Anda di halaman 1dari 8

Desarrollo

1)

A) ¿Cómo están conformados los nucleótidos?

Todos los nucleótidos tienen una estructura similar, están formados por tres moléculas más
pequeñas: una molécula de ácido fosfórico, una pentosa y una base nitrogenada. La pentosa: Es un
tipo de azúcar que tiene 5 átomos de carbono.

B) ¿Qué es un codón y anticodón?

La información genética, en el ARN, se escribe a partir de cuatro letras, que corresponden a las bases
nitrogenadas (A, C, G y U), formando largas sucesiones de tripletes (conjunto de tres nucleótidos
adyacentes). En el ARN, cada uno de estos tripletes consecutivos no solapados se denomina codón
mientras Un anticodón es la secuencia de tres nucleótidos complementaria a una
secuencia de otros tres nucleótidos que se encuentran en el ARN mensajero
(ARNm)

C) ¿Qué es un gen?

Un gen es una unidad de información en un locus de ácido desoxirribonucleico que codifica un


producto funcional, como por ejemplo proteínas. Es la unidad molecular de la herencia genética,
pues almacena la información genética y permite transmitirla a la descendencia

D) ¿Qué puede suceder si hay un error en la replicación del ADN?

Todo el tiempo ocurren errores de replicación y daños al ADN en las células de nuestro cuerpo. Sin
embargo, en la mayoría de los casos no causan cáncer, ni siquiera mutaciones. Eso es porque suelen
detectarse y repararse por mecanismos de corrección y reparación del ADN. Si por el contrario, el
daño no se puede reparar, la célula experimentará muerte celular programada (apoptosis) para
evitar heredar el ADN defectuoso.
2) En la hoja

3) Explica con un esquema sencillo como ocurre el proceso de clonación


4) Explica

A) ¿Qué opinas sobre la influencia de los factores ambientales en la modulación de genes


y las consecuencias en la salud?

Que el ambiente si se sigue contaminando nos puede generar mutaciones afectando a los
genes y ADN y como resultado generando cancer

B) ¿Qué diferencias existen entre el genotipo y el fenotipo?

La diferencia entre genotipo y fenotipo es que el genotipo se puede distinguir observando el ADN, y
el fenotipo puede conocerse por medio de observar la apariencia externa de un organismo.

5) Indica que aminoácidos se producirán a partir de las siguientes secuencias de ADN

5’ TACCGACCGAATTATCGGCATGTTCGTTTCATC 3’

R: AUG GCU GGC UUA AUA GCC GUA CAA GCA AAG UAG
MET ALA GLI LEU LIE ALA VAL GLN ALA LIS PARA
6) Con bases a los imanes explica

A) ¿Cómo está conformado el nucleótido?

Todos los nucleótidos tienen una estructura similar, están formados por tres moléculas más
pequeñas: una molécula de ácido fosfórico, una pentosa y una base nitrogenada. La pentosa: Es un
tipo de azúcar que tiene 5 átomos de carbono.

B) ¿Cuáles son los pares de bases que conforman la molécula?

Un Par de bases consiste en dos nucleótidos opuestos y complementarios en las cadenas de ADN y
ARN que están conectadas por puentes de hidrógeno. En el ADN, adenina y timina así como guanina
y citosina pueden formar un par de bases.

C) ¿Qué importancia tienen los puentes de hidrógenos en una molécula?

La noción de puente de hidrógeno se emplea en el ámbito de la química. El concepto refiere a una


clase de enlace que se produce a partir de la atracción existente en un átomo de hidrógeno y un
átomo de oxígeno, flúor o nitrógeno con carga negativa.
7) Dada la siguiente secuencia de bases de una porción de ADN en cada cadena
complementaria
ATGGTATGGATGCTATATTCCGTTTACCATACCTACGATATAAGGCAA

A) Esta secuencia pásela a ARNm

UACCAUA CCUACGA UAUAAGGC AAAUGGUAU GGAUG CAAUA UUCCGUU

B) Pasar de ARNm a traducción de aminoácido

AUGGUAUGGAUGCUAUAUUCCGUUUAGGAUACCUACGUUAUAAGGCAA

8)

Especie A) (29,3+29,2) / (21,4+21,2) = 1,37

Especie B) (24,6+32) / (26+25,8) = 1,092

Especie C) (32,1+32) / (17,7+17,6) = 1,815


9) En un ADN aislado de una determinada especie una de las hebras o cadenas de su doble
hélice es

5’ AACGGAATATAGC 3’

A) ¿Pasa las bases de la hebra a complementaria?

3’ TTGCCTTATATCG 5’

10) las siguientes secuencias de ARNm daria lugar a la de aminoacidos indicados

UCG CGA CCA GAA AAU AAG GUU GCG

A) ¿qué efectos tuviera si se hace la inserción de una citocina en el principio de la cadena?

Si se inserta una de citocina a la cadena modificaría los tipos de aminoácidos cambiándolos

Y dando un resultado algo diferente.

B) ¿Qué efectos tuviera si se hace una inserción de una adenina al principio de ARNm?

Si se inserta una de citocina a la cadena modificaría los tipos de aminoácidos cambiándolos

Y dando un resultado algo diferente.


11)

A) ¿qué es una mutación?

Una mutación es el cambio al azar en la secuencia de nucleótidos o en la organización del ADN de un


ser vivo, que produce una variación en las características de este y que no necesariamente se
transmite a la descendencia. Se presenta de manera espontánea y súbita o por la acción de
mutágenos

B) ¿Cuáles son los agentes mutagénicos?

Mutágenos químicos

Los mutágenos de naturaleza química incluyen las siguientes clases de químicos: acridinas,
nitrosaminas, epóxidos, entre otros. Existe una subclasificación para estos agentes en:

Bases análogas

Las moléculas que presentan similitud estructural con las bases nitrogenadas tienen la capacidad de
inducir mutaciones; entre los más comunes están el l 5-bromouracilo y la 2-aminopurina.

Agentes que reaccionen con el material genético

El ácido nitroso, la hidroxilamina y una serie de agentes alquilantes reaccionan de manera directa en
las bases que forman el ADN y pueden cambiar de purina a pirimidina y viceversa.

Agentes intercalentes

Existen una serie de moléculas como las acridinas, bromuro de etidio (muy usado en los laboratorios
de biología molecular) y la proflavina, que tienen una estructura molecular plana y logran ingresar a
la hebra de ADN.

Reacciones oxidativas

El metabolismo normal de la célula tiene como producto secundario una serie de especies reactivas
del oxígeno que dañan a las estructuras celulares y también al material genético.
Mutágenos físicos

El segundo tipo de agentes mutagénicos son físicos. En esta categoría encontramos a los diferentes
tipos de radiación que afectan al ADN.

Mutágenos biológicos

Por último, tenemos a los mutantes biológicos. Son organismos que pueden inducir mutaciones
(entre ellas anomalías a nivel de los cromosomas) en virus y otros microorganismos.

C) El descubrimiento de Barbara McClintock

si debido que gracias a este hubo nuevas investigaciones relacionadas con las alteraciones genéticas
como las mutaciones y aunque hubo algunos textos anteriormente no eran tan concrestos como el
de la genetista estadounidenses

12) ¿calcula los nucleótido de cada animal?

Pez: 4x10^-27

Planta Superior: 5x10^-27

Bacteria:1x10^-28

13) Responde según la siguiente cadena de ADN

ATGGTGTGGGTGCTATATTCCGTT

A) Estructura complementaria de la cadena del ADN

TACCACACCCACGATATAAGGCAA

B) Pásala a ARNm

UACCACACCCACGAUAUAAGGCAA