Anda di halaman 1dari 3

Primer3 Output

WARNING: Numbers in input sequence were deleted.

PRIMER PICKING RESULTS FOR

Template masking not selected


No mispriming library specified
Using 1-based sequence positions
OLIGO start len tm gc% any_th 3'_th hairpin seq
LEFT PRIMER 139 20 58.93 50.00 0.00 0.00 0.00 agaaactgggcatgtggaga
RIGHT PRIMER 595 20 58.08 50.00 0.00 0.00 0.00 acgatcctgagacttccaca
SEQUENCE SIZE: 1440
INCLUDED REGION SIZE: 1440

PRODUCT SIZE: 457, PAIR ANY_TH COMPL: 0.00, PAIR 3'_TH COMPL: 0.00

1 gacaccatggtgcacctgactcctgaggagaagtctgccgttactgccctgtggggcaag

61 gtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggttacaagac

121 aggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttct
>>>>>>>>>>>>>>>>>>>>

181 gataggcactgactctctctgcctattggtctattttcccacccttaggctgctggtggt

241 ctacccttggacccagaggttctttgagtcctttggggatctgtccactcctgatgctgt

301 tatgggcaaccctaaggtgaaggctcatggcaagaaagtgctcggtgcctttagtgatgg

361 cctggctcacctggacaacctcaagggcacctttgccacactgagtgagctgcactgtga

421 caagctgcacgtggatcctgagaacttcagggtgagtctatgggacccttgatgttttct

481 ttccccttcttttctatggttaagttcatgtcataggaaggggagaagtaacagggtaca

541 gtttagaatgggaaacagacgaatgattgcatcagtgtggaagtctcaggatcgttttag
<<<<<<<<<<<<<<<<<<<<

601 tttcttttatttgctgttcataacaattgttttcttttgtttaattcttgctttcttttt

661 ttttcttctccgcaatttttactattatacttaatgccttaacattgtgtataacaaaag

721 gaaatatctctgagatacattaagtaacttaaaaaaaaactttacacagtctgcctagta

781 cattactatttggaatatatgtgtgcttatttgcatattcataatctccctactttattt

841 tcttttatttttaattgatacataatcattatacatatttatgggttaaagtgtaatgtt
901 ttaatatgtgtacacatattgaccaaatcagggtaattttgcatttgtaattttaaaaaa

961 tgctttcttcttttaatatacttttttgtttatcttatttctaatactttccctaatctc

1021 tttctttcagggcaataatgatacaatgtatcatgcctctttgcaccattctaaagaata

1081 acagtgataatttctgggttaaggcaatagcaatatttctgcatataaatatttctgcat

1141 ataaattgtaactgatgtaagaggtttcatattgctaatagcagctacaatccagctacc

1201 attctgcttttattttatggttgggataaggctggattattctgagtccaagctaggccc

1261 ttttgctaatcatgttcatacctcttatcttcctcccacagctcctgggcaacgtgctgg

1321 tctgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcaggctgcctatc

1381 agaaagtggtggctggtgtggctaatgccctggcccacaagtatcactaagctcgctttc

KEYS (in order of precedence):


>>>>>> left primer
<<<<<< right primer

ADDITIONAL OLIGOS
start len tm gc% any_th 3'_th hairpin seq

1 LEFT PRIMER 66 20 59.13 55.00 0.00 0.00 0.00cgtggatgaagttggtggtg


RIGHT PRIMER 537 21 58.73 52.38 0.00 0.00 0.00accctgttacttctccccttc
PRODUCT SIZE: 472, PAIR ANY_TH COMPL: 6.08, PAIR 3'_TH COMPL: 7.91

2 LEFT PRIMER 70 20 58.83 55.00 0.00 0.00 0.00 gatgaagttggtggtgaggc


RIGHT PRIMER 540 21 58.46 52.38 0.00 0.00 0.00tgtaccctgttacttctcccc
PRODUCT SIZE: 471, PAIR ANY_TH COMPL: 0.00, PAIR 3'_TH COMPL: 0.00

3 LEFT PRIMER 28 20 58.65 55.00 0.00 0.00 0.00 gagaagtctgccgttactgc


RIGHT PRIMER 486 22 58.76 45.45 0.00 0.00 0.00 ggggaaagaaaacatcaagggt
PRODUCT SIZE: 459, PAIR ANY_TH COMPL: 0.00, PAIR 3'_TH COMPL: 0.00

4 LEFT PRIMER 56 20 58.77 50.00 0.00 0.00 0.00 gcaaggtgaacgtggatgaa


RIGHT PRIMER 529 21 57.51 47.62 0.00 0.00 0.00 acttctccccttcctatgaca
PRODUCT SIZE: 474, PAIR ANY_TH COMPL: 0.00, PAIR 3'_TH COMPL: 0.00

Statistics
con too in in not no tm tm high high high high
sid many tar excl ok bad GC too too any_th 3'_th hair- poly end
ered Ns get reg reg GC% clamp low high compl compl pin X stab
ok
Left 5861 0 0 0 0 1838 0 1925 734 0 0 65 23 0
1276
Right 5861 0 0 0 0 2304 0 2341 421 0 0 24 24 0
747
Pair Stats:
considered 82870, unacceptable product size 82861, primer in pair overlaps a primer in a
better pair 2830, ok 9
libprimer3 release 2.4.0

(primer3_results.cgi release 4.1.0)