcripts, we selected six target genes containing potential
miR-21 binding sites within their 3⬘-UTRs for further valida- DISCUSSION
tion by luciferase reporter assays. 400 –500-base pair fragments Over the past few years the vast potential of miRNAs as reg-
of the 3⬘-UTRs were cloned into a modified pGL3 vector, ulators of cancer-related signaling pathways has fully emerged
downstream of the luciferase gene. Upon co-transfection in (10, 14). Understanding the connections between miRNAs
HEK293 cells, miR-21 significantly repressed the expression of deregulated in cancer and cellular signaling pathways involved
all six constructs relative to a lin-4 control (p ⬍ 0.001) (Fig. 4A). in cancer has been hampered by our limited knowledge of
The empty pGL3 vector was not significantly affected by miR- miRNA target recognition. Although several studies have dem-
21, highlighting the importance of the 3⬘-UTR regions in medi- onstrated a central role of the miRNA seed region in target
ating this regulation. In addition, we tested the effect of the binding (13, 37), additional binding requirements and con-
miR-21 inhibitor on all constructs in MCF-7 cells. Only one of straints likely exist. In addition, studies have reported func-
the six constructs, pGL3-PDCD4, showed a significant increase tional miRNA binding without perfect complementarity to the

1030 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 2 • JANUARY 11, 2008
 Supplemental Material can be found at:
http://www.jbc.org/content/suppl/2008/01/11/M707224200.DC1.html

miR-21 Targets PDCD4 in Human Breast Cancer Cells

miR-21 precursor
A 1,5 C

lin-4 precursor

LNA scramble
*** *** *** *** *** ***

LNA miR-21
Luciferase/Renilla ratio
relative to control

1,0

0,5
PDCD4

62 100 344 100

0,0
Vinculin
BM + m RII

-4

SO + m S-5
I I 21

-4

PD + m D 4
2
p G mi R 3

-4
CD miR 6

L3 + -6R
1
-4

-4
-4

R -2 1
L3 -21

1
-4
1

4 21
G
+ GL

L3 + DK
G -2

K 6 -2

S- -2
lin

lin

lin

lin
lin

lin
PR iR-

lin
pG G2 BT

L3 4 DC
P

C iR-

L3 -5 OC
BT miR

C iR
IL miR
pG -6R IL
p

pG K6 C
pG PR BM

+
+

+
+

+
IL GL3

pG CD P
3

pG CS S
2

5
BT L

CD GL
L3 +

D
BM L 3

-6

3
G

PD GL
L3 I I

SO L
L3

L3 p
L3 p

L3 p
L3 pG

pG
p
pG

L3
pG
pG

L3
pG
pG

pG
CDK6

pG
B 2,5
*** 44 100 124 100
Luciferase/Renilla ratio

2,0
Vinculin
relative to control

1,5

Downloaded from www.jbc.org by guest, on September 28, 2010

1,0

Cofilin 2
0,5

41 100 123 100

0,0
II 1 L I

NA

5
NA
A

A
NA
sc A

sc A

C R-2 D4
G 21 2
L3 21 3

A
K6 -21 6

sc A
IL iR- -6R
PR -2 RI

A
sc A

sc A
sc A
sc A

C iR-2 S-
Vinculin
BT iR- TG
pG iR- GL

CD iR DK
N

N
N

+ LN
+ LN

N
N
+ LN
N

N
+ LN
rL

rL

rL

PD mi DC
BM mi MP
rL

rL
rL

5 1L
rL

C
4 1L
IL
L3 m 3 B
p

L3 + m 3 C

O
-6 21
3

P
L3 I I + 3 B

L 3 -5 + 3 S
pG R + GL
pG 2 GL

L3
R

+
+
pG
pG PR GL

pG CS GL
2

L3 m
p

R
m

SO m
G p

C pG

S-
D
p

+
+

p
L3 +
L3

4
pG 6

pG D
K

-6
pG

BT

CD

IL
BM

PD

SO
L3
L3

L3
L3

L3
pG
pG

L3
pG
pG

pG

pG

FIGURE 4. Validation of miR-21 targets. A, firefly luciferase reporter assays with constructs holding 3⬘-UTR sequences from the indicated genes were
cotransfected into HEK293 cells along with a Renilla luciferase transfection control plasmid either alone or together with miR-21 or lin-4 precursor
miRNAs. Shown are relative luciferase values normalized to transfections without miRNA. Data are shown as the mean ⫾ S.D. of four replicates and are
representative of four independent experiments. ***, p ⬍ 0.001 using a two-tailed t test. B, constructs as in panel A transfected into MCF-7 cells either
alone or together with a miR-21 inhibitor or a scrambled control. Data are shown as the mean ⫾ S.D. of four replicates and are representative of four
independent experiments. ***, p ⬍ 0.001 using a two-tailed t test. C, Western blot analysis of MCF-7 cells transfected with miR-21 or lin-4 precursors or
inhibitory miR-21 or scrambled LNAs. The bands were quantified relative to the appropriate vinculin loading controls using a LAS-3000 imager (Fuji), and
the relative quantifications are shown.

seed region (44, 45). Hence, there is a need for experimental
approaches to target identification in order to gain knowledge
of the mechanisms and modalities of miRNA target recogni-
tion. A number of studies have identified putative miRNA tar-
gets by microarray analysis of total RNA following transfections
with miRNA duplexes (7, 37, 46). Reasoning that high concen-
trations of exogenous miRNAs could lead to the identification
of false positives, especially in cells where the miRNA is not
highly expressed, we took the opposite approach and inhibited
an endogenous miRNA to relieve mRNA targets from the
increased degradation observed for some mRNAs upon
miRNA binding (7, 9, 47). A similar approach was previously
used by Stoffel and coworkers (48) to identify targets of miR-
122 in the mouse liver. Although microarray analysis following
miRNA inhibition or overexpression is a relatively simple and
robust method for target identification, this approach can, per
definition, not identify mRNAs subjected exclusively to trans-
lational repression (49, 50). Therefore, the development of new
genome-wide methodologies is urgently needed to unravel the
true importance of miRNA regulation.
Given the indications that miR-21 acts as an oncogene in a
variety of tumor types, and the limited knowledge of miR-21
targets, our aim was to identify functionally relevant miR-21
targets in MCF-7 breast cancer cells. Bioinformatics analyses
demonstrate a very significant over-representation of miR-21
complementary motifs among the transcripts up-regulated by
miR-21 inhibition, demonstrating the validity of the experi-
mental approach. We subsequently verified a direct responsive-
ness to miR-21 for a subset of the putative target mRNAs in
heterologous reporter assays. Interestingly, among the six
3⬘-UTR sequences tested in luciferase assays, only the PDCD4
sequence responded to miR-21 inhibition.
The tumor suppressor PDCD4 was originally characterized
as an inhibitor of cellular transformation in a mouse cell culture
model (51). PDCD4 expression is down-regulated or lost in
several tumor types (52, 53), and ectopic expression of Pdcd4
reduces tumor formation in a mouse skin cancer model (54).
Consequently, PDCD4 has been indicated by several as a prom-
ising molecular target in cancer treatment (55–57). At the
molecular level, PDCD4 binds and inhibits the translation ini-
tiation factor eukaryotic initiation factor 4a, thereby impacting
on protein translation (58, 59). In addition, PDCD4 has been
found to inhibit AP-1-mediated trans-activation (51) and to
induce expression of the cyclin-dependent kinase inhibitor p21

JANUARY 11, 2008 • VOLUME 283 • NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 1031
 Supplemental Material can be found at:
http://www.jbc.org/content/suppl/2008/01/11/M707224200.DC1.html

miR-21 Targets PDCD4 in Human Breast Cancer Cells

A B
1,4

1,2 ***
GUGGAAUAU - - - UCUAAUAAGCUA Position 224-248 of PDCD4 3’UTR

Luciferase/Renilla ratio
1

relative to control
AGUUGUAGUCAGACUAUUCGAU hsa-miR-21 0,8

0,6

0,4

0,2

-4

-4
T1

T2
1

1
-4
1
D

-2

-2
-2

lin

lin
lin

U
C

iR

iR
iR

4M

4M
PD

+
+

m
m

T1

T2
4

D
+

+
L3

C
U

U
C

2
pG D4

PD

PD
pG

4M

4M
T

T
PD

U
C

D
L3

L3
pG D4M

M
PD

L3

C
pG D4
pG

pG
PD

PD
L3

C
PD

PD
pG

L3

L3
L3

L3
PDCD4 siRNA

Control siRNA

pG

pG
C D 120 p < 0.003

Downloaded from www.jbc.org by guest, on September 28, 2010

100

80
% Viable cells
PDCD4
60 LNA scramble
LNA miR-21

40
Vinculin
20

0
Control siRNA PDCD4 siRNA

FIGURE 5. PDCD4 is an important functional target of miR-21. A, potential binding pattern of miR-21 to the 3⬘-UTR of PDCD4. B, firefly luciferase reporter assay
with pGL3-PDCD4, pGL3-PDCD4MUT1, and pGL3-PDCD4MUT2 co-transfected into HEK cells with a Renilla luciferase transfection control plasmid, either alone
or together with miR-21 or lin-4 precursor miRNAs. Shown are relative luciferase values normalized to transfections without miRNA. Data are shown as the
mean ⫾ S.D. of four replicates and are representative of two independent experiments. ***, p ⬍ 0.001 using a two-tailed t test. C, verification of PDCD4 knock
down in MCF-7 cells by Western analysis. D, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide growth assay in MCF-7 cells treated with PDCD4 or
control siRNAs and transfected with inhibitors against miR-21 or a scrambled control. Cell number was quantified 5 days after transfection. Data are shown as
the mean ⫾ S.D. of three replicates and are representative of three independent experiments. The p value was calculated using a two-tailed t test.

(53). As a result, loss of PDCD4 confers growth advantages to
the cells by several means and thereby facilitates the develop-
ment of cancer.
We demonstrate here that PDCD4 is directly regulated by
the “oncomiR” miR-21. This is evident at the level of PDCD4
mRNA as well as protein where endogenous PDCD4 protein
level is ⬃3.5-fold up-regulated by miR-21 inhibition. Impor-
tantly, depletion of PDCD4 by siRNA transfection partly res-
cues the reduced cellular proliferation observed upon miR-21
inhibition in MCF-7 cells, demonstrating that PDCD4 is an
important functional target of miR-21 in this model.
A recent report demonstrated that the stability of PDCD4 is
controlled by the mTOR pathway since PDCD4 during mitogen
stimulation is phosphorylated by the S6K1 kinase, which marks
it for degradation by the proteasome (60). That miR-21 via
repression of PDCD4 affects the PI3K/AKT/mTOR pathway
downstream of mTOR in breast cancer cells is interesting, given
the evidence that miR-21 in hepatocellular carcinoma cells reg-
ulate the PI3K antagonist PTEN (11). Hence, in different cell
types miR-21 may target different negative regulators of the
PI3K/AKT/mTOR survival pathway. In addition, knock down
of the tumor suppressor protein p53 partly abrogated the pro-
liferation decrease observed in MCF-7 cells following inhibi-
tion of miR-21. This suggests a functional link between miR-21,
the miRNA most frequently found overexpressed in cancer
(27), and the tumor suppressor pathway most often found
mutated or otherwise obstructed in cancer (39). There is accu-
mulating evidence of extensive cross-talk between the p53 and
the PI3K/AKT/mTOR pathways (61), and our data may reflect
such cross-coordination between important anti-cancer
networks.
Acknowledgments—We thank Ulf Andersson Ørom for comments on
the manuscript and Dr. Iwata Ozaki for the PDCD4 antibody.
REFERENCES
1. Lee, R. C., Feinbaum, R. L., and Ambros, V. (1993) Cell 75, 843– 854
2. Lee, R. C., and Ambros, V. (2001) Science 294, 862– 864
3. Lau, N. C., Lim, L. P., Weinstein, E. G., and Bartel, D. P. (2001) Science 294,
858 – 862

1032 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 2 • JANUARY 11, 2008
 Supplemental Material can be found at:
http://www.jbc.org/content/suppl/2008/01/11/M707224200.DC1.html
miR-21 Targets PDCD4 in Human Breast Cancer Cells
4. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., and Tuschl, T. (2001)
Science 294, 853– 858
5. Pillai, R. S., Bhattacharyya, S. N., and Filipowicz, W. (2007) Trends Cell
Biol. 17, 118 –126
6. Nilsen, T. W. (2007) Trends Genet. 23, 243–249
7. Bagga, S., Bracht, J., Hunter, S., Massirer, K., Holtz, J., Eachus, R., and
Pasquinelli, A. E. (2005) Cell 122, 553–563
8. Jackson, R. J., and Standart, N. (2007) Sci. STKE 2007, re1
9. Wu, L., Fan, J., and Belasco, J. G. (2006) Proc. Natl. Acad. Sci. U. S. A. 103,
4034 – 4039
10. Kloosterman, W. P., and Plasterk, R. H. (2006) Dev. Cell 11, 441– 450
11. Meng, F., Henson, R., Wehbe-Janek, H., Ghoshal, K., Jacob, S. T., and
Patel, T. (2007) Gastroenterology 133, 647– 658
12. Jovanovic, M., and Hengartner, M. O. (2006) Oncogene 25, 6176 – 6187
13. Lu, J., Getz, G., Miska, E. A., Alvarez-Saavedra, E., Lamb, J., Peck, D.,
Sweet-Cordero, A., Ebert, B. L., Mak, R. H., Ferrando, A. A., Downing, J. R.,
Jacks, T., Horvitz, H. R., and Golub, T. R. (2005) Nature 435, 834 – 838
14. Esquela-Kerscher, A., and Slack, F. J. (2006) Nat. Rev. Cancer 6,
259 –269
15. Calin, G. A., and Croce, C. M. (2006) Nat. Rev. Cancer 6, 857– 866
16. Calin, G. A., and Croce, C. M. (2007) J. Clin. Investig. 117, 2059 –2066
17. Sevignani, C., Calin, G. A., Nnadi, S. C., Shimizu, M., Davuluri, R. V.,
Hyslop, T., Demant, P., Croce, C. M., and Siracusa, L. D. (2007) Proc. Natl.
Acad. Sci. U. S. A. 104, 8017– 8022
18. Welch, C., Chen, Y., and Stallings, R. L. (2007) Oncogene 26, 5017–5022
19. Calin, G. A., Dumitru, C. D., Shimizu, M., Bichi, R., Zupo, S., Noch, E.,
Aldler, H., Rattan, S., Keating, M., Rai, K., Rassenti, L., Kipps, T., Negrini,
M., Bullrich, F., and Croce, C. M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99,
15524 –15529
20. Tarasov, V., Jung, P., Verdoodt, B., Lodygin, D., Epanchintsev, A.,
Menssen, A., Meister, G., and Hermeking, H. (2007) Cell Cycle 6,
1586 –1593
21. Raver-Shapira, N., Marciano, E., Meiri, E., Spector, Y., Rosenfeld, N., Mos-
kovits, N., Bentwich, Z., and Oren, M. (2007) Mol. Cell 26, 731–743
22. Cimmino, A., Calin, G. A., Fabbri, M., Iorio, M. V., Ferracin, M., Shimizu,
M., Wojcik, S. E., Aqeilan, R. I., Zupo, S., Dono, M., Rassenti, L., Alder, H.,
Volinia, S., Liu, C. G., Kipps, T. J., Negrini, M., and Croce, C. M. (2005)
Proc. Natl. Acad. Sci. U. S. A. 102, 13944 –13949
23. Johnson, S. M., Grosshans, H., Shingara, J., Byrom, M., Jarvis, R., Cheng,
A., Labourier, E., Reinert, K. L., Brown, D., and Slack, F. J. (2005) Cell 120,
635– 647
24. He, L., Thomson, J. M., Hemann, M. T., Hernando-Monge, E., Mu, D.,
Goodson, S., Powers, S., Cordon-Cardo, C., Lowe, S. W., Hannon, G. J.,
and Hammond, S. M. (2005) Nature 435, 828 – 833
25. le Sage, C., Nagel, R., Egan, D. A., Schrier, M., Mesman, E., Mangiola, A.,
Anile, C., Maira, G., Mercatelli, N., Ciafre, S. A., Farace, M. G., and Agami,
R. (2007) EMBO J. 26, 3699 –3708
26. Voorhoeve, P. M., le Sage, C., Schrier, M., Gillis, A. J., Stoop, H., Nagel, R.,
Liu, Y. P., van Duijse, J., Drost, J., Griekspoor, A., Zlotorynski, E., Yabuta,
N., De Vita, G., Nojima, H., Looijenga, L. H., and Agami, R. (2006) Cell
124, 1169 –1181
27. Volinia, S., Calin, G. A., Liu, C. G., Ambs, S., Cimmino, A., Petrocca, F.,
Visone, R., Iorio, M., Roldo, C., Ferracin, M., Prueitt, R. L., Yanaihara, N.,
Lanza, G., Scarpa, A., Vecchione, A., Negrini, M., Harris, C. C., and Croce,
C. M. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 2257–2261
28. Roldo, C., Missiaglia, E., Hagan, J. P., Falconi, M., Capelli, P., Bersani, S.,
Calin, G. A., Volinia, S., Liu, C. G., Scarpa, A., and Croce, C. M. (2006)
J. Clin. Oncol. 24, 4677– 4684
29. Iorio, M. V., Ferracin, M., Liu, C. G., Veronese, A., Spizzo, R., Sabbioni, S.,
Magri, E., Pedriali, M., Fabbri, M., Campiglio, M., Menard, S., Palazzo, J. P.,
Rosenberg, A., Musiani, P., Volinia, S., Nenci, I., Calin, G. A., Querzoli, P.,
Negrini, M., and Croce, C. M. (2005) Cancer Res. 65, 7065–7070
30. Chan, J. A., Krichevsky, A. M., and Kosik, K. S. (2005) Cancer Res. 65,
6029 – 6033
JANUARY 11, 2008 • VOLUME 283 • NUMBER 2
31. Si, M. L., Zhu, S., Wu, H., Lu, Z., Wu, F., and Mo, Y. Y. (2007) Oncogene 26,
2799 –2803
32. Zhu, S., Si, M. L., Wu, H., and Mo, Y. Y. (2007) J. Biol. Chem. 282,
14328 –14336
33. Meng, F., Henson, R., Lang, M., Wehbe, H., Maheshwari, S., Mendell, J. T.,
Jiang, J., Schmittgen, T. D., and Patel, T. (2006) Gastroenterology 130,
2113–2129
34. Brummelkamp, T. R., Bernards, R., and Agami, R. (2002) Science 296,
550 –553
35. Huber, W., von Heydebreck, A., Sultmann, H., Poustka, A., and Vingron,
M. (2002) Bioinformatics 18, Suppl. 1, S96 –S104
36. Griffiths-Jones, S. (2006) Methods Mol. Biol. 342, 129 –138
37. Grimson, A., Farh, K. K., Johnston, W. K., Garrett-Engele, P., Lim, L. P.,
and Bartel, D. P. (2007) Mol. Cell 27, 91–105
38. Chow, L. M., and Baker, S. J. (2006) Cancer Lett. 241, 184 –196
39. Vousden, K. H., and Lane, D. P. (2007) Nat. Rev. Mol. Cell. Biol. 8, 275–283
40. Yang, H. S., Knies, J. L., Stark, C., and Colburn, N. H. (2003) Oncogene 22,
3712–3720
41. Chen, Y., Knosel, T., Kristiansen, G., Pietas, A., Garber, M. E., Matsuhashi,
S., Ozaki, I., and Petersen, I. (2003) J. Pathol. 200, 640 – 646
42. Gao, F., Zhang, P., Zhou, C., Li, J., Wang, Q., Zhu, F., Ma, C., Sun, W., and
Zhang, L. (2007) Oncol. Rep. 17, 123–128
Downloaded from www.jbc.org by guest, on September 28, 2010
43. Zhang, H., Ozaki, I., Mizuta, T., Hamajima, H., Yasutake, T., Eguchi, Y.,
Ideguchi, H., Yamamoto, K., and Matsuhashi, S. (2006) Oncogene 25,
6101– 6112
44. Jing, Q., Huang, S., Guth, S., Zarubin, T., Motoyama, A., Chen, J., Di
Padova, F., Lin, S. C., Gram, H., and Han, J. (2005) Cell 120, 623– 634
45. Brennecke, J., Stark, A., Russell, R. B., and Cohen, S. M. (2005) PLoS Biol. 3,
e85
46. Lim, L. P., Lau, N. C., Garrett-Engele, P., Grimson, A., Schelter, J. M.,
Castle, J., Bartel, D. P., Linsley, P. S., and Johnson, J. M. (2005) Nature 433,
769 –773
47. Christoffersen, N. R., Silahtaroglu, A., Orom, U. A., Kauppinen, S., and
Lund, A. H. (2007) RNA (N. Y.) 13, 1172–1178
48. Krutzfeldt, J., Rajewsky, N., Braich, R., Rajeev, K. G., Tuschl, T., Manoha-
ran, M., and Stoffel, M. (2005) Nature 438, 685– 689
49. Humphreys, D. T., Westman, B. J., Martin, D. I., and Preiss, T. (2005) Proc.
Natl. Acad. Sci. U. S. A. 102, 16961–16966
50. Bhattacharyya, S. N., Habermacher, R., Martine, U., Closs, E. I., and Filip-
owicz, W. (2006) Cell 125, 1111–1124
51. Yang, H. S., Jansen, A. P., Nair, R., Shibahara, K., Verma, A. K., Cmarik,
J. L., and Colburn, N. H. (2001) Oncogene 20, 669 – 676
52. Jansen, A. P., Camalier, C. E., Stark, C., and Colburn, N. H. (2004) Mol.
Cancer Ther. 3, 103–110
53. Goke, R., Barth, P., Schmidt, A., Samans, B., and Lankat-Buttgereit, B.
(2004) Am. J. Physiol. 287, C1541–C1546
54. Jansen, A. P., Camalier, C. E., and Colburn, N. H. (2005) Cancer Res. 65,
6034 – 6041
55. Young, M. R., Yang, H. S., and Colburn, N. H. (2003) Trends Mol. Med. 9,
36 – 41
56. Hwang, S. K., Jin, H., Kwon, J. T., Chang, S. H., Kim, T. H., Cho, C. S., Lee,
K. H., Young, M. R., Colburn, N. H., Beck, G. R., Jr., Yang, H. S., and Cho,
M. H. (2007) Gene Ther. 14, 1353–1361
57. Lankat-Buttgereit, B., and Goke, R. (2003) Biol. Cell 95, 515–519
58. Goke, A., Goke, R., Knolle, A., Trusheim, H., Schmidt, H., Wilmen, A.,
Carmody, R., Goke, B., and Chen, Y. H. (2002) Biochem. Biophys. Res.
Commun. 297, 78 – 82
59. Yang, H. S., Jansen, A. P., Komar, A. A., Zheng, X., Merrick, W. C., Costes,
S., Lockett, S. J., Sonenberg, N., and Colburn, N. H. (2003) Mol. Cell. Biol.
23, 26 –37
60. Dorrello, N. V., Peschiaroli, A., Guardavaccaro, D., Colburn, N. H., Sher-
man, N. E., and Pagano, M. (2006) Science 314, 467– 471
61. Levine, A. J., Feng, Z., Mak, T. W., You, H., and Jin, S. (2006) Genes Dev. 20,
267–275
JOURNAL OF BIOLOGICAL CHEMISTRY 1033