Anda di halaman 1dari 40

Critical JurnalRiview (CJR)

Mikrobiologi
Prodi Pendidikan Biologi

“Plastics: Environmental and Biotechnological Perspectives on Microbial Degradation” and


Generation of a Prophage-Free Variant of the Fast-Growing Bacterium Vibrio natriegens”

DISUSUN OLEH
KELOMPOK 6

MUTIARA TRI RAMADANI


NISA ASTRIANI SINAGA
NUR PUTRI ALIYAH

Kelas : Pendidikan Biologi D 2017

PROGRAM STUDI PENDIDIKAN BIOLOGI


FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM
UNIVERSITAS NEGERI MEDAN
MEDAN
2019
KATA PENGANTAR

Puji syukur kehadirat Tuhan yang maha kuasa, atas kasih dan karunia-Nya, sehingga
penulis dapat menyelesaikan tugas Crtitical Journal Review dengan judul: jurnal I
“Plastics: Environmental and Biotechnological Perspectives on Microbial
Degradation” dan Jurnal II “Generation of a Prophage-Free Variant of the Fast-
Growing Bacterium Vibrio natriegens”. Crtitical Journal Review ini bertujuan untuk
memenuhi tugas mata kuliah Mikrobiologi .

Penghargaan dan terimakasih yang setulus-tulusnya, penulis sampaikan kepada :


1. Bapak Dr. Hasruddin, M.Pd selaku Ketua Jurusan Biologi Universitas Negeri Medan
2. Bapak Wasis Wuyung Wisnu Brata, M.Pd selaku Ketua Program Studi Pendidikan
Biologi Universitas Negeri Medan
3. Ibu Dra. Uswatun Hasanah, M.Si selaku Dosen mata kuliah Mikrobiologi dan kedua
orangtua yang selalu mendukung dan memotivasi penulis untuk konsisten
menyelesaikan tugas kuliah
4. Seluruh teman-teman Kelas Pendidikan Biologi D 2017
Akhir kata penulis menyadari bahwa dalam penulisan makalah ini masih jauh dari
kesempurnaan. Karena itu, penulis memohon saran dan kritik yang sifatnya membangun
demi kesempurnaannya dan semoga bermanfaat bagi kita semua.

Medan, 23 September 2019

Kelompok 6
BAB I. PENDAHULUAN

A. Rasionalisasi Pentingnya Critical Journal Review (CJR)


Critical Journal Review (CJR) sangat penting buat kalangan pendidikan terutama buat
mahasiswa maupun mahasiswi karena dengan mengkritik suatu jurnal maka mahasiswa/i
ataupun si pengkritik dapat membandingkan dua jurnal dengan tema yang sama, dapat
melihat mana jurnal yang perlu diperbaiki dan mana jurnal yang sudah baik untuk
digunakan berdasarkan dari penelitian yang telah dilakukan oleh penulis jurnal tersebut,
setelah dapat mengkritik jurnal maka diharapkan mahasiswa/i dapat membuat suatu jurnal
karena sudah mengetahui bagaimana kriteria jurnal yang baik dan benar untuk digunakan
dan sudah mengerti bagaimana cara menulis atau langkah-langkah apa saja yang
diperlukan dalam penulisan jurnal tersebut.
B. Tujuan Penulisan Critical Journal Review (CJR)
Critical journal Review ini dibuat bertujuan untuk belajar melalui pemenuhan tugas mata
kuliah Mikrobiologi sehingga dapat menambah pengetahuan untuk melihat atau
membandingkan dua atau beberapa jurnal yang baik dan yang benar. Setelah dapat
membandingkan maka akan dapat membuat suatu jurnal karena sudah dapat
membandingkan mana jurnal yang sudah baik dan mana jurnal yang masih perlu
diperbaiki dan juga karena sudah mengerti langkah-langkah dari pembuatan suatu jurnal.
C. Manfaat Critical Journal Review (CJR)
Manfaat penulisan Critical Journal Review ( CJR), yaitu :
1. Dapat membandingkan dua atau lebih jurnal yang direview.
2. Dapat meningkatkan analisis kita terhadap suatu jurnal.
3. Dapat mengetahui teknik-teknik penulisan CJR yang benar.
4. Dapat menulis bagaimana jurnal yang baik dan benar.
5. Dapat menambah pengetahuan kita tentang isi-isi dari jurnal-jurnal penelitian.
6. Identitas Journal yang direview
1. Jurnal I
1. Judul Artikel : Plastics: Environmental and Biotechnological
Perspectives on Microbial Degradation
2. Nama Journal : Applied and Environmental Microbiology
3. e-ISSN : e01095-19
4. Pengarang artikel : Dominik Danso, Jnnifer Chow, Wlfgang R. Streita
5. Penerbit : Department of Microbiology and Biotechnology,
University of Hamburg
6. Kota terbit : Hamburg, Germany
7. Vol/ Ha l : Volume 85 Issue 19
8. Alamat Situs : (http://aem.asm.org/content/by/year)

2. Jurnal II
1. Judul Artikel : Generation of a Prophage-Free Variant of the
Fast-Growing Bacterium Vibrio natriegens
2. Nama Journal : Applied and Environmental Microbiology
3. e-ISSN : e00853-19

4. Pengarang artikel : Eugen Pfeifer,a Slawomir Michniewski,b Cornelia


Gätgens,a Eugenia Münch,d Felix Müller,d,e
Tino Polen,a Andrew Millard,cBastian Blombach,e
Julia Frunzkea

5. Penerbit : Department of Microbiology and Biotechnology,


University of Hamburg
6. Kota terbit : Hamburg, Germany
7. Vol/ Hal : Volume 85 Issue 17

8. Alamat Situs : (http://aem.asm.org/content/by/year)


BAB II. RINGKASAN ARTIKEL
A. JURNAL I
Altogether, synthetic polymers are produced worldwide at a scale of at least 350 to
400 million metric tons annually. The main polymers that are produced and of
importance to our economy are polyurethane (PUR), polyethylene (PE), polyamide
(PA), polyethylene terephthalate (PET), polystyrene (PS), polyvinylchloride (PVC), and
polypropylene (PP) . With an increasing production and use of plastics, it is estimated
that 5 to 13 million metric tons of plastic enter the ocean every year, with negative
consequences for various ecosystems and for the health of humans and animals (1–3).
Regarding only the Great Pacific Garbage Patch, more than 1.8 trillion pieces of
plastic with an estimated weight of 80,000 tons have so far accumulated, with no end in
sight (4–7). Therefore, the two main questions addressed in this review are as follows. (i)
Which enzymes and microorganisms are currently known to be involved in high-
molecular-weight polymer plastic degradation? (ii) What are the future challenges and
technologies for identifying better enzymes acting on a highly diverse range of
synthetic polymers?
Intriguingly, the currently best-known route of plastic destruction involves exposure
to UV light together with mechanical disruption caused by waves and winds or
grinding on marine rocks and sediments, which eventually breaks larger plastics into
smaller pieces of micro- and nanoplastics (MP, with sizes of 5 mm, and NP, with sizes
of 0.1 m). So-called “weathering” and “photodegradation” are currently considered the
main forces for initial depletion of plastics, and they mainly result in a modification of
the chemical, physical, and mechanical properties of the plastics (9, 10). The resulting
particles have a much larger surface area, which makes them amenable to further
degradation (11). Notably, MPs and NPs are a concern to our health, as it is expected that
they enter the food chain and end up in our intestines (12, 13). The fate of MPs or NPs in
human or animal intestines has yet to be determined.
Therefore, removal of plastics from the environment using microbial enzymes has
been a focus of recent research. The main challenge is that marine and terrestrial
displaced plastics are highly stable and durable. Plastics have mainly been introduced
since the 1960s and, given the relatively few decades since these human-made
polymers became available, nature has only had a very short time to evolve highly
active enzymes. Besides, many different types of plastics accumulate in the environ-
ment, and many of the frequently used plastics are mixtures containing additional
solubilizers and other chemical agents to alter the mechanical and physical properties.
These compounds are further targets for microbial biodegradation but may also
interfere with degradative enzyme activities. It is assumed that the larger polymers are
initially degraded by secreted exoenzymes into smaller subunits (multimers, dimers)
that can be incorporated into the microbial cells. Once in the cells, either the oligomers
or the degradation products of these are funneled through the classical degradation
pathways to yield energy and/or serve as building blocks for catabolism or
metabolism.
In general, it is believed that the microbial degradation of human-made polymers is a
very slow process. This high resistance mainly stems from the high molecular weight of
the fiber, the strong C-C bonds, and the extremely hydrophobic surface, which is very
difficult to attack by enzymes. Notably, polymers are high-molecular-weight molecules,
and they have amorphous and crystalline forms, which have different levels of degrad-
ability.

POLYMERS AND MICROBIAL DEGRADATION

Currently, only a few bacteria and fungi have been described for the partial
degradation of PET to oligomers or monomers (8). All known PET hydrolases have
relatively low turnover rates. Intriguingly, the trait for PET degradation appears to be
limited to a few bacterial phyla, and most bacterial isolates with the potential for PET
degradation are members of the Gram-positive phylum Actinobacteria (15). The best
characterized examples originate from the genera Thermobifida and Thermomonospora
(16–23). The enzymes involved in the degradation (e.g., PET hydrolase and tannase,
MHETase) are typical serine hydrolases, e.g., cutinases (EC 3.1.1.74), lipases (EC
3.1.1.3), and carboxylesterases (EC 3.1.1.1). These enzymes possess a typical / -
hydrolase fold, and the catalytic triad is composed of a serine, a histidine, and an aspartate
residue (18,24). They can also contain several disulfide bonds caused by cysteine
residues, which promote thermal stability and specific binding to PET, as shown by the
example of PETase from Ideonella sakaiensis 201-F6 (25).

Also, for the bacterium I. sakaiensis, usage of PET as a major energy and carbon
source has been described (25). In addition to the PET hydrolase, the I. sakaiensis
genome codes for a second enzyme that appears to be unique so far and which shares high
similarity to the group of tannases, capable of degrading mono(2-hydroxyethyl)
terephthalic acid. PET hydrolase as a secreted enzyme produces the intermediate
mono(2-hydroxyethyl) terephthalic acid (MHET). MHET is internalized by the cell and
hydrolyzed by MHETase. The resulting monomers are then used for bacterial metabo-
lism. I. sakaiensis is affiliated with the phylum Betaproteobacteria and belongs to the
order Burkholderiales.

The I. sakaiensis PETase three-dimensional (3D) structure was elucidated recently


(26). The overall structure most resembles the structures of cutinases. Austin et al.
showed that a double mutation (S238F/W159H), which narrows the active site of the
enzyme and makes the protein even more like a cutinase resembling the enzyme from
Thermobifida fusca, leads to an improved variant. The majority of the functionally
verified PET hydrolases contain a C-terminal disulfide bond, promoting thermal and
also kinetic stability (27–29). The only exception from this so far is a para-
nitrobenzylesterase from Bacillus subtilis (30). An additional disulfide bond can be found
in I. sakaiensis PETase, as well as in structural models of the functionally tested PET
hydrolases described by Danso et al. (31). The structural data indicate that PETases bind
the polymer with the hydrophobic surface and the substrate-binding cleft. In total, 4
MHET moieties are bound to the protein (one to subsite I and three to subsite II),
whereby the ester bond to be cleaved is located between both subsites next to the
catalytic serine. The MHETase from I. sakaiensis that further hydrolyzes MHET to
ethylene glycol and terephthalic acid has been recently crystallized ligand free (2.05 Å)
and with a nonhydrolyzable MHET analogue bound (2.1 Å). The enzyme possesses a
lid domain that almost exclusively confers substrate specificity and activity toward
MHET, with a kcat of 11.1 1.4 s 1 (32).

While the I. sakaiensis enzymes are the best-studied models, other enzymes and
organisms have been identified as potent PET degraders. Currently, four enzymes from
Thermobifida species, one from Saccharomonospora, and one from the phylum Ther-
momonospora are known to act on PET. These actinobacterial enzymes are often
Ca2 -dependent, especially in terms of their thermal stability (33), and they are partially
inhibited by their released hydrolysis products MHET and BHET (33). Therefore, efforts
have been made to overcome this limitation; one approach lies in the combination of
polyester hydrolases with other enzymes to improve substrate binding and catalytic
properties (26, 34, 35).
Using an in silico genome mining approach, a cutinase from Pseudomonas pseudo-
alcaligenes (PpCutA) and a putative lipase from Pseudomonas pelagia (PpelaLip) were
identified as potential enzymes acting on polyesters in general. Further experimental
work using recombinant enzymes of PpCutA and PpelaLip verified the hydrolytic
activities of both enzymes on different types of polyesters, including the hydrolysis of
polyoxyethylene terephthalate (36). In their study, the authors used structurally differ- ent
ionic phthalic acid-based polyesters with an average molecular weight ranging from
1,770 to 10,000 g/mol and semicrystalline polyesters with crystallinity below 1% to test
and verify the microbial degradation. Notably, the identified organism belongs to a
biotechnologically important novel species within the genus Pseudomonas, which was
designated Pseudomonas pertucinogena (37).

In addition to the metagenome-derived PET esterases described above, colleagues


recently reported on the functional screening of metagenomes and the characteriza- tion
of selected enzymes. Among those were the metagenome-derived esterases MGS0156
and GEN0105, which hydrolyzed polylactic acid (PLA) and polycaprolactone, as well as
bis(benzoyloxyethyl)-terephthalate. For MGS0156, 3D structural data at 1.95 Å indicate a
modified / -hydrolase fold with a lid domain and a highly hydrophobic active site (38).
The closest homologue to MGS0156 is an enzyme from Desulfovibrio fructosivorans
with 70% sequence similarity.

Within this context, it is perhaps notable that often enzyme activities that are
reported are based on clearing zones in agar plates. However, these assays are not fully
reliable. For instance, different enzymes from Pseudomonas spp. and Bacillus spp.
showed significant esterase activities and partially or even completely cleared plates
containing colloidal PUR. However, only the Pseudomonas sp. lipase significantly de-
graded the added PUR based on nuclear magnetic resonance (NMR) and infrared (IR)
data (50). Furthermore, there is strong evidence that some B. subtilis and Alicycliphilus
sp. isolates are able to degrade PUR (51–53).

In a recent publication, Schmidt and colleagues reported on microbial degradation of


PUR (i.e., Impranil DLN). The authors of this study employed the known polyester
hydrolases LC-cutinase, TfCut2, Tcur1278, and Tcur0390 in their assays and observed
significant weight loss of the tested foils when incubated for extended time periods (200
h) at a temperature of 70°C (54). The observation that cutinases, otherwise known to
degrade polyethylene terephthalate, also act on PUR could be attributed to the
promiscuous nature of the Thermobifida-derived cutinases. Recent research on promis-
cuity of enzymes implies that lipolytic enzymes such as cutinases are very often highly
promiscuous and can convert up to 78 different substrates (55).

While the list of PUR-active bacteria is steadily increasing, a larger number of fungi
have also been reported to degrade polyurethane (41). Notably, the authors of that study
identified a 21-kDa metallo-hydrolase from Pestalotiopsis microspora as a respon- sible
enzyme in PUR degradation. Additional studies identified Fusarium solani, Candida
ethanolica (56), and Candida rugosa (57) as PUR degraders. While for C. rugosa, a lipase
has been identified as the key enzyme involved in PUR metabolism, no enzymes were yet
identified for C. ethanolica and F. solani. Other fungi reported belong to the
Cladosporium cladosporioides complex, including the species Cladosporium
pseudocladosporioides, Cladosporium tenuissimum, Cladosporium asperulatum, and
Cladosporium montecillanum, and three others were identified as Aspergillus
fumigatus, Penicillium chrysogenum (58), and Aspergillus flavus (59). In the case of A.
flavus, it is assumed that secreted esterases are responsible for the degradation.
However, no defined enzyme has yet been linked to the observed activities. In a
similar study, it was recently reported that Aspergillus tubingensis colo- nizes PUR and
acts on the surface of films made of PUR. However, no enzyme was linked with the
PUR activities (60).

It is noteworthy that the above-mentioned PUR-active enzymes and organisms were


all acting on ester-linked PUR. However, to the best of our knowledge, no enzymes have
yet been described acting on polyurethane ethers. Polyethylene. Polyethylene (PE)
consists of long-chain polymers of ethylene, and it is produced as either high-density
(HD-PE) or low-density (LD-PE) polyethylene. PE is chemically synthesized by
polymerization of ethane and is highly variable, since side chains can be obtained
depending on the manufacturing process. Such modifications mainly have influence on
crystallinity and molecular weight. The polymer is most frequently used in the
packaging industry as one of the main packaging materials, and more than 100 million
tons of PE are produced globally per year (2, 61) (Fig. 2). Possible PE degradation has
been affiliated with a surprisingly large number of bacterial genera. Among those
were Gram-negative species affiliated with the genera Pseudomonas, Ralstonia, and
Stenotrophomonas but also many Gram-positive taxa (e.g., Rhodococcus, Staphylococcus,
Streptomyces, Bacillus, and others) (see references in Sen and Raut [62] and Restrepo-
Florez et al. [63]). In addition, fungal genera affiliated with assumed PE degradation
were reported; these included Aspergillus, Cladosporium, Penicillium, and others
(see references in references 62, 63, and 64–69). In addition, a few studies linked the
PE-degrading microbes with the complex gut microbiomes of invertebrates (70, 71).

Polyamide. Polyamide (PA) is a polymer of repeating units of aliphatic, semiaro-


matic, or aromatic molecules linked via amide bonds. Since the monomers for making
this polymer can be very versatile, there are many different types of synthetic poly-
amides, with the most popular being nylon and Kevlar. Synthetic polyamides are mainly
used in textiles, automotive applications, carpets, and sportswear (73).

Three main enzymes are essential for the initial hydrolysis of cyclic and linear
6-aminohexanoate oligomers. The first one is a cyclic-dimer hydrolase (NylA), the
second a dimer hydrolase (NylB), and the third an endo-type oligomer hydrolase (NylC).
NylC is a typical esterase, but its 3D structure also reveals motifs with -lactamase folds
(79–87). Once the oligomers are hydrolyzed, the monomers are metabolized by differ- ent
aminotransferases. The draft genome of Arthrobacter sp. KI72 carries, among others, two
genes, designated nylD1 and nylE1, that are responsible for the secondary 6-
aminohexanoate metabolism. The 6-aminohexanoate aminotransferase (NylD1)
catalyzes the reaction of 6-aminohexanoate to adipate semialdehyde. It uses
ketoglutarate, pyruvate, and glyoxylate as amino acceptors and generates glutamate,
alanine, and glycine, respectively. The reaction relies on pyridoxal phosphate as a
cofactor. The second enzyme, the adipate semialdehyde dehydrogenase (NylE1), cata-
lyzes the reaction, leading from adipate semialdehyde to adipate. This enzyme requires
NADP as a cofactor and is an oxidoreductase (88, 89).

The only enzyme that has so far been reported to act on high-molecular-weight
nylon fibers was classified as a manganese-dependent peroxidase and originated from a
white rot fungus. The activity of the native and purified enzyme, however, differed from
that of lignolytic enzymes. Nylon-degrading activity was quantified by measuring the
structural disintegration of nylon-66 membranes. The enzyme had a molecular weight
of 43 kDa and was dependent on the presence of lactate and other alpha- hydroxy
acids. Unfortunately, no gene or protein sequence was determined (92).
While the first reports were published in 1965 stating that, among others, Pseu-
domonas aeruginosa is able to convert oligomeric nylon, further studies have confirmed
that P. aeruginosa and evolved strain PAO1 are able to efficiently degrade 6-
aminohexanoate linear dimers (74, 93). The main enzymatic activities were assigned to a
6-aminohexanoate cyclic-dimer hydrolase and a 6-aminohexanoate dimer hydro- lase.
Other Pseudomonas species have, however, also been reported to utilize 6-
aminohexanoate-dimers as a sole carbon and nitrogen source (94).

Polystyrene. Polystyrene (PS) [poly(1-phenylethene)] polymer consists of styrene


monomers. PS is a widely used synthetic polymer for packaging industries but many
daily use articles (CD cases, plastic cutlery, petri dishes, etc.) are also produced from this
polymer (95). In 2016, about 14 million tons were produced. The direct ring
cleavage of styrene is initiated by a dihydroxylation of the aromatic ring. This reaction is
catalyzed by a 2,3-dioxygenase and followed by a 2,3-dihydrodiol dehydrogenase. The
two key products that are formed are styrene cis-glycol and 3-vinylcatechol. The
latter can then be degraded by subsequent meta- or orthocleav- age to form acrylic acid,
acetaldehyde, and pyruvate. The pathway is rather unspecific for the general degradation
of various aromatic compounds, such as phenol or toluene (100–102).

Polyvinylchloride and polypropylene. Polyvinylchloride (PVC) and polypropyl- ene


(PP) are both important polymers produced at higher levels than the above- named
polymers. PVC is the third most frequently produced polymer, and only PE and PP are
produced at higher levels. PVC is composed of repeating chloroethyl units and PP of
repeating units of propane-1,2-diyl units (116, 117). In sharp contrast to their huge
global production rate, hardly any reliable information is available on microbial
degradation of both of these important polymers. Only a very few reports that describe the
degradation of the polymers based on weight loss and using mixed species microbial
communities have been published (118, 119). How- ever, it is likely that these reports
were in part misled by the degradation of the chemical additives rather than the
polymer. Consequently, no defined enzymes or pathways that are responsible for the
degradation of either of these two high- molecular-weight polymers are known.

MICROBIOMES OF INVERTEBRATES AS POSSIBLE SOURCES OF PLASTIC-


DEGRADING BACTERIA
Recently, it was reported that invertebrates can degrade different plastics (70, 71,
120–123). While these studies demonstrated that the insects perform a mechanical
grinding and shredding of the plastics, it has been critically discussed if, and to which
extent, the microbiomes associated with the different insects are capable of truly
degrading the synthetic polymers. In one of those studies, Yang and colleagues
provided convincing evidence that Tenebrio molitor L. (mealworms) digested Styro-
foam. The larvae lived over a month when fed on the Styrofoam. Within a 16-day
period, nearly 50% of the ingested Styrofoam carbon was converted into CO2, and the
residual Styrofoam was found in the feces. Labeling studies using -13C- or -13C-
labeled polystyrol implied that the carbon compound was preferentially used to build
lipids (71). One of the earliest reports on insects digesting plastics came from caterpil-
lars. In 2017, a Spanish team reported on the fast biodegradation of PE by larvae of the
wax moth (Galleria mellonella). The authors of this study presented evidence that larvae
of the wax moth produced holes in PE films with considerable speed (120). The findings
of this study were critically discussed later on, as the occurrence of ethylene glycol as
well as the correct usage of the FTIR method could not be immediately verified (121).
Further work by a Chinese and United States-based research team identified Bacillus sp.
strain YP1 as the polyethylene-degrading bacterium responsible for PE degradation in
Indian mealworms (70, 122). A related study from the same group identified bacteria
affiliated with the genera Citrobacter and Kosakonia as main degraders for PE and PS in
the guts of Tenebrio molitor (123). Thus, grinding of larger plastic pieces into smaller
parts might offer a solution in that it increases the surface area and thereby allows
microorganisms to better attach to the surfaces.

FUTURE CHALLENGES IN MICROBIAL PLASTIC DEGRADATION RESEARCH

The diversity of known enzymes and microbes acting on synthetic polymers is still
rather limited. Therefore, future work has to address the identification of organisms
acting on the most dominant polymers. The main bottleneck lies in the initial break-
down of high-molecular-weight and highly robust polymers and their crystalline struc-
tures. Furthermore, the implementation of enzymes in processes that would allow the
degradation of plastic polluting environmental niches is a challenge for future gener-
ations of microbiologists. Since current cultivation technologies have not yet resulted in
the identification of highly active enzymes for most plastics, the diversity of
noncultivated microorganisms (i.e., global metagenomes) and the so-called dark matter
proteins offer a promising source for the identification of such biocatalysts. Thus, the
further development of smart search algorithms for mining metagenome data sets is
certainly a rewarding task. In parallel, the setup of reliable function- based assays for
the detection of high-molecular-weight-polymer-active enzymes is important as well.
Since commercially available polymers and films thereof are often used as
substrates, they contain additives, plasticizers, and other biodegradable impurities (for
example, phthalates), which are much more easily broken down than the actual backbone.
This therefore interferes with the results and frequently leads to the identification of
false positives. Thus, the overall methodology linked to the analysis of microbial plastic
degradation needs to be standardized and optimized.

Similarly, the development of cellulosome-like structures (i.e., “plastosomes”) in


microbes to attack intact and crystalline fibers would certainly be a worthwhile project.
Along these lines, the simple development of highly active enzymes for textile indus- tries
could already significantly reduce annual plastic pollution and would perhaps be one of
the more realistic short-term goals. Furthermore, using synthetic biology to generate
microorganisms that would pro- duce high-value compounds from plastic waste is a
future challenge and would contribute to an improved circular use of plastics.
Monomers and oligomers formed after the degradation could be used to build value-
added products or even new (biodegradable) polymers.Lastly, obtaining plastic-active
enzymes and implementing them in the production of true biopolymers is a highly
rewarding research task and would significantly reduce our global plastic problem.
TERJEMAHAN

Secara keseluruhan, polimer sintetik diproduksi di seluruh dunia pada skala sedikitnya
350 hingga 400 juta metrik ton per tahun. Polimer utama yang diproduksi dan penting bagi
perekonomian kita adalah poliuretan (PUR), polietilen (PE), poliamida (PA), polietilena
tereftalat (PET), polistirena (PS), polivinilklorida (PVC), dan polipropilen (PP) ( Gambar 1).
Dengan peningkatan produksi dan penggunaan plastik, diperkirakan 5 hingga 13 juta metrik
ton plastik masuk ke laut setiap tahun, dengan konsekuensi negatif untuk berbagai ekosistem
dan bagi kesehatan manusia dan hewan (1-3). Hanya tentang Patch Sampah Besar Pasifik,
lebih dari 1,8 triliun keping plastik dengan perkiraan berat 80.000 ton telah terakumulasi
sejauh ini, tanpa akhir yang terlihat (4-7). Oleh karena itu, dua pertanyaan utama yang
dibahas dalam ulasan ini adalah sebagai berikut. (i) Enzim dan mikroorganisme mana yang
saat ini diketahui terlibat dalam polimer dengan berat molekul tinggi degradasi plastik? (ii)
Apa tantangan dan teknologi masa depan untuk mengidentifikasi enzim yang lebih baik yang
bekerja pada beragam polimer sintetis?

Menariknya, rute penghancuran plastik yang paling terkenal saat ini melibatkan
paparan sinar UV bersama dengan gangguan mekanis yang disebabkan oleh gelombang dan
angin atau penggilingan pada batuan dan sedimen laut, yang pada akhirnya memecah plastik
yang lebih besar menjadi potongan mikro dan nanoplastik yang lebih kecil (MP, dengan
ukuran 5 mm, dan NP, dengan ukuran 0,1 m). Apa yang disebut "pelapukan" dan
"fotodegradasi" saat ini dianggap sebagai kekuatan utama untuk penipisan awal plastik, dan
mereka terutama menghasilkan modifikasi sifat kimia, fisik, dan mekanik dari plastik (9, 10).
Partikel yang dihasilkan memiliki luas permukaan yang jauh lebih besar, yang membuatnya
dapat menerima degradasi lebih lanjut (11). Khususnya, anggota parlemen dan NP
merupakan masalah bagi kesehatan kita, karena diharapkan mereka memasuki rantai
makanan dan berakhir di usus kita (12, 13). Nasib anggota parlemen atau NP di usus manusia
atau hewan belum ditentukan.

Oleh karena itu, penghapusan plastik dari lingkungan menggunakan enzim mikroba
telah menjadi fokus penelitian terbaru. Tantangan utama adalah bahwa plastik yang
dipindahkan di laut dan terestrial sangat stabil dan tahan lama. Plastik terutama telah
diperkenalkan sejak 1960-an dan, mengingat beberapa dekade yang relatif sejak polimer
buatan manusia ini tersedia, alam hanya memiliki waktu yang sangat singkat untuk
mengembangkan enzim yang sangat aktif. Selain itu, banyak jenis plastik terakumulasi di
lingkungan, dan banyak plastik yang sering digunakan adalah campuran yang mengandung
pelarut tambahan dan bahan kimia lainnya untuk mengubah sifat mekanik dan fisik.
Senyawa-senyawa ini adalah target lebih lanjut untuk biodegradasi mikroba tetapi juga
mungkin mengganggu aktivitas enzim degradatif. Diasumsikan bahwa polimer yang lebih
besar pada awalnya didegradasi oleh exoenzym yang disekresikan menjadi subunit yang lebih
kecil (multimer, dimer) yang dapat dimasukkan ke dalam sel mikroba. Begitu berada di sel,
baik oligomer atau produk degradasi ini disalurkan melalui jalur degradasi klasik untuk
menghasilkan energi dan / atau berfungsi sebagai blok bangunan untuk katabolisme atau
metabolisme.

Secara umum, diyakini bahwa degradasi mikroba polimer buatan manusia adalah
proses yang sangat lambat. Resistensi yang tinggi ini terutama berasal dari berat molekul
tinggi serat, ikatan C-C yang kuat, dan permukaan yang sangat hidrofobik, yang sangat sulit
diserang oleh enzim. Khususnya, polimer adalah molekul dengan berat molekul tinggi, dan
mereka memiliki bentuk amorf dan kristal, yang memiliki tingkat kemampuan degradasi yang
berbeda.

Saat ini, hanya sedikit bakteri dan jamur yang telah dijelaskan untuk degradasi
sebagian PET menjadi oligomer atau monomer (8). Semua hidrolase PET yang dikenal
memiliki tingkat turnover yang relatif rendah. Menariknya, sifat degradasi PET tampaknya
terbatas pada beberapa filum bakteri, dan sebagian besar isolat bakteri dengan potensi
degradasi PET adalah anggota dari filum Gram-positif Actinobacteria (15). Contoh-contoh
berkarakter terbaik berasal dari genus Thermobi fi da dan Thermomonospora (16–23). Enzim
yang terlibat dalam degradasi (mis., PET hidrolase dan tannase, MHETase) adalah hidrolase
serin tipikal, misalnya, cutinase (EC 3.1.1.74), lipase (EC 3.1.1.3), dan karboksilesterase (EC
3.1.1.1). Enzim ini memiliki lipatan khas / -hidrolase, dan triad katalitik terdiri dari serin,
histidin, dan residu aspartat (18,24). Mereka juga dapat mengandung beberapa ikatan
disintegrasi yang disebabkan oleh residu sistein, yang meningkatkan stabilitas termal dan
pengikatan spesifik terhadap PET, seperti yang ditunjukkan oleh contoh PETase dari
Ideonella sakaiensis 201-F6 (25).

Juga, untuk bakteri I. sakaiensis, penggunaan PET sebagai energi utama dan sumber
karbon telah dijelaskan (25). Selain PET hidrolase, genom I. sakaiensis mengkode enzim
kedua yang tampaknya unik sejauh ini dan yang memiliki kesamaan tinggi dengan kelompok
tannase, yang mampu mendegradasi asam tereftalat mono (2-hidroksietil) tereftalat. PET
hidrolase sebagai enzim yang disekresikan menghasilkan asam intermediate mono (2-
hydroxyethyl) terephthalic (MHET). MHET diinternalisasi oleh sel dan dihidrolisis oleh
MHETase. Monomer yang dihasilkan kemudian digunakan untuk metabolisme bakteri. I.
sakaiensis berafiliasi dengan filum Betaproteobacteria dan termasuk dalam urutan
Burkholderiales.

Struktur I. sakaiensis PETase tiga dimensi (3D) telah dijelaskan baru-baru ini (26).
Struktur keseluruhan paling menyerupai struktur cutinase. Austin et al. menunjukkan bahwa
mutasi ganda (S238F / W159H), yang mempersempit situs aktif enzim dan membuat protein
lebih seperti cutinase menyerupai enzim dari Thermobi fi da fusca, mengarah ke varian yang
lebih baik. Mayoritas hidrolase PET yang diverifikasi secara fungsional mengandung ikatan
pemutusan terminal-C, yang meningkatkan stabilitas termal dan kinetik (27-29). Satu-satunya
pengecualian dari ini sejauh ini adalah para- nitrobenzylesterase dari Bacillus subtilis (30).
Ikatan pemisah tambahan dapat ditemukan pada I. sakaiensis PETase, serta dalam model
struktural dari hidrolase PET yang diuji secara fungsional dijelaskan oleh Danso et al. (31)
Data struktural menunjukkan bahwa PETases mengikat polimer dengan permukaan
hidrofobik dan celah pengikat substrat. Secara total, 4 bagian MHET terikat pada protein
(satu ke subsite I dan tiga ke subsite II), di mana ikatan ester yang akan dibelah terletak di
antara kedua subsitus di sebelah serine katalitik. MHETase dari I. sakaiensis yang selanjutnya
menghidrolisis MHET menjadi etilen glikol dan asam tereftalat baru-baru ini telah
dikristalisasi dengan bebas ligan (2,05 Å) dan dengan ikatan analog MHET yang tidak
terhidrolisis (2,1 Å). Enzim memiliki domain tutup yang hampir secara eksklusif
menganugerahkan spesifikasi dan aktivitas substrat ke arah MHET, dengan kcat 11,1 1,4 s 1
(32).

Sementara enzim I. sakaiensis adalah model yang paling banyak dipelajari, enzim dan
lainnya organisme telah diidentifikasi sebagai degradator PET yang kuat. Saat ini, empat
enzim dari spesies Thermobi fi da, satu dari Saccharomonospora, dan satu dari filum
Thermmononospora diketahui bekerja pada PET. Enzim actinobacterial ini seringkali
tergantung Ca2, terutama dalam hal stabilitas termal mereka (33), dan mereka sebagian
dihambat oleh produk hidrolisis yang dikeluarkan MHET dan BHET (33). Oleh karena itu,
upaya telah dilakukan untuk mengatasi batasan ini; satu pendekatan terletak pada kombinasi
poliester hidrolase dengan enzim lain untuk meningkatkan sifat pengikatan substrat dan
katalitik (26, 34, 35).
Dengan menggunakan pendekatan penambangan gen silico, cutinase dari
Pseudomonas pseudo-alcaligenes (PpCutA) dan lipase diduga dari Pseudomonas pelagia
(PpelaLip) diidentifikasi sebagai enzim potensial yang bekerja pada poliester secara umum.
Pekerjaan eksperimental lebih lanjut dengan menggunakan enzim rekombinan PpCutA dan
PpelaLip memverifikasi aktivitas hidrolitik kedua enzim pada berbagai jenis poliester,
termasuk hidrolisis polioksietilen tereftalat (36). Dalam studi mereka, penulis menggunakan
poliester berbasis asam ion ftalat ionik yang berbeda secara struktural dengan berat molekul
rata-rata mulai dari 1.770 hingga 10.000 g / mol dan poliester semikristalin dengan
kristalinitas di bawah 1% untuk menguji dan memverifikasi degradasi mikroba. Khususnya,
organisme yang diidentifikasi milik spesies novel bioteknologi penting dalam genus
Pseudomonas, yang disebut Pseudomonas pertucinogena (37).

Selain esterase PET turunan metagenome yang dijelaskan di atas, rekan baru-baru ini
melaporkan skrining fungsional metagenom dan karakterisasi enzim yang dipilih. Di antara
mereka adalah esterase yang diturunkan dari metagenome MGS0156 dan GEN0105, yang
menghidrolisis asam polylactic (PLA) dan polycaprolactone, serta bis (benzoyloxyethyl) -
terephthalate. Untuk MGS0156, data struktural 3D pada 1,95 Å menunjukkan lipatan yang
dimodifikasi / -hidrolase dengan domain tutup dan situs aktif yang sangat hidrofobik (38).
Homolog terdekat dengan MGS0156 adalah enzim dari Desulfovibrio fructosivorans dengan
kesamaan urutan 70%.

Dalam konteks ini, mungkin perlu dicatat bahwa sering aktivitas enzim yang
dilaporkan didasarkan pada zona pembersihan di piring agar. Namun, pengujian ini tidak
sepenuhnya dapat diandalkan. Misalnya, enzim yang berbeda dari Pseudomonas spp. dan
Bacillus spp. menunjukkan aktivitas esterase yang signifikan dan pelat yang dibersihkan
sebagian atau seluruhnya yang mengandung PUR koloid. Namun, hanya Pseudomonas sp.
lipase secara signifikan mendefinisikan PUR yang ditambahkan berdasarkan data resonansi
magnetik nuklir (NMR) dan inframerah (IR) (50). Selain itu, ada bukti kuat bahwa beberapa
B. subtilis dan Alicycliphilus sp. isolat dapat menurunkan PUR (51-53).

Dalam publikasi terbaru, Schmidt dan rekannya melaporkan degradasi mikroba PUR
(yaitu, Impranil DLN). Penulis penelitian ini menggunakan poliester hidrolase LC-cutinase,
TfCut2, Tcur1278, dan Tcur0390 yang dikenal dalam pengujian mereka dan mengamati
penurunan berat badan yang signifikan dari foil yang diuji ketika diinkubasi untuk periode
waktu yang lama (200 jam) pada suhu 70 ° C ( 54). Pengamatan bahwa cutinases, atau
dikenal untuk mendegradasi polietilen tereftalat, juga bertindak pada PUR dapat dikaitkan
dengan sifat promiscuous dari cutinase yang diturunkan dari Thermobi-da. Penelitian terbaru
tentang promisitas enzim menyiratkan bahwa enzim lipolitik seperti cutinase sangat sering
sangat pilih-pilih dan dapat mengkonversi hingga 78 substrat yang berbeda (55). Sementara
daftar bakteri aktif PUR terus meningkat, sejumlah besar jamur juga dilaporkan menurunkan
poliuretan (41). Khususnya, para penulis studi tersebut mengidentifikasi 21-kDa metallo-
hydrolase dari Pestalotiopsis microspora sebagai enzim yang bertanggung jawab dalam
degradasi PUR.

Studi tambahan mengidentifikasi Fusarium solani, Candida ethanolica (56), dan


Candida rugosa (57) sebagai pengurai PUR. Sementara untuk C. rugosa, lipase telah
diidentifikasi sebagai enzim kunci yang terlibat dalam metabolisme PUR, belum ada enzim
yang diidentifikasi untuk C. ethanolica dan F. solani. Jamur lain yang dilaporkan termasuk
dalam kompleks Cladosporium cladosporioides, termasuk spesies Cladosporium
pseudocladosporioides, Cladosporium tenuissimum, Cladosporium asperulatum, dan
Cladosporium montecillanum, dan tiga lainnya diidentifikasi sebagai Aspergillus fumigatus,
Penicillium (chorus). Dalam kasus A. flvus, diasumsikan bahwa esterase yang disekresikan
bertanggung jawab atas degradasi. Namun, belum ada enzim pasti yang dikaitkan dengan
aktivitas yang diamati. Dalam penelitian serupa, baru-baru ini dilaporkan bahwa Aspergillus
tubingensis mengkolonisasi PUR dan bekerja pada permukaan film yang terbuat dari PUR.
Namun, tidak ada enzim yang dikaitkan dengan aktivitas PUR (60).

Patut dicatat bahwa enzim dan organisme aktif PUR yang disebutkan di atas
semuanya bekerja pada PUR yang terkait ester. Namun, sejauh pengetahuan kami, belum ada
enzim yang dijelaskan bekerja pada eter poliuretan. Polyethylene. Polietilena (PE) terdiri dari
polimer rantai panjang etilena, dan diproduksi sebagai polietilen densitas tinggi (HD-PE) atau
polietilena densitas rendah (LD-PE). PE disintesis secara kimia dengan polimerisasi etana
dan sangat bervariasi, karena rantai samping dapat diperoleh tergantung pada proses
pembuatannya. Modifikasi semacam itu terutama memiliki pengaruh pada kristalinitas dan
berat molekul. Polimer ini paling sering digunakan dalam industri kemasan sebagai salah satu
bahan kemasan utama, dan lebih dari 100 juta ton PE diproduksi secara global per tahun (2,
61) (Gbr. 2). Kemungkinan degradasi PE telah terafiliasi dengan jumlah yang sangat besar
genera bakteri. Di antara mereka adalah spesies Gram-negatif yang terafiliasi dengan genera
Pseudomonas, Ralstonia, dan Stenotrophomonas tetapi juga banyak taksa Gram-positif (mis.,
Rhodococcus, Staphylococcus, Streptomyces, Bacillus, dan lain-lain) (lihat referensi dalam
Sen dan Raut [62] dan Restrepo-Florez et al. [63]). Selain itu, genus jamur yang berafiliasi
dengan dugaan degradasi PE dilaporkan; ini termasuk Aspergillus, Cladosporium,
Penicillium, dan lainnya (lihat referensi dalam referensi 62, 63, dan 64-69). Selain itu,
beberapa penelitian menghubungkan mikroba pengurai-PE dengan mikrobioma usus
invertebrata yang kompleks (70, 71).

Poliamida. Poliamida (PA) adalah polimer unit berulang molekul alifatik, semi-matic,
atau aromatik yang dihubungkan melalui ikatan amida. Karena monomer untuk membuat
polimer ini bisa sangat fleksibel, ada banyak jenis poliamida sintetik, dengan yang paling
populer adalah nilon dan Kevlar. Poliamida sintetik terutama digunakan dalam tekstil,
aplikasi otomotif, karpet, dan pakaian olahraga (73).

Tiga enzim utama sangat penting untuk hidrolisis awal siklik dan linier Oligomer 6-
aminoheksanoat. Yang pertama adalah hidrolase dimer siklik (NylA), yang kedua adalah
dimer hidrolase (NylB), dan yang ketiga merupakan oligomer hidrolase (NylC) jenis endo.
NylC adalah esterase yang khas, tetapi struktur 3D-nya juga memperlihatkan motif dengan
lipatan -lactamase (79-87). Setelah oligomer dihidrolisis, monomer dimetabolisme oleh
aminotransferase yang berbeda. Rancangan genom Arthrobacter sp. KI72 membawa, antara
lain, dua gen, yang ditunjuk nylD1 dan nylE1, yang bertanggung jawab untuk sekunder
Metabolisme 6-aminoheksanoat. The 6-aminohexanoate aminotransferase (NylD1)
mengkatalisasi reaksi 6-aminohexanoate menjadi adipate semialdehyde. Itu menggunakan
ketoglutarate, piruvat, dan glioksilat sebagai akseptor amino dan masing-masing
menghasilkan glutamat, alanin, dan glisin. Reaksi ini bergantung pada fosfat piridoksal
sebagai kofaktor. Enzim kedua, adipate semialdehyde dehydrogenase (NylE1),
menggabungkan reaksi, memimpin dari adipate semialdehyde ke adipate. Enzim ini
membutuhkan NADP sebagai kofaktor dan merupakan oksidoreduktase (88, 89).

Satu-satunya enzim yang sejauh ini dilaporkan bekerja pada serat nilon dengan berat
molekul tinggi diklasifikasikan sebagai peroksidase yang bergantung pada mangan dan
berasal dari jamur busuk putih. Namun, aktivitas enzim asli dan murni berbeda dari enzim
lignolitik. Aktivitas degradasi nilon dikuantifikasi dengan mengukur disintegrasi struktural
membran nilon-66. Enzim memiliki berat molekul 43 kDa dan tergantung pada keberadaan
laktat dan asam alfa-hidroksi lainnya. Sayangnya, tidak ada urutan gen atau protein yang
ditentukan (92).
Sementara laporan pertama diterbitkan pada tahun 1965 yang menyatakan bahwa, antara lain,
Pseu- domonas aeruginosa mampu mengubah nilon oligomer, studi lebih lanjut telah
mengkonfirmasi bahwa P. aeruginosa dan strain yang berevolusi PAO1 mampu secara efisien
mendegradasi Dimer linier 6-aminoheksanoat (74, 93). Kegiatan enzimatik utama ditugaskan
untuk hidrolase dimer siklik-dimer 6-aminoheksanoat dan hidrolase dimer 6-aminoheksanoat.
Spesies Pseudomonas lain, bagaimanapun, juga telah dilaporkan memanfaatkan 6-
aminohexanoate-dimer sebagai sumber karbon dan nitrogen tunggal (94).

Polystyrene. Polimer Polystyrene (PS) [poly (1-phenylethene)] terdiri dari monomer


stirena. PS adalah polimer sintetik yang banyak digunakan untuk industri pengemasan tetapi
banyak barang penggunaan sehari-hari (kasing CD, peralatan makan plastik, cawan petri, dll.)
Juga diproduksi dari polimer ini (95). Pada 2016, sekitar 14 juta ton diproduksi.

Pembelahan cincin langsung dari styrene dimulai oleh dihydroxylation dari cincin
aromatik. Reaksi ini dikatalisis oleh 2,3-dioksigenase dan diikuti oleh 2,3-dihidrodiol
dehidrogenase. Dua produk utama yang terbentuk adalah styrene cis-glycol dan 3-
vinylcatechol. Yang terakhir ini kemudian dapat terdegradasi oleh meta- atau ortokleavat
selanjutnya untuk membentuk asam akrilat, asetaldehida, dan piruvat. Jalurnya agak tidak
spesifik untuk degradasi umum berbagai senyawa aromatik, seperti fenol atau toluena (100-
102).

Polivinilklorida dan polipropilen. Polivinilklorida (PVC) dan polipropilena (PP)


keduanya merupakan polimer penting yang diproduksi pada tingkat yang lebih tinggi
daripada polimer yang disebutkan di atas. PVC adalah polimer ketiga yang paling sering
diproduksi, dan hanya PE dan PP yang diproduksi pada tingkat yang lebih tinggi. PVC terdiri
dari unit kloroetil berulang dan PP unit berulang propana-1,2-diil unit (116, 117). Berbeda
sekali dengan laju produksi globalnya yang sangat besar, hampir tidak ada informasi yang
dapat diandalkan tentang degradasi mikroba dari kedua polimer penting ini. Hanya sedikit
laporan yang menggambarkan degradasi polimer berdasarkan penurunan berat badan dan
penggunaan komunitas mikroba spesies campuran yang telah dipublikasikan (118, 119).
Namun, ada kemungkinan bahwa laporan-laporan ini sebagian disesatkan oleh degradasi
aditif kimia daripada polimer. Akibatnya, tidak ada enzim atau jalur yang ditentukan yang
bertanggung jawab untuk degradasi salah satu dari dua polimer dengan berat molekul tinggi
ini yang diketahui.
MIKROBIOM INVERTEBRATES SEBAGAI SUMBER YANG MUNGKIN DARI
BAKTERI DEGRADING PLASTIK

Baru-baru ini, dilaporkan bahwa invertebrata dapat menurunkan plastik yang berbeda
(70, 71,120–123). Sementara studi-studi ini menunjukkan bahwa serangga melakukan
penggilingan dan penghancuran plastik secara mekanis, telah dibahas secara kritis jika, dan
sejauh mana, mikrobioma yang terkait dengan serangga berbeda mampu benar-benar
merendahkan polimer sintetik. Dalam salah satu studi tersebut, Yang dan rekannya
memberikan bukti yang meyakinkan bahwa Tenebrio molitor L. (ulat tepung) mencerna
Styrofoam. Larva hidup lebih dari sebulan ketika diberi makan styrofoam. Dalam periode 16
hari, hampir 50% dari karbon Styrofoam yang tertelan dikonversi menjadi CO2, dan sisa
Styrofoam ditemukan dalam tinja. Studi pelabelan menggunakan -13C- atau -13C- berlabel
polystyrol menyiratkan bahwa senyawa karbon lebih disukai digunakan untuk membangun
lipid (71). Salah satu laporan paling awal tentang serangga pencerna plastik berasal dari ulat.
Pada 2017, sebuah tim Spanyol melaporkan biodegradasi cepat PE oleh larva ngengat lilin
(Galleria mellonella). Para penulis penelitian ini menyajikan bukti bahwa larva ngengat lilin
menghasilkan lubang pada film PE dengan kecepatan yang luar biasa (120). Temuan-temuan
dari penelitian ini dibahas secara kritis di kemudian hari, karena kejadian etilen glikol serta
penggunaan metode FTIR yang benar tidak dapat segera diverifikasi (121). Pekerjaan lebih
lanjut oleh tim peneliti yang berbasis di Cina dan Amerika Serikat mengidentifikasi Bacillus
sp. strain YP1 sebagai bakteri pendegradasi polietilen yang bertanggung jawab untuk
degradasi PE pada cacing makan India (70, 122). Sebuah studi terkait dari kelompok yang
sama mengidentifikasi bakteri yang berafiliasi dengan genera Citrobacter dan Kosakonia
sebagai degraders utama untuk PE dan PS dalam nyali molekuler Tenebrio (123).

Dengan demikian, penggilingan potongan plastik yang lebih besar ke bagian yang lebih kecil
mungkin menawarkan solusi dalam hal itu meningkatkan luas permukaan dan dengan
demikian memungkinkan mikroorganisme untuk lebih menempel pada permukaan.

TANTANGAN MASA DEPAN DALAM PENELITIAN DEGRADASI PLASTIK


MIKROBA

Keragaman enzim dan mikroba yang diketahui bekerja pada polimer sintetik masih
agak terbatas. Oleh karena itu, pekerjaan di masa depan harus membahas identifikasi
organisme yang bekerja pada polimer yang paling dominan. Hambatan utama terletak pada
penguraian awal polimer dengan berat molekul tinggi dan sangat kuat serta struktur
kristalinnya. Selain itu, penerapan enzim dalam proses yang akan memungkinkan degradasi
ceruk lingkungan yang mencemari plastik merupakan tantangan bagi generasi mendatang ahli
mikrobiologi. Karena teknologi budidaya saat ini belum menghasilkan identifikasi enzim
yang sangat aktif untuk sebagian besar plastik, keragaman mikroorganisme yang tidak
dibudidayakan (mis., Metagenom global) dan apa yang disebut protein materi gelap
menawarkan sumber yang menjanjikan untuk identifikasi biokatalis tersebut. Dengan
demikian, pengembangan lebih lanjut dari algoritma pencarian pintar untuk menambang set
data metagenome tentu merupakan tugas yang bermanfaat. Secara paralel, pengaturan uji
berbasis fungsi yang andal untuk mendeteksi enzim polimer-aktif-berat-molekul tinggi juga
penting.

Karena polimer dan film yang tersedia secara komersial sering digunakan sebagai
substrat, maka polimer tersebut mengandung aditif, plasticizer, dan pengotor biodegradable
lainnya (misalnya, ftalat), yang jauh lebih mudah dipecah daripada tulang punggung yang
sebenarnya. Karena itu hal ini mengganggu hasil dan seringkali mengarah pada identifikasi
positif palsu. Dengan demikian, metodologi keseluruhan terkait dengan analisis degradasi
plastik mikroba perlu distandarisasi dan dioptimalkan.

Demikian pula, pengembangan struktur mirip seluloma (mis., "Plastosom") dalam


mikroba untuk menyerang serat utuh dan kristal tentu akan menjadi proyek yang bermanfaat.
Sejalan dengan hal ini, pengembangan sederhana enzim yang sangat aktif untuk industri
tekstil sudah dapat secara signifikan mengurangi polusi plastik tahunan dan mungkin akan
menjadi salah satu tujuan jangka pendek yang lebih realistis.

Selain itu, menggunakan biologi sintetis untuk menghasilkan mikroorganisme yang


akan menghasilkan senyawa bernilai tinggi dari limbah plastik adalah tantangan di masa
depan dan akan berkontribusi pada peningkatan penggunaan plastik bundar. Monomer dan
oligomer terbentuksetelah degradasi dapat digunakan untuk membangun produk bernilai
tambah atau bahkan baru (biodegradable) polimer. Terakhir, memperoleh enzim aktif-plastik
dan mengimplementasikannya dalam produksi biopolimer sejati adalah tugas penelitian yang
sangat bermanfaat dan akan secara signifikan mengurangi masalah plastik global kami.
B. JURNAL II
VARIAN GENERASI BEBAS VAKSINASI DARI BAKTERI CEPAT TUMBUH
VIBRIO NATRIEGENS

Bacteriophage, atau fag, mewakili entitas biologis paling melimpah di Bumi (1) dan
memiliki gaya hidup yang sangat beragam. Fag yang beriklim sedang dapat berintegrasi ke
dalam genom bakteri, tempat mereka mempertahankan, sebagaimana disebut profag,
hubungan jangka panjang dengan inang mereka. Status ini mendorong adaptasi timbal balik
antara inang dan genom virus, dan penelitian bioinformatik mengungkapkan bahwa ramalan
dan phageremnants dapat membentuk 20% dari seluruh genom bakteri (2, 3). Ramalan
ditemukan di hampir semua genom bakteri dan merupakan penyebab bagi sebagian besar
perbedaan strain spesifik dalam spesies bakteri (4-7). Dalam beberapa tahun terakhir,
semakin banyak penelitian yang berfokus pada penyelesaian dampak ramalan pada fisiologi
inang (8-11). Namun kondisi yang menyebabkan stres, mis., Kerusakan DNA dapat
mengaktifkan kembali profag, yang biasanya mengarah ke peralihan ke program perusakan
fag (mis., Siklus litik) dan akhirnya ke lisis sel dan pelepasan partikel fag. Efek stokastik
seperti fluktuasi molekul represor atau DNA untai tunggal yang terjadi secara spontan (mis.,
Dipicu oleh garpu replikasi yang terhenti) atau putusnya untaian dapat memprovokasi
fenomena yang disebut induksi kenampakan spontan (SPI) (12). Meskipun SPI adalah
penyebab terus-menerusnya kehilangan individu dalam populasi bakteri, beberapa penelitian
menekankan dampak positifnya pada kebugaran bakteri inang (13, 14), misalnya, dengan
meningkatkan informasi biofilm (15) atau virulensi dengan pelepasan toksin yang bergantung
pada lisis (16).

Dalam proses fermentasi industri, induksi ramalan merupakan konsekuensi dari


hilangnya sel-sel produsen dan dapat menyebabkan kerugian ekonomi yang parah. Dengan
demikian, banyak upaya optimalisasi regangan serta proyek pengurangan genom telah
berfokus pada penghapusan profag dan daerah yang menyerupai profag dari genom (17-22).
Pada sebagian besar studi ditunjukkan bahwa dalam kondisi laboratorium varian bebas profag
lebih kuat dan lebih dapat dimanfaatkan sebagai pabrik sel mikroba (17, 19, 21, 23). Secara
umum, proses produksi mikroba dioptimalkan untuk mencapai hasil ruangwaktu tinggi dan,
dengan demikian, tingkat pertumbuhan mikroorganisme sering merupakan faktor pembatas
utama. Ini hanya karena fakta bahwa produsen yang tumbuh cepat akan mengkonsumsi lebih
banyak substrat (mis., Memiliki tingkat konsumsi substrat spesifik biomassa tinggi) dan, oleh
karena itu, memiliki potensi untuk mencapai produktivitas yang lebih tinggi daripada
produsen yang tumbuh lambat. Akibatnya, ada minat yang kuat dalam mikroorganisme yang
tumbuh cepat, nonpathogenik, dan kuat yang menampilkan tingkat penyerapan substrat tinggi
untuk meningkatkan proses bioteknologi (24).

Vibrio natriegens yang tumbuh cepat, bakteri Gram-negatif mewakili kandidat yang
menjanjikan dengan potensi tinggi untuk mempercepat proses bioteknologi. Terisolasi pada
tahun 1958 dari daerah lumpur rawa-rawa garam, studi pertama melaporkan dua kali lipat
kurang dari 10 menit (25, 26). Penasaran dengan pertumbuhan yang cepat dan tingkat
penyerapan substrat yang tinggi, beberapa penelitian baru-baru ini berfokus pada potensi V.
natriegensas merupakan inang bagi biologi molekuler, termasuk pendekatan kloning (27, 28),
sintesis protein (28-31), dan produksi kecil molekuler (24, 32).

Dalam karya ini, kami fokus pada konstruksi dan karakterisasi varian bebas profag
dari V. natriegensATCC 14048. Dua wilayah profag potensial utuh pertama kali diprediksi
silico dan akhirnya dikonfirmasi oleh eksperimen induksi mitomycin C. Dalam percobaan
lebih lanjut, kedua ramalan (disebut VNP1 dan VNP2) telah dihapus dari genom bakteri.
Analisis komparatif mengungkapkan bahwa sel yang kekurangan dua ramalan itu lebih kuat
di bawah tekanan hipo-osmotik serta kondisi yang menyebabkan kerusakan DNA. Selain itu,
dalam percobaan pertumbuhan kompetitif, varian bebas profag mengungguli tipe liar (WT),
terutama di bawah kondisi hypo-osmotik. Hal ini dapat dikaitkan dengan hilangnya sebagian
kecil dari populasi tipe liar yang berkelanjutan karena SPI. Secara keseluruhan, data kami
menekankan bahwa V. natriegensstrain bebas profag merupakan platform yang menjanjikan
untuk rekayasa metabolik dan aplikasi bioteknologi di masa depan.

a. HASIL
Nubuat dalam genom Vibrio natriegens. Saat ini, dalam database NCBI RefSeq
melengkapi urutan genom dari lima berbedaV. natriegensstrain tersedia (8 April 2019).
Setiap genom terdiri dari dua kromosom bakteri, yang merupakan ciri khas dari spesies
Yunani. Isolat ATCC 14048 sebelumnya digambarkan sebagai salah satu strain yang
tumbuh paling cepat di antara strain V. natriegens (28) yang saat ini dikenal. Perlu
dicatat bahwa isolat ATCC 14048 yang berbeda tersedia. Dalam karya ini, kami fokus
pada regangan dengan nomor aksesi BioSample nomorAMAM03178087. Menggunakan
PhiSpy (33) dan PHASTER (34), dua daerah profag diprediksi pada kromosom pertama
(nomor akses RefSeqNZ_CP009977) (lihat Gambar. S1 dalam bahan tambahan).
Menurut kriteriaPHASTER, salah satu ramalan (dari PN96_RS04340 ke
PN96_RS04580) dikategorikan sebagai fag tidak lengkap dan yang lainnya
(PN96_RS06975 hingga PN96_RS07040) sebagai fag utuh. Selain anotasi RefSeq
terbaru, kami menggunakan RAST (35) untuk memperluas anotasi potensi profag dan
menemukan keberadaan gen fag khas (misalnya, integrase, ekor, dan protein kapsid
utama [MCP]) (Gbr. 1A dan Tabel S1) ). Selain itu, PhiSpy memperkirakan wilayah
profag ketiga (PN96_RS22545 ke PN96_RS22650) di kromosom kedua (Gambar. S1).
Namun, di wilayah khusus ini, tidak ada gen fag khas yang diprediksi oleh RAST atau
RefSeq, dan beberapa gen diberi catatan untuk menyandikan protein dengan fungsi
bakteri yang khas, seperti subunit sintase Fo F1ATP, ATP synthases, dan aldo /
ketoreductase (Tabel S1 ). Untuk menguji apakah ramalan tersebut masih dapat
diinduksi, kami menambahkan mitomycin C (MMC), agen pengikat silang dan perusak
DNA, pada kultur tipe liar yang tumbuh secara eksponensial. Setelah 3 sampai 4 jam
biakan cair berubah keruh dan lendir, menunjukkan lisis sel. DNA yang diisolasi dari
supernatan disekuensing dan mengungkapkan pengayaan spesifik dari dua daerah profag
pada kromosom pertama (Gambar 1B). Tidak ada DNA yang diperkaya ditemukan
untuk wilayah profag PhiSpypredicted dari kromosom kedua (data tidak ditampilkan).
Kami menamai dua ramalan yang dapat diinduksi VNP1 dan VNP2 (forVibrio
natriegensprophages 1 dan 2). Jumlah DNA yang diperkaya dari VNP2 (diprediksi
sebagai profage utuh menurut PHASTER) sekitar tujuh kali lebih tinggi dari VNP1,
menunjukkan bahwa VNP2 memiliki ukuran burst yang lebih tinggi. Berasal dari data
sekuensing, kami menentukan panjang pasti VNP1 (36.053 bp), VNP2 (39.183 bp), dan
situs lampiran mereka (att) [VNP1, 14 bp, TAGATTTGTGTGGT; VNP2, 26 bp,
CAGCC (G / C) AC (A / T) TT (C / T) TTCTTCTTTG A (C / T) TA]. Dalam kasus
VNP2, kami mengidentifikasi situs 26-bp-longatt terganggu. Quencing ini
mengungkapkan bahwa theatt Psite, atau lebih tepatnya, urutan setelah induksi (CAGC
CGACATTCTTCTTCTTTGATTA), sedikit berbeda dari theattL
(CAGCCCACTTTTTTTTCTT CTTTGATTA) dan situsattatt
(CAGCCGACATTCTTCTTCTTCTTTGACTA) sebelum induksi (perbedaan di situs
digarisbawahi). Ini kemungkinan merupakan hasil dari peristiwa rekombinasi selama
eksisi genom fag dari kromosom bakteri. Menggunakan transmisi electron microscopy
(TEM), kami menganalisis supernatan dari sampel tipe liar yang diinduksi MMC dan
mengkonfirmasi keberadaan fag milik keluarga Siphovirida. Partikel-partikel terdiri dari
kepala dengan diameter sekitar 50 hingga 60 nm dan panjang ekor fleksibel yang tidak
dapat dikontrak 100 hingga 110 nm (Gbr. 1C). Selain itu, penugasan dua fag ke
Siphovirida juga diprediksi oleh Virfam (36), dan tidak ada gen yang mengkode protein
pembentuk selubung, yang tipikal untuk Myoviridae, yang dijelaskan di wilayah profag
(Tabel S1).
Distribusi elemen VNP1- dan VNP2 seperti di dalam Vibriospecies. Dengan
menggunakan urutan nukleotida dari VNP1 dan VNP2, pencarian untuk ramalan yang
serupa dalam database profag aberti dengan lebih dari 10.000 potensi ramalan
dilakukan. Pencarian menghasilkan 13 hit untuk VNP1-like dan 77 hits untuk profes
seperti VNP2 menurut kesamaan Mash setidaknya 70%. Berdasarkan kesamaan genom
ini, pengelompokan hierarkis dilakukan (Gambar. S2 dan S3). Tiga ramalan
dikelompokkan secara jelas dengan VNP1 dan, yang menarik, salah satu fag ini
menunjukkan identitas 100%, sedangkan dua lainnya memiliki identitas nukleotida rata-
rata 99%. Perbandingan genom lebih lanjut terungkap bahwa identitas dua fag yang
disebutkan terakhir didasarkan pada wilayah 24-kb yang mencakup 70% wilayah VNP1.
Secara mengejutkan, bagian ~ 8-kb dari wilayah yang tersisa di VNP1 menunjukkan
identitas 84% dengan wilayah dalam ramalan VNP2, menunjukkan bahwa kedua nabi
mampu melakukan rekombinasi. Profag dari Vibrrio alginolyticusZJ-T
(SAMN05271497_p1) tidak mengelompok dengan VNP1, tetapi jarak Mash
menunjukkan beberapa kesamaan antara urutan profag, didukung oleh identitas
nukleotida rata-rata (ANI) dari 91%. Namun, perbandingan organisasi genom
menunjukkan kurangnya ukuran gen yang berbeda dari synteny dan substansial,
menunjukkan profag ini adalah spesies phage yang berbeda. Analisis ANI dari ramalan
yang tersisa menunjukkan kesamaan kurang dari 85% yang mewakili, menurut standar
saat ini (9), spesies fag yang berbeda dari VNP1 (Tabel S2).
CuringV. natriegensdari ramalan. Untuk menghapus viral load dari genV. natriegens,
pertama-tama kami menghapus wilayah VNP1 dengan rekombinasi homolog dua
langkah andsacB berbasis pemilihan balik. Meskipun metode ini bekerja dengan baik
untuk VNP1, profag kedua tidak dapat dihapus. Oleh karena itu, kami menggunakan
pendekatan penyaringan yang berbeda dengan mengintegrasikan ctBBoxoxin di bawah
kendali PBADpromoter ke dalam wilayah profag. Kehadiran toksin menyebabkan
isolasi sel yang secara spontan kehilangan wilayah VNP2, sebagaimana dikonfirmasi
oleh PCR (data tidak ditampilkan) dan sekuensing genom (Gambar 2A). Kami
meninggalkan situsatt di Vibriogenome untuk mengaktifkan percobaan infeksi fag,
transduksi, dan profil fag di kemudian hari. Secara keseluruhan, penghapusan
menghasilkan pengurangan 2,3% dari kromosom pertama. Selain itu, sekuensing gen
mengungkapkan 16 polimorfisme nukleotida tunggal (SNPs), yang sudah ada dalam
strain tipe liar orang tua, dibandingkan dengan urutan RefSeq (NZ_CP009977.1 dan
NZ_CP009978.1). Salah satu mutasi ini ada dalam rpoSgenethat yang mengkodekan
faktor sigma primer gen fase stasioner. Sembilan ditemukan di daerah yang mengkode
transferase gula yang dianotasi untuk terlibat dalam pembentukan polimer gula
ekstraseluler (lipopolisakarida [LPS] atau kapsul). LPS sering menjadi target fag
sebagai titik lampiran awal (37). SNPs incpsAmay menjelaskan mengapa pengujian fag
spot di tangan kita tidak pernah menghasilkan hasil dalam plak (lihat bahan tambahan
untuk informasi tentang studi infeksi ulang). Sebagai akibatnya, mutasi ini juga hadir
dalam varian turunan bebas-turunan (Tabel S3). Beberapa variasi urutan lebih lanjut (1
hingga 2 per galur) diidentifikasi dalam varian bebas fag, dan tinjauan lengkap
disediakan pada Tabel S3.
Dalam serangkaian percobaan pertama, kami menguji apakah penghapusan beban
proviral dan beberapa SNP yang terdeteksi akan memengaruhi pertumbuhan theV.
natriegensderivative dalam berbagai kondisi. Untuk tujuan ini, kami menggunakan
medium kompleks BHIN (lihat Bahan dan Metode) pada 30 ° C dan memeriksa
pertumbuhan dalam percobaan labu pengocok. Di tangan kami, tidak ada perbedaan
yang signifikan antara jenis liar dan varian profage-free yang dapat diamati mengenai
laju pertumbuhan dan kepadatan optik akhir (OD) (Gbr. 2B). Selain itu, kami
memperluas penapisan dengan pendekatan throughput tinggi yang dilakukan dalam 48-
well plate. Di sini, kami menguji pertumbuhan strain pada sumber karbon yang berbeda
dan memantau dampak variasi pH, suhu, dan osmolaritas menggunakan media minimal
VN sebagai dasar. Sekali lagi, kami tidak mengamati perbedaan yang signifikan antara
strain tipe liar dan varian fag-free.
Strain bebas-bakteri ini memiliki peningkatan toleransi terhadap kerusakan DNA dan
kondisi stres hipo-osmotik. Di bawah kondisi pertumbuhan yang optimal, kami tidak
dapat mendeteksi dampak negatif dari penghapusan profage terhadap pertumbuhan V.
natriegens (Gbr. 2B). Sebagai langkah selanjutnya, kami membandingkan perilaku
strain fag-free di bawah kondisi stres dengan tipe liar. Kami pertama kali melakukan
percobaan pertumbuhan di hadapan dan tidak adanya MMC antibiotik yang merusak
DNA (Gbr. 3A). Di sini, tipe liar dan Δvnp1 dan Δvnp2strain menunjukkan penurunan
kepadatan optik pada 600 nm (OD 600) setelah 3 jam, menunjukkan lisis sel yang
bergantung pada fag. Menariknya, dalam percobaan shakingflask, strain Δvnp12
menampilkan profil pertumbuhan yang sama dengan kultur tanpa agen perusak DNA.
Profil aktivitas VNP1 dan VNP2. Induksi profag spontan adalah fenomena yang
diamati di mana-mana dari strain bakteri lisogenik (12). Dalam percobaan berikut, kami
menguji fraksi sel yang menjalani SPI VNP1 dan VNP2 dalam kondisi budidaya standar
menggunakan PCR kuantitatif (qPCR) (Gambar 4AandB). Untuk tujuan ini, DNA
genom diisolasi dari sel pellet untuk menghindari sinyal latar belakang pengayaan DNA
fag dalam supernatan kultur. Oligonukleotida dirancang untuk dianil ke daerah mengapit
genom inang, menghasilkan produk setelah eksisi profag (Gbr. 4A). Secara keseluruhan,
dalam percobaan ini, kami menentukan bahwa SPI terjadi pada kurang dari 1% sel
populasi WT yang tumbuh secara eksponensial (0,13% 0,01% untuk VNP1 dan 0,61%
0,17% untuk VNP2). Tergantung pada fase pertumbuhan host, fraksi SPI dari VNP1
ditemukan berbeda dari VNP2 (Gbr. 4B). Dalam fase eksponensial (setelah 2 jam),
fraksi sel yang diinduksi VNP2 ditunjukkan empat kali lebih besar dari fraksi sel yang
diinduksi VNP1. Sebaliknya, fraksi yang lebih tinggi dari sel yang diinduksi VNP1
diamati pada fase stasioner (0,31% 0,13%, berbeda dengan 0,001% 0,000% untuk
VNP2) (Gambar 4B). Tren yang sangat mirip diamati oleh analisis qPC lebih lanjut di
mana pembentukan DNA fag melingkar dipantau (Gbr. S4). Di sini, jumlah total DNA
VNP2 yang lebih besar dikuantifikasi dalam sel yang tumbuh secara eksponensial,
sedangkan pada fase stasioner terdeteksi jumlah yang lebih besar untuk VNP1 (Gbr.
S4). Selain itu, untuk VNP1 dan VNP2, aktivitas 2 hingga 3 kali lipat lebih tinggi (fraksi
SPI dan jumlah DNA sirkular) diamati pada masing-masing strain penghapusan (VNP1
dalam strain strainvnp2 dan VNP2 pada Δvnp1strain) (Gbr. 4Band Gambar. S4 ).
Hebatnya, berdasarkan prediksi PHASTER, sebagian besar strain V. natriegens miliki
ramalan serupa (Gbr. S2 dan S3 dan Tabel S2), dan ini menimbulkan pertanyaan
mengapa mereka Simpan. Biasanya, spesies Vibrio adalah bakteri halofilik yang dapat
mengambil DNA tentu saja. V. natriegens tidak terkecuali dan juga mampu melakukan
transformasi alami (27) Akibatnya, menyembunyikan ramalan menyebabkan pelepasan
stokastik DNA dalam Vibrio populasi dapat berkontribusi pada transfer gen horizontal
di antara spesies. Dalam 2 tahun terakhir, beberapa studi independen menyoroti potensi
V. natriegens sebagai inang untuk produksi molekul kecil (24), untuk tujuan kloning
(28), dan sebagai sistem yang menarik untuk sintesis protein bebas sel (29, 48).
Selanjutnya berbeda alat-alat untuk rekayasa genom V. natriegens yang efisien telah
ditetapkan (27, 28). Dalam penelitian terbaru, Hoffart et al. Direkayasa V. natriegens
menuju produksi asam amino L-alanin, menghasilkan strain dengan belum pernah
terjadi sebelumnya produktivitas volumetrik sekitar 34 g liter 1 jam 1 (24). Dalam
konteks ini, meningkat produksi piruvat diamati pada strain bebas-profag (40%
dibandingkan dengan tipe liar) mungkin mewakili dasar yang menjanjikan dari rekayasa
metabolisme masa depan upaya untuk sintesis produk turunan piruvat. Sebagai
kesimpulan, hasil kami menunjukkan memfasiasi strain V. natriegens yang bebas dari
profage sebagai strain platform yang menjanjikan rekayasa metabolisme masa depan
yang menampilkan pertumbuhan dan genetika yang semakin ditingkatkan ketahanan
dibandingkan dengan strain tipe liar.
MATERIAL DAN METODE Strain bakteri dan kondisi pertumbuhan. Semua strain
bakteri yang digunakan dalam pekerjaan ini tercantum dalam Tabel 1. Sel-sel
Escherichia coli diperbanyak dalam medium LB-Miller cair (triptone 10 g / liter, ragi 5
g / liter ekstrak, 10 g / liter NaCl) atau di piring agar (LB ditambah agar 15 g / liter [Carl
Roth, Karlsruhe, Jerman]) pada suhu 37 ° C. Chloramphenicol (34 - g / ml) ditambahkan
ke media, jika tidak ditunjukkan sebaliknya. V. natriegens strain dibudidayakan dalam
LBN (medium LB dengan total 15 g / liter NaCl), BHIN (infus jantung otak 37 g / liter)
[Becton, Dickinson, Franklin Lakes, NJ] ditambah 15 g / liter NaCl) atau dalam media
VN (24) [per liter, 21 g 3- (N-morpholino) asam propanesulfonat (MOPS), 5 g (NH4)
2SO4, 15 g NaCl, 1 g, KH2PO4,1gK2HPO4, 0,25 g MgSO4, 0,01 g CaCl2, 16,4 mg
FeSO4 7 H2O, 10 mg MnSO4 H2O, 0,3 mg CuSO4 5 H2O, 1 mg ZnSO4 7 H2O, 0,02
mg NiCl2 6 H2O, pH 7,5]. Untuk pelat agar, agar 15 g / liter ditambahkan dengan, jika
wajib, 15 - g / ml kloramfenikol. Kultivasi dilakukan dalam tabung reaksi (prekultur)
dan goncangan labu (budaya utama) atau dalam pelat sumur-sumur 96-sumur (VWR,
Radnor, PA) (untuk prekultur) dan 48-sumur Pelat permukaan Nunclon delta (Thermo
Fisher Scientific, Waltham, MA) (budaya utama untuk pembaca plat tes). Untuk
percobaan flaking-flask, koloni tunggal digunakan untuk menginokulasi 4 ml medium
BHIN dalam a tabung reaksi yang diinkubasi pada pengocok rotari pada 180 rpm dan 30
° C selama 2 jam. Sel-sel kemudian dipanen dari prekultur, dan pelet sel diresuspensi
dalam media yang sesuai ke OD600 0,1 (jika tidak ditunjukkan sebaliknya). Strain
dibudidayakan pada 30 ° C pada frekuensi pengocok 120 rpm. Untuk pertumbuhan tes
dilakukan di pembaca piring (Infinite M1000; Tecan, Zürich, Swiss), koloni tunggal
dipetik dan dikonsultasikan pada tahun 750 - l Media BHIN selama 2 jam pada 30 ° C
dalam pelat well-well 96-well pada 900 rpm dalam pengocok HT Microtron (Infors HT,
Bottmingen, Swiss). Selanjutnya, prekursor digunakan untuk menginokulasi kultur
utama dalam 48-well plate, dimulai dengan OD600 0,1. Suhunya sudah diatur hingga 30
° C, frekuensi pengocokan adalah 582 rpm (mode orbital; amplitudo 1), dan kepadatan
optik pada 600 nm diukur online dalam interval 10 menit. Rekombinan DNA bekerja
dan rekombinasi kromosom. Plasmid dan oligonukleotida digunakan dalam pekerjaan
ini tercantum dalam Tabel 1 dan 2. Pekerjaan kloning rutin, seperti PCR, pembatasan
plasmid, DNA pemurnian, dll, dilakukan sesuai dengan protokol yang ditetapkan (49).
Untuk PCR koloni dengan V. sel natriegens, koloni tunggal diresuspensi dalam 50 - l
H2O suling ganda dan dipanaskan selama 10 menit pada 95 ° C. Selanjutnya, sampel
disentrifugasi secara singkat (10 detik), dan 1 - l dari supernatan digunakan sebagai
template DNA genom untuk PCR. Untuk membangun plasmid, produk PCR murni dan
plasmid yang dicerna DNA dirakit sesuai dengan protokol perakitan Gibson (50).
Sintesis Oligonukleotida dan pengurutan plasmid dilakukan di Eurofins MWG Operon
(Ebersberg, Jerman).
Penghapusan kromosom pada wilayah profage 1 (posisi 935757 hingga 971809;
ukuran, 36.052 bp) telah dilakukan oleh rekombinasi homolog dengan dua - 500-bp
daerah mengapit besar menggunakan plasmid pDM4-del- vnp1 seperti yang dijelaskan
sebelumnya (51, 52). Untuk membangun pDM4-del-vnp1, pertama-tama daerah
mengapit 500-bp adalah diperkuat oleh PCR menggunakan oligonukleotida vnp1_del1
dan vnp1_del2 untuk wilayah hulu dan vnp1_del3 dan vnp1_del4 untuk wilayah hilir
500-bp. Produk PCR dimurnikan, dan backbone plasmid pDM4 dicerna dengan SacI
dan XbaI, dimurnikan, dan kemudian dikombinasikan dengan PCR melalui perakitan
Gibson. Untuk transformasi, sel-sel pir E. coli S-17 digunakan. Klon positif (dievaluasi
oleh koloni PCR) diurutkan dan digunakan untuk protokol konjugasi (51, 52). Setelah
yang terakhir langkah counterselection, klon diuji oleh koloni PCR menggunakan
oligonukleotida vnp1_del5 dan vnp1_del6. Untuk menghapus wilayah profag 2
(1496626 hingga 1535809; ukuran, 39.183 bp), racun ccdB di bawah kontrol PBAD
terintegrasi antara PN96_RS07160 dan PN96_RS07165 menggunakan pDM4-vnp2-
pBAD- ccdB plasmid. Plasmid dibuat dengan cara yang mirip dengan yang dijelaskan
untuk pDM4-del-vnp1. Di sini, dua - 500-bp daerah mengapit homolog situs integrasi
(antara PN96_RS07160 dan RS07165) digunakan untuk rekombinasi dan pemilihan
counters. Setelah rekombinasi ke 2, the tidak adanya wilayah profage 2 dikonfirmasi
oleh koloni PCR (vnp2_del_fw dan vnp2_del_rv). Catat itu Integrasi gen ccdB telah
menghasilkan isolasi strain yang secara spontan kehilangan Wilayah VNP2. Akhirnya,
penghapusan kedua wilayah profag diperiksa dengan urutan genom (lihat di bawah).
Fusi gen reporter mcherry dengan gen mcp di wilayah profag 1 dan 2 tercapai masing-
masing menggunakan plasmid pDM4-mcp-vnp1-mcherry dan pDM4-mcp-vnp2-
mcherry. Di sini, gen produk menghasilkan fusi terminal-C dari protein mCherry
dihubungkan oleh urutan linker [GL (GSGG) 3TA] (53). Untuk tujuan ini, gen mcherry
dengan urutan hulu GGTCTCGG
CTCTGGTGGAGGAAGTGGTGGAGGTTCTGGTGGCACTGCC terintegrasi dalam
bingkai ke masing-masing mcp gen (tanpa berhenti kodon). Integrasi kromosom
dilakukan dengan menggunakan homolog rekombinasi - 500-bp mengapit daerah situs
integrasi.
Persiapan sampel untuk TEM. Untuk analisis TEM, sampel disiapkan seperti yang
dijelaskan dalam Fortier dan Moineau (56). Sel tipe liar, Δvnp1, dan Δvnp2 diinduksi
dengan 1 - MMC M pada OD 0,1. Sampel 1 ml diambil setelah 3 jam dan 4 jam dan
disaring (0,22-- m ukuran pori). Sampel fag yang disaring disentrifugasi pada 16.000 g
selama 1 jam, supernatan dihilangkan dengan lembut (- 900 - l), dan 1 ml amonium
asetat (0,1 M, pH 7,5) ditambahkan. Langkah pencucian ini dilakukan dua kali. Dicuci
sampel diizinkan untuk mengadsorpsi kisi-kisi nikel berlapis karbon Formvar yang
dikeluarkan dengan cahaya (200 mesh; Maxtaform; Plano, Wetzlar, Jerman) selama 10
menit. Pada grid, sampel diwarnai dengan menempatkan a setetes 0,5% (berat / volume)
uranyl asetat dalam air suling (Science Services GmbH, Munich, Jerman). Setelah
pengeringan udara, sampel diperiksa menggunakan TEM LEO 906 (Carl Zeiss,
Oberkochen, Jerman), yang beroperasi pada tegangan akselerasi 60 kV. Kamera
perangkat 2K pengisian daya ganda kecepatan tinggi sudut ganda (14 bit; Tröndle, TRS
Moorenweis, Jerman) dan perangkat lunak analisis IMAGE SP Professional (SISPROG;
Tröndle, Moorenweis, Jerman) digunakan untuk pencitraan. Tes plak dan spot fag. Pada
OD600 0,1 dalam BHIN, sel WT diinduksi dengan 1 - MMC M Setelah 3 jam, 1 ml
supernatan diambil (5 menit, 16.000 g) dan disaring (0,22-- m ukuran pori) dan disebut
sebagai suspensi fag. Sejalan dengan budaya tipe liar, koloni tunggal yang bebas dari
profag varian (Δvnp1, Δvnp2, dan Δvnp12) digunakan untuk menginokulasi kultur
BHIN (kultur umpan) dan ditanam setidaknya 2 jam pada 30 ° C. Untuk uji plak
standar, 100 - l suspensi fag diinkubasi dengan 800 - Aku umpan budaya dan 100 - l 10
buffer fag (1 10 mM Tris-HCl, pH 7,5, 10 mM MgSO4, 0,4% [wt / vol] NaCl) ditambah
2 mM CaCl2 selama 20 menit pada suhu kamar. Pada langkah ini beberapa seri
pengenceran fag dan suspensi sel diuji. Selanjutnya, suspensi sel fag dicampur dengan 4
ml prewarmed (rendaman air pada suhu 45 ° C) agar lembut BHIN (0,5% [berat /
volume] agar) dan dituang dengan lembut pada piring BHIN. Setelah waktu
pendinginan minimal 1 jam, pelat diinkubasi pada 30 ° C dan pada hari-hari berikutnya
secara visual memeriksa plak.
Analisis untuk hasil biomassa, tingkat konsumsi glukosa, dan produk turunan glukosa.
Itu tingkat pertumbuhan (- [h 1]), hasil biomassa (YX / S [g g 1]), dan tingkat konsumsi
glukosa spesifik biomassa (qS [gg 1 jam 1]) dihitung seperti yang dijelaskan
sebelumnya (24). Pembentukan biomassa dipantau oleh menentukan OD600 atau berat
kering sel (CDW; dalam g liter 1) pada titik waktu tertentu (CDW [g liter 1] OD600
0,27) (24). Untuk penentuan kadar glukosa dan asam organik dalam cairan biakan, 2 ml
budaya dipanen dengan sentrifugasi (12.100 g, 5 menit, suhu kamar) dan supernatan
dianalisis. Konsentrasi glukosa dan piruvat ditentukan secara enzimatik sesuai dengan
referensi. id 57. Konsentrasi asam organik lainnya diukur melalui kromatografi cair
kinerja tinggi menggunakan alat Agilent 1200 series yang dilengkapi dengan asam
organik Rezex ROA H (8%) kolom (300 kali 7,8 mm; 8 - m; Phenomenex), dilindungi
oleh kolom Phenomenex SecurityGuard carbo-H (tinggi, 4 mm; diameter bagian dalam,
3.0 mm) seperti yang dijelaskan oleh Hoffart et al. (24).
Eksperimen pertumbuhan kompetitif. Untuk menganalisis kebugaran dalam kondisi
kompetitif, strain tipe liar diatur dalam rasio sel-ke-sel yang sama dengan strain Δvnp1,
Δvnp2, atau Δvnp12. Selain itu, galur Δvnp1 digabungkan dengan galur Δvnp2.
Pertumbuhan kompetitif Percobaan dilakukan di 96-well deep-well plate pada 30 ° C
dengan frekuensi pengocokan 900 rpm. Di sini, OD600 0,05 untuk setiap jenis uji
disesuaikan (mis., Setelan 1, jenis liar dan jenis Δvnp1; setup 2, tipe liar dan strain
Δvnp2, dll.) untuk menginokulasi 800-- l kultur (OD600 dari 0,1) di bawah kondisi
standar (BHI ditambah 1,5% [berat / volume] NaCl), tekanan hipo-osmotik minor (BHI
ditambah 0,5% [berat / volume] NaCl), dan kondisi hiperosmotik minor (BHI plus 2,5%
[berat / volume] NaCl). Dua kali sehari, OD600 terakhir kultur fase-stasioner diukur,
dan 4-- l alikuot dipindahkan untuk menginokulasi yang baru 800-- l kultur yang
mengandung media yang sesuai (pengenceran, 1: 200). Percobaan berlangsung selama
12 siklus budidaya. Menurut persamaan ODfinal / ODstart 2n (di mana n adalah jumlah
generasi), 90 generasi diperkirakan secara total. Sekitar 700 - l sel fase stasioner diambil
setelah siklus budidaya pertama dan terakhir. Sel dipanen (2 menit, 10.000 g) dan pelet
disimpan pada suhu 20 ° C untuk analisis lebih lanjut.
Persiapan sampel dan analisis qPCR. Komposisi kultur (fraksi dari strain tertentu)
dalam percobaan pertumbuhan kompetitif serta fraksi sel SPI-positif dikuantifikasi oleh
qPCR. Dalam percobaan SPI, sel diambil dari kultur fase eksponensial (2 jam) dan
stasioner- kultur fase (6 jam) diperbanyak dalam medium BHIN. Pelet sel diresuspensi
dalam buffer elusi BE disediakan oleh kit DNA mikroba NucleoSpin (Macherey-Nagel,
Dueren, Jerman), dan isolasi DNA genom (gDNA) dilakukan sesuai dengan protokol
pabrikan. Konsentrasi gDNA diukur menggunakan fluorometer Qubit 2.0 (Thermo
Fisher Scientific, Waltham, MA) dan disesuaikan hingga 50 ng / - l. Eksperimen qPCR
dilakukan dengan menggunakan master mix universal Luna QPCR (New England
Biolab, Ipswich, MA) dan instrumen qTOWER 2.2 (Analytik, Jena, Jerman)
menggunakan 100 ng gDNA yang disiapkan sebagai templat. Standar DNA yang sesuai
disiapkan setelah langkah PCR dengan oligonucleo pasang surut yang tercantum dalam
Tabel 2 dan ekstraksi gel berikutnya dengan gel NucleoSpin dan kit pembersihan PCR
(Macherey-Nagel, Dueren, Jerman). Konsentrasi diukur dengan fluorometer Qubit 2.0
dan disesuaikan hingga 1 ng / - l. Dari sampel ini lima 1:10 pengenceran seri disiapkan
(1 10 5ng / - l), dan 2-- l alikuot dari sampel ini digunakan sebagai standar (10 3 hingga
10 5ng / - l). Semua reaksi dijalankan duplikat teknis (R2 0,95). Sebagai wilayah
referensi genomik, 194 bp timidin kinase- gen pengkodean dari lokus PN96_RS07840
digunakan. Untuk percobaan kompetitif, genomik DNA dari strain yang bebas dari
profag dan tipe liar diambil sebagai kontrol. Tingkat DNA WT adalah dianggap 100%,
sedangkan DNA dari strain fag-bebas digunakan sebagai kontrol negatif. Rasionya
adalah dihitung menggunakan persamaan berikut: rasioΔstrain / WT N (DNAsample) /
N (DNAWT) 100. Dalam SPI percobaan, untuk menghitung fraksi sel yang
menampilkan induksi profag spontan, genomik DNA dari strain profage-free disebut
sebagai kontrol (100%) sepenuhnya diinduksi dengan menggunakan persamaan berikut:
fraksi SPI (%) N (DNAsample) / N (DNAΔvnp12) 100, di mana N (DNASample), N
(DNAΔvnp12), dan N (DNAWT) adalah jumlah DNA yang dinormalisasi yang dihitung
menggunakan nilai siklus ambang batas yang diukur dan standar DNA yang sesuai.
Normalisasi dilakukan untuk a gen kontrol genomik (penyandian timidin kinase): N
(DNAX) DNAX Referensi DNA. Untuk menentukan perbandingan fag dengan genom
bakteri (lihat Gambar. S6 dalam bahan tambahan), the jumlah genom fag yang dihitung
dari jumlah DNA fag melingkar dibagi oleh jumlah genom bakteri keseluruhan yang
diperoleh dari jumlah DNA menggunakan gen referensi. DNA dari regangan bebas-fag
digunakan sebagai kontrol negatif. Analisis ekspresi gen diferensial (RNA-Seq). Mulai
dari OD600 0,1 dalam BHIN, sel tipe liar dan tiga varian bebas-profag (Δvnp1, Δvnp2,
dan Δvnp12 strain) ditanam di 30 ° C selama 2 jam. Sel dipanen dengan sentrifugasi (10
menit pada 4.500 g, 4 ° C). Pelet itu segera dibekukan dalam nitrogen cair. Ekstraksi
RNA dilakukan dengan menggunakan kit RNeasy (Qiagen, Hilden, Jerman) seperti
yang dijelaskan sebelumnya (45). Kualitas RNA yang diperoleh pertama kali dievaluasi
dalam Agilent Tape station 2200 (Agilent Technologies, Waldbronn, Jerman) dengan
menilai integritas RNA angka (RIN). Jika nilai RIN di atas 8,0, RNA dideplesi untuk
jumlah ribosom dengan Kit pelepasan rRNA Ribo-Zero (bakteri) (Epicenter / Illumina,
Munich, Jerman). Selanjutnya, tion diverifikasi oleh elektroforesis berbasis kapiler lebih
lanjut. Untuk dua dari tiga ulangan biologis perpustakaan cDNA disiapkan dengan kit
persiapan perpustakaan emRNA TruSeq yang terdampar (Illumina, Munich, Jerman),
dan untuk satu replikasi biologis dari masing-masing strain, kit persiapan perpustakaan
NEBNext Ultra RNA untuk Illumina (NEB, Ipswich, MA) digunakan. Validasi
perpustakaan dilakukan oleh qPCR menggunakan kit kuantum perpustakaan KAPA
(Peqlab, Erlangen, Jerman) untuk perpustakaan Illumina atau, untuk NEB-based
perpustakaan, kit kuantifikasi Perpustakaan NEBNext untuk Illumina. Sequencing
paired-end dilakukan dengan kit reagen MiSeq v3 (150 siklus) dalam platform MiSeq
(Illumina, Munich, Jerman). Demultiplexed mentah membaca diunggah ke database
ArrayExpress di EMBL-EBI di bawah nomor aksesi E-MTAB- 7877. Untuk melakukan
analisis ekspresi gen diferensial (DGE), pertama bacaan mentah dipangkas kualitas dan
dipetakan terhadap urutan genom dari strain V. natriegens ATCC 14048 (RefSeq nomor
aksesi NZ_CP009977.1 dan NZ_CP009978.1) dengan CLC Genomics Workbench
(Qiagen Aarhus A / S, Aarhus, Denmark). Untuk perataan, hanya bacaan yang memiliki
kesamaan setidaknya 90% dalam 90% dari panjangnya dipertimbangkan. Sebagai
langkah berikutnya, bacaan yang dipetakan dinormalisasi menggunakan transkrip per
juta metode. Analisis DGE dilakukan dengan CLC Genomics diimplementasikan alat
untuk analisis DGE empiris (EDGE) dengan nilai cutoff P 0,05 dan tingkat deteksi palsu
0,05 Genomik komparatif dari VNP1 dan VNP2. Genom untuk semua 5.730 Vibrio sp.
Yang tersedia untuk umum genom diekstraksi dari SRA dan dikumpulkan (Januari
2018). Kumpulan genom disimpan di Enterobase.warwick.ac.uk. Setiap genom dicari
untuk ramalan menggunakan PHASTER API (34). Untuk masing-masing genom urutan
nubuat utuh, tidak lengkap, dan dipertanyakan diekstraksi. Untuk cepat mencari semua
elemen ramalan, sketsa MASH dari setiap urutan ramalan dibuat menggunakan
parameter berikut: sketsa -k 21 -s 1000 (61). Fag yang mirip dengan VNP1 dan VNP2
dicari untuk menggunakan Mash (61). Urutan profag mirip dengan VNP1 dan VNP2
diekstraksi dan dijelaskan menggunakan Prokka (62) dengan database kustom yang
dibangun dari protein yang diekstraksi dari semua fag (Januari 2018). Urutan profag
dibandingkan menggunakan nucmer –maxgap 500 –minclus- ter 100. Clustering
dilakukan dan heatmap diambil menggunakan heatmaply (63). Inti rata-rata identitas
otide (ANI) dihitung menggunakan autoANI (64). Pernyataan akses data. Semua data
yang mendukung temuan penelitian ini dimasukkan dalam naskah (atau file tambahan)
atau dapat disediakan oleh penulis yang sesuai atas permintaan.
BAB III. KEUNGGULAN dan KELEMAHAN PENELITIAN

A. KEUNGGULAN
a. Kegayutan antar elemen
Memiliki gambar dan grafik penelitian serta penjelasan dari tabel tentang Plastics:
Environmental and Biotechnological Perspectives on Microbial Degradation” and
Generation of a Prophage-Free Variant of the Fast-Growing Bacterium Vibrio
natriegens”
b. Originalitas temuan
Temuan-temuan dalam penelitian ini memang dapat kita lihat dari mana kita dapatkan
sumbernya di mana sumber ataupun otak pemikirnyalah kita dapat melihat keaslian
penelitian seperti halnya saya mencari jurnal ini melalui berberapa sumber seperti internet
serta daftar pustaka. Temuan-temuan dalam penelitian cukup original dan sederhana
karena berbentuk sistematis terhadap teori sehingga pembaca mengerti terhadap jurnal
tersebut kemudia bukti untuk memuktahirkan hasil temuan materi
c. Kemutakhiran masalah
Hal kemutakhiran masalah-masalah yang ada dalam jurnal tersebut menjelaskan di mana
sangat membangun untuk peningkatan yang positif dalam meneliti dan dari beberapa
penjelasan permasalahan yang menganalisis :
Jurnal I : penghapusan plastik dari lingkungan menggunakan enzim mikroba
Jurnal II : varian generasi bebas vaksinasi bakteri cepat tumbuh vibrio nitriegens
d. Kohesi dan koherensi isi penelitian
kalimat yang digunakan adalah baku dan mudah dipahami sehingga pembaca mudah
memahami dalam jurnal tersebut. Memiliki teori perkembangn anak yang sistematis dan
memiliki keterkaitan secara padu dan utuh.
B. KELEMAHAN
a. Kegayutan antar elemen
hanya sedikit kelemahan pada isi jurnal tersebut karena isi jurnal tersebut merupakan
penelitian yang dilakukan oleh sekelompok orang serta memiliki tabel-tabel dan
penejelesan yang berkaitan dan padu.
b. Originalitas temuan
Pada kelemahan di bagian Originalitas temuan tidak ada karena jurnal ini bersifat
Internasional dan memiliki website serta ISSN.
c. Kemuktahiran Masalah
Dalam kemukhtahiran masalah pada jurnal adalah hanya mencondong ke konsep teori
dan penemuan-penemuan. Tidak ada menjelaskan contoh permasalahan yang sekarang ini
d. Kohesi dan Koherensi isi Penelitian
Dari jurnal tersebut memiliki gagasan yang mengacu pada penelitian saja konsep-konsep
BAB IV. IMPLIKASI

a. Teori
Teori-teori yang disajikan dalam jurnal utama ini sangat mendalam yaitu
Jurnal I : penghapusan plastik dari lingkungan menggunakan enzim mikroba
Jurnal II :varian generasi bebas vaksinasi bakteri cepat tumbuh vibrio nitriegens
juga aplikasi-aplikasi dalam kehidupan sehari-hari nya juga dijelaskan sehingga jika
ingin menerapkan nya langsung atau mempraktekkan nya langsung maka dapat
menjadikan jurnal ini sebagai referensi yang cukup kuat.
b. Program pembangunan di Indonesia
Pada jurnal I penghapusan plastik dari lingkungan menggunakan enzim mikroba telah
menjadi fokus penelitian terbaru. Tantangan utama adalah bahwa plastik yang
dipindahkan di laut dan terestrial sangat stabil dan tahan lama. Pada jurnal I
Ikonstruksi dan karakterisasi varian bebas profag dari V. natriegensATCC 14048.
Dalam studi ini, kami menghasilkan varian V. natriegens yang bebas-penaburan.
strain yang bebas dari profage menunjukkan toleransi yang lebih tinggi terhadap
kerusakan DNA dan tekanan hypoosmotic.
c. Pembahasan dan Analisis
Setelah melakukan kritikan terhadap jurnal ini maka menurut analisis saya implikasi
dari jurnal ini ialah bahwa jurnal ini sangat cocok digunakan jika ingin mengetahui
penghapusan plastik dari lingkungan menggunakan enzim mikroba dan varian
generasi bebas vaksinasi bakteri cepat tumbuh vibrio nitriegens karena pendalaman
materi nya yang cukup luas mulai dari penurunan-penurunan rumus yang dilengkapi
dengan gambar- gambar yang mendukung pemahaman pengguna ketika membaca dan
memahami buku ini.
BAB V. PENUTUP
A. Simpulan
Pada jurnal I : penghapusan plastik dari lingkungan menggunakan enzim mikroba
dan enzim untuk menghasilkan mikroorganisme yang akan menghasilkan senyawa
bernilai tinggi dari limbah plastik adalah tantangan di masa depan dan akan
berkontribusi pada peningkatan penggunaan plastik bundar.
Pada jurnal II : Bakteri laut yang tumbuh cepat, Vibrio natriegens, mewakili
inang model yang baru muncul untuk biologi molekuler dan bioteknologi. Varian
bebasprofag dari V. natriegensas strain platform yang menjanjikan untuk aplikasi
bioteknologi di masa depan.

B. Saran
Untuk kedepannya atau selanjutnya kelemahan-kelemahan atau pun kekurangan
setiap jurnal ini perlu diperbaiki supaya lebih baik lagi dimanfaatkan ataupun
digunakan pembaca sebagai refrensi dalam penelitian-penelitian ataupun untuk
kegunaan lainnya.
DAFTAR PUSTAKA

Danso, D., Chow, J., dan Streita, W. R. (2019). Plastics: Environmental and
Biotechnological Perspectives on Microbial Degradation. Applied and
Environmental Microbiology. Vol. 85 (19): 1-14

Pfeifer, E. Dkk. (2019). Generation of a Prophage-Free Variant of the Fast-Growing


Bacterium Vibrio natriegens. Applied and Environmental Microbiology. Vol. 85
(17): 1-17