Synthetic Chemical Probes That Dissect Vitamin D Activities

Supporting Information for
Synthetic Chemical Probes That Dissect Vitamin D Activities
Akiko Nagata,§,† Yusuke Akagi,§,† Lisa Asano,∫,† Kenjiro Kotake,∫ Fumihiro Kawagoe,‡ Aileen
Mendoza,∫ Shadi Sedghi Masoud,§ Kosuke Usuda,§ Koji Yasui,§ Yasushi Takemoto,∫ Atsushi
Kittaka,‡,* Kazuo Nagasawa,§,* and Motonari Uesugi∫,∥,€,$,*
§
Department of Biotechnology and Life Science, Graduate School of Technology, Tokyo University of
Agriculture and Technology, 2-24-16, Naka-cho, Koganei city, 184-8588, Tokyo, Japan
∫
Institute for Chemical Research, Kyoto University, Uji, Kyoto 611-0011, Japan
‡
Faculty of Pharmaceutical Sciences, Teikyo University, 2-11-1 Kaga, Itabashi, Tokyo 173-8605, Japan
∥Institute for Integrated Cell-Material Sciences (WPI-iCeMS), Kyoto University, Uji, Kyoto 611-0011,
Japan
€
CREST, AMED
$
School of Pharmacy, Fudan University, Shanghai 201203, China
Table of Contents
1. Experimental procedures for synthesis and characterization of compounds

1.1 General S2
1.2 Synthesis of compounds and characterization of the compounds S3-S35
2. Experimental procedure for biological experiments and material information S36-S43
3. 1H and 13C NMR spectra for compounds 11-38f, S8a-S13b S44-S92
S1
1. Experimental procedure for synthesis and characterization of compounds
1.1 General
Unless otherwise stated, reactions were performed under an argon atmosphere using freshly
dried solvents. All reactions were monitored by thin-layer chromatography using Merck silica gel
60 F254 pre-coated plates (0.25 mm) and were visualized by UV, p-anisaldehyde staining. Flash
column chromatography was performed under pressurization using silica gel (particle size 40-100
m) purchased from Cica or NH silica gel (NH-DM1020) purchased from FUJI SILYSIA
CHEMICAL LTD. For preparative TLC was used Merck silica gel 60 F254 pre-coated plates (0.50
mm). Optical rotations were measured on a JASCO P-2200 polarimeter. 1H and 13C NMR spectra
were recorded on JNM-AL 300 or JNM-ECX 400 or JNM-ECZ400S or ECA 500. The spectra
are referenced internally according to residual solvent signals of CDCl3 (1H NMR;  = 7.26 ppm,
13
C NMR;  = 77.0 ppm) or CD3OD (1H NMR;  = 3.31 ppm, 13C NMR;  = 49.0 ppm). Data for
1
H NMR are recorded as follows: chemical shift (, ppm), multiplicity (s, singlet; d, doublet; t,
triplet; q, quartet; m, multiplet; br, broad), coupling constant (Hz), integration. Data for 13C NMR
are reported in terms of chemical shift (, ppm). Mass spectra were recorded on JEOL JMS-
T100X spectrometer with ESI-MS mode using methanol as solvent.
S2
1.2 Synthesis of compounds and characterization of the compounds
Compound S3
S1
S2
S3
To a solution of S1[1] (64.0 mg, 0.136 mmol) and S2[1] (39.3 mg, 0.0896 mmol) in toluene (0.9
mL) and Et3N (0.9 mL) was added Pd(PPh3)4 (20.7 mg, 0.0179 mmol, 20 mol%) at room
temperature, then the reaction mixture was heated at 90 °C. After stirring for 5 h, the reaction
mixture was filtered through a pad of silica gel column and the filtrate was concentrated in vacuo.
The residue was chromatographed on silica gel (n-hexane/ethyl acetate; 10:1) to give S3 (12.4
mg, 17%). S3: []26D = -48.7 (c 1.5 in CHCl3); 1H NMR (300 MHz, CDCl3)  8.20-8.11 (m, 1H),
7.90-7.80 (m, 1H), 7.78-7.66 (m, 2H), 6.29 (d, J = 11.0 Hz, 1H), 5.74 (d, J = 11.3 Hz, 1H), 5.36
(d, J = 8.3 Hz, 1H), 4.98 (s, 1H), 4.79 (s, 1H), 4.32-4.18 (m, 1H), 4.10-3.98 (m, 1H), 2.84-2.70
(m, 1H), 2.42 (dd, J = 13.7, 3.8 Hz, 1H), 2.20 (dd, J = 13.4, 7.6 Hz, 1H), 2.06-1.10 (m, 29H), 0.95
(t, J = 7.9 Hz, 9H), 0.93 (d, J = 6.5 Hz, 3H), 0.85 (s, 9H), 0.57 (q, J = 7.9 Hz, 6H), 0.53 (s, 3H),
0.04 (s, 3H), 0.005 (s, 3H); 13C NMR (75 MHz, CDCl3)  147.7, 144.0, 143.2, 134.6, 133.3, 132.8,
132.1, 130.8, 125.2, 125.0, 116.7, 112.9, 73.4, 66.7, 56.5, 56.2, 55.7, 45.8, 45.4, 42.8, 40.4, 36.4,
36.0, 30.0, 29.7, 28.9, 27.5, 25.7, 23.5, 22.1, 20.7, 18.7, 18.0, 11.8, 7.1, 6.7, -4.8, -4.9 ppm; HRMS
(ESI) m/z calcd for C45H76N2NaO6SSi2: 851.4860 [M+Na]+; found: 851.4843.
Compounds 12-16
S3
PPh3 (2.0 equiv.), ROH (3 equiv.) and DIAD (2.0 equiv.) were added to a solution of nosyl amine
S3 in THF (0.05 M) at room temperature. The reaction mixture was quenched by H 2O. The
aqueous layer was extracted with ethyl acetate three times. The combined layer was washed with
brine, dried over MgSO4, and concentrated in vacuo. The residue was chromatographed on silica
gel to give alkylated nosyl amine. To a solution of 1-dodecanethiol (2.0 equiv.) in diethyl ether
S3
(0.15 M) was added sodium hydride (1.9 equiv.) at 0 °C and stirred for 30 min. To the suspension
was added a solution of above alkylated nosyl amine in diethyl ether (0.076 M). The reaction was
quenched by H2O. The aqueous layer was extracted with ethyl acetate three times. The combined
organic layer was washed with brine, dried over MgSO4, and concentrated in vacuo. The residue
was chromatographed on silica gel to give alkyl amine. HF·Py (100 equiv.) was added to a
solution of alkyl amine in THF (0.017 M) at room temperature. The reaction mixture was
quenched by sat. NaHCO3 aq. The aqueous layer was extracted with ethyl acetate three times.
The combined organic layer was washed with brine, dried over MgSO4, and concentrated in vacuo.
The residue was chromatographed on silica gel to give 12-16, respectively.
12: yield: 36% (3 steps); []23D = +79.7 (c 0.27 in CHCl3); 1H NMR (300 MHz, CDCl3)  6.38 (d,
J = 11.4 Hz, 1H), 5.98 (d, J = 11.4 Hz, 1H), 5.12 (d, J = 2.1 Hz, 1H), 4.97
(d, J = 2.4 Hz, 1H), 4.05-4.12 (m, 1H), 3.33 (t, J = 4.3 Hz, 1H), 2.82 (dd,
J = 11.7, 3.8 Hz, 1H), 2.47-2.71 (m, 3H), 2.17-2.28 (m, 1H), 1.25-2.09 (m,
24H), 1.21 (s, 6H), 1.08 (t, J = 7.2 Hz, 3H), 0.94 (t, J = 6.5 Hz, 3H), 0.52
(d, J = 10.3 Hz, 3H); 13
C NMR (125 MHz, CDCl3) 145.60, 143.05,
133.50, 130.88, 128.81, 124.61, 116.91, 113.47, 71.10, 66.83, 60.16, 56.51, 56.29, 46.35, 45.90,
44.38, 41.98, 41.81, 40.59, 36.39, 36.08, 29.65, 29.20, 28.99, 27.68, 23.52, 22.21, 20.83, 18.80,
14.91, 11.89 ppm; HRMS (ESI) m/z calcd for C29H50NO2: 444.3842 [M+H]+; found: 444.3832.
13: yield: 36% (3 steps); []23D = +72.8 (c 0.34 in CHCl3); 1H NMR (300 MHz, CDCl3)  6.38
(d, J = 11.0 Hz, 1H), 5.98 (d, J = 11.4 Hz, 1H), 5.13 (d, J = 2.4 Hz, 1H),
4.98 (d, J = 2.4 Hz, 1H), 4.05-4.11 (m, 1H), 3.31 (t, J = 4.0 Hz, 1H), 2.79-
2.84 (m, 1H), 2.57-2.63 (m, 2H), 2.43-2.51 (m, 1H), 2.23 (t, J = 11.2 Hz,
1H), 1.65-2.12 (m, 15H), 1.25-1.59 (m, 9H), 1.21 (s, 6H), 0.74-0.94 (m,
8H), 0.52 (d, J = 10.3 Hz, 3H); 13C NMR (125 MHz, CDCl3)  145.65,
142.86, 133.56, 124.58, 117.06, 113.53, 71.09, 66.84, 60.28, 56.46, 56.27, 47.44, 46.29, 45.87,
44.38, 42.03, 40.48, 36.39, 36.11, 32.06, 29.36, 29.22, 28.96, 27.68, 23.48, 22.22, 20.80, 20.65,
18.80, 14.02, 11.87 ppm; HRMS (ESI) m/z calcd for C31H54NO2: 472.4155 [M+H]+; found:
472.4170.
S4
14: yield: 38% (3 steps); []24D = +64.0 (c 0.90 in CHCl3); 1H NMR (300 MHz, CDCl3)  6.41
5.01 (d, J = 2.1 Hz, 1H), 4.10-4.18 (m, 1H), 3.39 (d, J = 4.1 Hz, 1H), 2.83
(d, J = 11.7 Hz, 1H), 2.56-2.66 (m, 2H), 2.20-2.40 (m, 4H), 1.60-2.04 (m,
5H), 1.25-1.51 (m, 22H), 1.21 (s, 6H), 0.93 (d, J = 6.5 Hz, 3H), 0.52 (s,
3H); 13
C NMR (125 MHz, CDCl3)  144.78, 143.33, 133.06, 124.92,
116.96, 114.42, 71.11, 66.49, 60.21, 56.52, 56.24, 52.68, 46.15, 45.92, 44.40, 41.71, 40.48, 36.40,
36.09, 29.36, 29.20, 28.93, 27.67, 23.43, 22.26, 20.84, 18.77, 11.95, 10.66, 3.73, 3.52 ppm;
HRMS (ESI) m/z calcd for C31H52NO2: 470.3998 [M+H]+; found: 470.3980.
J = 11.4 Hz, 1H), 6.02 (d, J = 11.4 Hz, 1H), 5.16 (d, J = 2.1 Hz, 1H), 4.98
(d, J = 2.1 Hz, 1H), 4.08-4.14 (m, 1H), 3.64-3.70 (m, 1H), 3.34 (t, J = 4.3
Hz, 1H), 2.44-2.84 (m, 10H), 1.25-2.28 (m, 25H), 1.21 (s, 7H), 0.85-0.96
(m, 5H), 0.53 (d, J = 10.3 Hz, 3H); 13C NMR (125 MHz, CDCl3) 146.12,
142.68, 133.84, 124.20, 117.18, 113.61, 71.17, 67.95, 66.70, 60.28, 57.52,
56.49, 56.27, 50.97, 46.22, 45.84, 44.30, 42.06, 40.44, 36.35, 36.02, 34.54, 34.45, 29.26, 29.21,
28.91, 27.73, 23.49, 22.31, 20.91, 18.85, 12.08 ppm; HRMS (ESI) m/z calcd for C33H57N2O3:
529.4369 [M+H]+; found: 529.4354.
16 : yield: 20% (3 steps); []23D = +42.4 (c 0.32 in CHCl3); 1H NMR (300 MHz, CDCl3) 6.38
(d, J = 11.4 Hz, 1H), 5.98 (d, J = 11.4 Hz, 1H), 5.21 (s, 1H), 5.04 (s, 1H),
4.15 (t, J = 4.6 Hz, 1H), 3.68 (t, J = 4.5 Hz, 3H), 3.45 (s, 1H), 2.44-2.83
(m, 11H), 1.83-2.30 (m, 12H), 1.69 (t, J = 11.9 Hz, 2H), 1.25-1.52 (m,
10H), 1.20 (d, J = 9.6 Hz, 8H), 0.94 (t, J = 6.7 Hz, 4H), 0.50 (s, 3H); 13C
NMR (100 MHz, CDCl3)  143.31, 133.23, 124.56, 116.98, 114.53,
71.08, 70.54, 66.92, 66.38, 60.22, 57.38, 56.45, 56.22, 53.49, 45.99, 45.80, 44.36, 43.31, 41.49,
40.37, 36.35, 36.07, 29.68, 29.35, 29.16, 28.90, 27.64, 23.43, 22.32, 20.81, 18.79, 12.06 ppm;
HRMS (ESI) m/z calcd for C34H59N2O3: 543.4526 [M+H]+; found: 543.4491.
S5
Compound S4
S3 S4
To a solution of 1-dodecanethiol (4.0 L, 17 mol) in diethyl ether (100 L) was added sodium
hydride (60% oil dispersion, 1.0 mg, 25 mol) at 0 °C and stirred for 30 min. To the suspension
was added nosyl amine S3 (7.8 mg, 9.4 mol) in diethyl ether (100 L), then the reaction mixture
was warmed to room temperature. After additive 2 h, the reaction was quenched by H2O. The
aqueous layer was extracted with ethyl acetate three times. The combined organic layer was
washed with brine, dried over MgSO4, and concentrated in vacuo. The residue was
chromatographed on silica gel (n-hexane/ethyl acetate; 4:1 to 1:1) to give amine S4 (4.6 mg, 76%).
S4: []28D = +29.9 (c 1.3 in CHCl3); 1H NMR (300 MHz, CDCl3)  6.26 (d, J = 11.0 Hz, 1H), 5.99
(d, J = 11.3 Hz, 1H), 5.14 (s, 1H), 4.86 (s, 1H), 4.16-4.05 (m, 1H), 3.68-3.58 (m, 1H), 2.81 (d, J
= 11.7 Hz, 1H), 2.44 (dd, J = 13.1, 3.4 Hz, 1H), 2.35-0.60 (m, 25H), 1.17 (s, 6H), 0.93 (t, J = 7.9
Hz, 9H), 0.86 (s, 9H), 0.55 (q, J = 7.6 Hz, 6H), 0.53 (s, 3H), 0.053 (s, 3H), 0.048 ppm (s, 3H);
13
C NMR (75 MHz, CDCl3)  150.2, 141.8, 134.6, 123.6, 117.4, 109.9, 73.4, 67.3, 56.5, 56.3,
52.3, 46.3, 45.8, 45.5, 44.3, 40.5, 36.4, 36.1, 30.0, 29.8, 28.9, 27.6, 25.8, 23.5, 22.3, 20.8, 18.8,
18.1, 12.0, 7.1, 6.7, -4.7, -4.8 ppm; HRMS (ESI) m/z calcd for C39H74NO2Si2: 644.5258 [M+H]+;
found: 644.5213.
Compounds 11, 17, and 19-30
S4
To a solution of amine S4 in CH2Cl2 (0.04 M) was added Et3N (2.5 equiv.) and R-Cl (1.2 equiv.)
at -20 °C. The reaction mixture was quenched by sat. NaHCO3 aq. The aqueous layer was
extracted with ethyl acetate three times. The combined organic layer was washed with brine, dried
over MgSO4, and concentrated in vacuo. The residue was chromatographed on silica gel to give
S6
silyl-protected. To a solution of silyl-protected in THF (0.037 M) was added 3HF·Et3N (120
equiv.) at room temperature. The reaction mixture was quenched with sat. NaHCO3 aq. The
washed with brine, dried over MgSO4, and concentrated in vacuo. The residue was
chromatographed on silica gel to give 11, 17 and 19-30, respectively.
11: yield: 54% (2 steps); []22D = +4.5 (c 0.40 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.36 (s,
5H), 6.36 (d, J = 11.0 Hz, 1H), 5.97 (d, J = 11.7 Hz, 1H), 5.23 (s, 1H),
5.11 (d, J = 4.8 Hz, 1H), 4.97 (s, 1H), 4.53 (s, 1H), 4.11 (t, J = 7.1 Hz,
1H), 2.78-2.83 (m, 1H), 2.53-2.59 (m, 1H), 2.32 (q, J = 6.5 Hz, 1H),
1.88-2.05 (m, 11H), 1.25-1.74 (m, 12H), 1.22 (s, 7H), 0.93 (d, J = 6.2
Hz, 3H), 0.53 (t, J = 6.5 Hz, 3H); 13C NMR (100 MHz, CDCl3)  155.38,
144.72, 143.71, 136.39, 132.38, 128.55, 128.19, 125.28, 116.86, 112.33,
71.10, 66.82, 66.74, 56.49, 56.31, 51.58, 45.93, 44.98, 44.38, 41.25, 40.42, 36.36, 36.08, 29.35,
29.22, 29.09, 27.63, 23.61, 22.24, 20.78, 18.79, 11.93 ppm; HRMS (FAB) m/z calcd for
C35H51NO4Na: 572.3716 [M+Na]+; found: 572.3717.
J = 11.4 Hz, 1H), 5.95 (d, J = 11.7 Hz, 1H), 5.36 (s, 1H), 5.06 (s, 1H),
4.30 (d, J = 8.3 Hz, 3H), 4.09 (s, 1H), 2.84 (s, 1H), 2.58 (d, J = 4.1 Hz,
1H), 2.32 (d, J = 7.6 Hz, 1H), 1.96-2.03 (m, 5H), 1.73 (d, J = 15.8 Hz,
2H), 1.25-1.47 (m, 15H), 1.21 (s, 8H), 0.93 (d, J = 6.2 Hz, 3H), 0.53 (d,
J = 4.1 Hz, 3H); 13C NMR (100 MHz, CDCl3)  144.59, 144.54, 131.89,
131.74, 125.45, 116.36, 115.45, 113.51, 71.12, 66.32, 56.65, 56.29, 54.91, 50.68, 46.01, 45.19,
44.35, 42.54, 41.94, 40.38, 36.34, 36.04, 29.69, 29.37, 29.20, 29.06, 27.58, 23.57, 22.24, 20.78,
18.77, 12.10, 12.03 ppm; HRMS (ESI) m/z calcd for C28H47NO4SNa: 516.3124 [M+Na]+; found:
516.3139.
19: yield: 42% (2 steps); []22D = -45.6 (c 0.97 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.75 (d,
J = 8.3 Hz, 2H), 7.29 (d, J = 8.6 Hz, 2H), 6.32 (d, J = 11.0 Hz, 1H), 5.73
(d, J = 11.0 Hz, 1H), 4.88 (s, 1H), 4.78 (d, J = 7.2 Hz, 1H), 4.59 (d, J =
8.6 Hz, 1H), 4.06-4.15 (m, 2H), 2.75-2.79 (m, 1H), 2.50 (dd, J = 13.4,
3.1 Hz, 1H), 2.17-2.27 (m, 1H), 1.82-2.07 (m, 5H), 1.28-1.69 (m, 7H),
1.22 (s, 6H), 0.94 (d, J = 6.2 Hz, 3H), 0.53 (s, 3H); 13C NMR (100 MHz,
CDCl3)  162.56, 143.96, 143.85, 143.3, 137.83, 132.13, 129.62, 127.0,
125.33, 116.54, 113.0, 71.10, 66.37, 56.52, 56.27, 54.2, 45.92, 44.7, 44.35, 42.4, 40.4, 36.40,
S7
36.10, 29.34, 29.18, 29.10, 27.60, 23.50, 22.20, 21.60, 20.80, 18.76, 11.98 ppm; HRMS (FAB)
m/z calcd for C34H51NO4SNa: 592.3437 [M+Na]+; found: 592.3433.
20: yield: 50% (2 steps); []23D = -19.2 (c 0.37 in CHCl3); 1H NMR (400 MHz, CDCl3)  6.38 (d,
J = 11.4 Hz, 1H), 5.97 (d, J = 11.0 Hz, 1H), 5.37 (d, J = 8.7 Hz, 1H), 5.20
(s, 1H), 4.96 (s, 1H), 4.77 (dd, J = 14.2, 6.4 Hz, 1H), 4.09 (d, J = 15.1
Hz, 1H), 2.80-2.83 (m, 1H), 2.56-2.60 (m, 1H), 2.33 (q, J = 6.6 Hz, 1H),
1.82-2.17 (m, 10H), 1.25-1.72 (m, 12H), 1.22 (d, J = 6.4 Hz, 6H), 0.81-
0.97 (m, 6H), 0.53 (d, J = 6.9 Hz, 3H); 13C NMR (125 MHz, CDCl3) 
168.98, 144.44, 143.90, 132.46, 125.26, 116.78, 112.39, 71.10, 66.91, 56.47, 56.29, 50.06, 45.94,
45.15, 44.38, 40.94, 40.40, 36.34, 36.09, 30.93, 29.34, 29.22, 29.11, 27.61, 23.64, 23.51, 22.24,
20.78, 18.79, 11.90 ppm; HRMS (ESI) m/z calcd for C29H47NO3Na: 480.3454 [M+Na]+; found:
480.3458.
21: yield: 72% (2 steps); []22D = -9.2 (c 0.13 in CHCl3); 1H NMR (300 MHz, CDCl3)  6.39 (d,
J = 11.4 Hz, 1H), 5.96 (d, J = 11.7 Hz, 1H), 5.33 (d, J = 8.6 Hz, 1H), 5.20
(s, 1H), 4.95 (s, 1H), 4.78 (d, J = 6.9 Hz, 1H), 4.08 (s, 1H), 2.78-2.84 (m,
1H), 2.56-2.61 (m, 1H), 2.17-2.35 (m, 4H), 1.89-2.04 (m, 6H), 1.67 (dd,
J = 28.0, 12.2 Hz, 11H), 1.06-1.49 (m, 10H), 0.85-0.97 (m, 6H), 0.52 (d,
J = 6.5 Hz, 3H); 13C NMR (100 MHz, CDCl3)  172.72, 144.56, 144.03,
132.59, 125.34, 116.87, 112.62, 71.19, 67.10, 56.58, 56.29, 49.95, 45.93, 45.23, 44.37, 40.96,
40.42, 36.43, 36.10, 29.95, 29.35, 29.23, 29.19, 28.40, 27.63, 23.62, 22.24, 20.87, 18.88, 11.98,
9.89, 0.07 ppm; HRMS (ESI) m/z calcd for C30H49NO3Na: 494.3610 [M+Na]+; found: 494.3620.
J = 11.7 Hz, 1H), 5.96 (d, J = 11.4 Hz, 1H), 5.33 (d, J = 8.3 Hz, 1H), 5.21
(s, 1H), 4.95 (s, 1H), 4.79 (d, J = 7.2 Hz, 1H), 4.06 (s, 1H), 2.82 (d, J =
12.7 Hz, 1H), 2.56-2.62 (m, 1H), 2.32 (q, J = 6.9 Hz, 1H), 2.16 (t, J = 7.4
Hz, 3H), 1.89-2.05 (m, 6H), 1.25-1.74 (m, 17H), 1.21 (s, 6H), 0.92-0.98
(m, 6H), 0.85-0.88 (m, 3H), 0.53 (d, J = 5.2 Hz, 3H); 13C NMR (100
MHz, CDCl3)  171.87, 144.44, 143.94, 132.47, 128.81, 125.27, 116.79, 112.60, 71.11, 67.01,
56.48, 56.29, 49.96, 45.91, 45.25, 44.37, 41.02, 40.42, 38.97, 36.36, 36.11, 29.69, 29.34, 29.23,
29.11, 27.63, 23.62, 22.23, 20.79, 19.25, 18.80, 13.78, 11.90 ppm; HRMS (ESI) m/z calcd for
C31H51NO3Na: 508.3767 [M+Na]+; found: 508.3754.
S8
J = 8.2 Hz, 2H), 7.67 (d, J = 8.2 Hz, 2H), 6.45 (d, J = 11.4 Hz, 1H), 5.98-
6.04 (m, 2H), 5.31 (s, 1H), 5.03 (s, 1H), 4.97 (d, J = 7.3 Hz, 1H), 2.84 (d,
J = 12.8 Hz, 1H), 2.66 (d, J = 13.3 Hz, 1H), 2.38 (d, J = 7.8 Hz, 1H), 2.16
(d, J = 14.2 Hz, 2H), 1.99-2.05 (m, 4H), 1.90-1.80 (1H), 1.25-1.57 (m,
12H), 1.21 (s, 10H), 0.93 (d, J = 6.4 Hz, 3H), 0.46 (s, 3H); 13C NMR (100
MHz, CDCl3)  165.07, 144.52, 144.01, 138.01, 132.35, 132.29, 127.33,
125.67, 125.63, 122.31, 116.51,113.18, 71.10, 67.05, 56.43, 56.27, 51.31, 45.89, 44.98, 44.36,
36.33, 36.03, 31.92, 29.70, 29.35, 29.18, 23.61, 22.21, 20.76, 18.79, 11.79 ppm; HRMS (ESI) m/z
calcd for C35H48F3NO3Na: 610.3484 [M+Na]+; found: 610.3458.
(dd, J = 19.5, 8.5 Hz, 6H), 6.44 (d, J = 11.0 Hz, 1H), 5.94-6.00 (m, 2H),
5.29 (s, 1H), 5.01 (s, 1H), 4.97-4.89 (1H), 4.09 (s, 1H), 2.88-2.79 (1H),
2.67-2.60 (1H), 2.39-2.29 (1H), 2.13 (s, 2H), 2.00 (s, 5H), 1.25-1.71 (m,
5H), 1.21 (s, 8H), 0.93 (t, J = 6.6 Hz, 3H), 0.87 (dd, J = 10.5, 6.9 Hz, 5H),
0.48 (s, 3H); 13C NMR (100 MHz, CDCl3)  165.39, 144.42, 144.12,
132.46, 131.82, 128.46, 126.29, 125.35, 116.54, , 113.08, , 71.12, 56.44,
56.26, 51.88, 45.92, 44.35, 40.78, 40.31, 3632, 29.34, 29.18, 29.13, 27.56, 22.22, 20.78, 18.81,
11.84 ppm; HRMS (ESI) m/z calcd for C34H48BrNO3Na: 622.2695 [M+Na]+; found: 622.2683.
25: yield: 52% (2 steps); []23D = +74.5 (c 0.25 in CHCl3); 1H NMR (400 MHz, CDCl3)   7.68
6.01 (d, J = 11.4 Hz, 1H), 5.93 (d, J = 8.2 Hz, 1H), 5.30 (s, 1H), 5.00 (s,
1H), 4.95 (s, 1H), 4.09 (d, J = 7.8 Hz, 1H), 3.85 (d, J = 2.7 Hz, 3H), 2.85
(d, J = 12.8 Hz, 1H), 2.62-2.65 (m, 1H), 2.33-2.38 (m, 1H), 2.17 (s, 1H),
1.94-2.05 (m, 5H), 1.25-1.75 (m, 11H), 1.20 (d, J = 9.6 Hz, 8H), 0.83-0.97
(m, 7H), 0.52 (s, 3H); 13
C NMR (125 MHz, CDCl3)  165.80, 16216,
144.44, 144.23, 132.71, 129.49, 128.64, 125.23, 116.70, 113.79, 113.03, 71.09, 67.20, 56.50,
56.32, 55.42, 51.05, 45.92, 45.47, 44.37, 40.95, 40.42, 36.33, 36.07, 30.92, 29.35, 29.23, 29.21,
27.57, 23.63, 22.23, 20.78, 18.80, 11.88 ppm; HRMS (ESI) m/z calcd for C35H51NO4Na: 572.3716
[M+Na]+; found: 572.3692.
S9
26: yield: 74% (2 steps); []21D = +57.7 (c 0.23 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.67-
7.77 (m, 5H), 6.45 (d, J = 11.4 Hz, 1H), 5.98-6.04 (m, 2H), 5.31 (s, 1H),
5.02 (s, 1H), 4.97 (s, 1H), 4.09 (t, J = 4.0 Hz, 1H), 2.81-2.86 (m, 1H),
2.63-2.68 (m, 1H), 2.33-2.39 (m, 1H), 2.16 (d, J = 10.3 Hz, 1H), 1.68-
2.05 (m, 7H), 1.25-1.51 (m, 8H), 1.21 (s, 7H), 0.85-0.94 (m, 7H), 0.48 (s,
3H); 13
C NMR (75 MHz, CDCl3)  165.25, 144.06, 143.98, 136.56,
135.92, 132.69, 129.2 (q, 1JFC = 306.2 Hz), 127.95, 127.86, 125.06,
116.57, 112.79, 71.01, 66.68, 56.33, 56.15, 51.01, 45.75, 45.07, 44.21, 40.43, 40.23, 36.21, 35.91,
31.47, 29.2, 29.0, 27.45, 23.51, 22.54, 22.12, 20.66, 18.67, 14.04, 11.68 ppm; HRMS (ESI) m/z
calcd for C35H48F3NO3SNa: 642.3205 [M+Na]+; found: 642.3197.
27: yield: 48% (2 steps); []23D = +79.4 (c 0.19 in CHCl3); 1H NMR (400 MHz, CDCl3)  7.72 (q,
J = 4.6 Hz, 2H), 7.08 (t, J = 8.7 Hz, 2H), 6.45 (d, J = 11.0 Hz, 1H), 6.01
(d, J = 11.4 Hz, 1H), 5.94 (d, J = 7.8 Hz, 1H), 5.30 (s, 1H), 5.01 (s, 1H),
4.95 (s, 1H), 4.08 (s, 1H), 2.84 (d, J = 12.8 Hz, 1H), 2.62-2.66 (m, 1H),
2.33-2.38 (m, 1H), 2.18 (s, 1H), 1.95-2.00 (m, 5H), 1.25-1.72 (m, 13H),
1.21 (s, 9H), 0.94 (d, J = 6.0 Hz, 3H), 0.50 (s, 3H); 13C NMR (100 MHz,
CDCl3) 165.23, 144.42, 144.21, 132.56, 129.19, 129.11, 125.30, 116.56,
115.75, 115.53, 113.15, 71.10, 67.12, 56.45, 56.28, 51.23, 45.91, 45.43, 44.36, 40.80, 40.36, 36.34,
C34H48FNO3Na: 560.3516 [M+Na]+; found: 560.3535.
28: yield: 61% (2 steps); []20D = +70.0 (c 0.21 in CHCl3); 1H NMR (400 MHz, CDCl3) δ 7.76 (d,
J = 8.2 Hz, 1H), 6.44-6.55 (m, 2H), 5.97 (d, J = 11.4 Hz, 1H), 5.30 (s, 1H),
5.03 (s, 1H), 4.94 (s, 1H), 4.08 (s, 1H), 2.84 (d, J = 12.4 Hz, 1H), 2.64 (d,
J = 12.4 Hz, 1H), 2.35 (dd, J = 13.3, 7.8 Hz, 1H), 2.18 (s, 1H), 1.83-2.04
(m, 5H), 1.63-1.71 (m, 9H), 1.25-1.46 (m, 10H), 1.21 (s, 7H), 0.88-0.94
(m, 6H), 0.48 (s, 3H); 13C NMR (100 MHz, CDCl3):  144.56, 143.63,
131.97, 125.60, 116.47, 113.55, 113.06, 112.86, 71.10, 67.03, 56.46,
56.29, 51.85, 45.90, 45.42, 44.36, 40.53, 40.41, 36.34, 36.04, 29.69, 29.35, 29.20, 27.58, 23.61,
22.15, 20.76, 18.80, 14.12, 11.49 ppm; HRMS (ESI) m/z calcd for C34H45F4NO3Na: 614.3233
[M+Na]+; found: 614.3273.
S10
(dd, J = 16.7, 9.8 Hz, 1H), 6.95 (td, J = 10.2, 5.8 Hz, 1H), 6.62 (dd, J =
13.3, 8.2 Hz, 1H), 6.44 (d, J = 11.0 Hz, 1H), 5.97 (d, J = 11.0 Hz, 1H),
5.29 (s, 1H), 5.01 (s, 1H), 4.97 (s, 1H), 4.08 (t, J = 3.9 Hz, 1H), 2.82-2.85
(m, 1H), 2.63 (d, J = 12.8 Hz, 1H), 2.35 (dd, J = 12.8, 7.8 Hz, 1H), 2.12-
2.17 (m, 1H), 1.83-2.05 (m, 5H), 1.51-1.74 (m, 7H), 1.25-1.45 (m, 14H),
1.20 (d, J = 10.1 Hz, 8H), 0.93 (d, J = 6.4 Hz, 3H), 0.47 (s, 3H); 13C NMR
(75 MHz, CDCl3) 160.2, 143.94, 143.88, 132.4, 125.3, 116.6, 113.0, 71.1, 66.8, 56.4, 56.2, 51.4,
45.9, 45.2, 44.3, 40.6, 40.4, 36.3, 36.0, 29.3, 29.1, 27.5, 23.6, 22.1, 20.7, 18.7, 11.6 ppm; HRMS
(ESI) m/z calcd for C34H46F3NO3Na: 596.3328 [M+Na]+; found: 596.3340.
30: yield: 78% (2 steps); []22D = +59.4 (c 0.18 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.45 (s,
1H), 7.15 (d, J = 8.3 Hz, 1H), 6.80 (d, J = 8.6 Hz, 1H), 6.44 (d, J = 10.7
Hz, 1H), 5.95-6.03 (m, 2H), 5.30 (s, 1H), 5.01 (s, 1H), 4.96 (s, 1H), 3.93
(d, J = 6.9 Hz, 8H), 2.84 (d, J = 11.7 Hz, 1H), 2.62-2.66 (m, 1H), 2.39 (d,
J = 7.9 Hz, 1H), 1.86-2.17 (m, 6H), 1.25-1.75 (m, 10H), 1.21 (s, 8H),
0.76-0.94 (m, 7H), 0.50 (s, 3H); 13C NMR (100 MHz, CDCl3)  165.95,
151.77, 149.14, 144.16, 132.61, 125.34, 118.79, 116.74, 112.85, 110.86,
110.19, 71.10, 67.13, 56.45, 56.29, 56.05, 50.77, 46.46, 45.88, 45.31, 44.37, 40.93, 40.38, 36.34,
36.08, 29.69, 29.35, 29.22, 29.12, 27.58, 23.62, 22.23, 20.76, 18.81, 11.89 ppm; HRMS (ESI):
m/z calcd for C36H53NO5Na: 602.3821 [M+Na]+; found: 602.3856.
Compound 18
S3
To a solution of nosyl amine S3 (57.4 mg, 0.0692 mmol) in THF (2.3 mL) was added 3HF·Et3N
(0.12 mL, 0.74 mmol) at 0 °C, and the reaction mixture was stirred at room temperature for 3 d.
Saturated NaHCO3 aq. was added to the reaction mixture, and the aqueous layer was extracted
with ethyl acetate three times. The combined organic layer was washed with brine, dried over
MgSO4, and concentrated in vacuo. The residue was purified by column chromatography on silica
gel (n-hexane/ethyl acetate; 1:1) to give 18 (42.9 mg, quant.). 18: []22D = -78.5 (c 1.07 in CHCl3);
S11
1
H NMR (300 MHz, CDCl3) δ 8.14-8.20 (m, 1H), 7.84-7.89 (m, 1H), 7.70-7.77 (m, 3H), 6.36 (d,
J = 11.4 Hz, 1H), 5.74 (d, J = 11.4 Hz, 1H), 5.41 (d, J = 8.3 Hz, 1H), 5.04 (s, 1H), 4.82 (s, 1H),
4.28-4.37 (m, 1H), 4.08-4.15 (m, 1H), 2.76-2.80 (m, 1H), 2.55 (d, J = 13.8 Hz, 1H), 2.28 (q, J =
6.8 Hz, 1H), 1.82-2.04 (m, 7H), 1.21-1.67 (m, 17H), 0.82-0.96 (m, 6H), 0.51 (s, 3H); 13C NMR
(75 MHz, CDCl3)  147.71, 143.94, 134.70, 133.49, 132.92, 131.6, 130.66, 125.60, 125.25,
116.57, 113.03, 71.13, 66.17, 56.49, 56.24, 55.20, 45.88, 44.34, 44.30, 42.20, 40.40, 36.35, 36.01,
C33H48N2NaO6S: 623.3131 [M+Na]+; found: 623.3160.
Compounds 31-36
S6a
S5
S7a
S7b
S7a
To a solution of sulfone S5[2] (202 mg, 0.334 mmol) in THF (2.0 mL) was added LiHMDS (1.3
M solution in THF, 0.28 mL, 0.36 mmol) at -78 °C, and the mixture was stirred at the same
temperature for 1 h. A solution of (1,3)-ketone S6a[3] (72.4 mg, 0.194 mmol) in THF (1.0 mL)
was added to the mixture above at -78 °C, and the reaction mixture was stirred at same
temperature for 2 h. To the reaction mixture was added H2O, and the aqueous layer was extracted
S12
gel (n-hexane/ethyl acetate; 30:1 to 15:1) to give S7a (21.5 mg, 15%) and S7b (33.8 mg, 22%),
respectively. To a solution of coupling product S7a in EtOH (0.05 M) and THF was added
H2NNH2·H2O (5 equiv.) at room temperature, and the reaction mixture was stirred at 60 °C. The
reaction mixture was filtered through a plug of cotton and concentrated in vacuo. To a solution of
the residue in CH2Cl2 (0.02 M) were added Et3N (2.5 equiv.) and R-Cl (1.2 equiv.) at 0 °C, and
the mixture was stirred at the same temperature. To the reaction mixture was added H2O, and the
aqueous layer was extracted with CH2Cl2 three times. The combined organic layer was washed
with brine, dried over MgSO4, and concentrated in vacuo. The residue was purified by column
chromatography on silica gel to give silyl-protected. To a solution of silyl-protected in THF (0.01
M) was added HF·Py (150 equiv.) at 0 °C, and the reaction mixture was stirred at room
temperature. Saturated NaHCO3 aq. was added to the reaction mixture, and the aqueous layer was
over MgSO4, and concentrated in vacuo. The residue was purified by column chromatography on
silica gel to give 31-36, respectively.
J = 11.0 Hz, 1H), 5.81 (d, J = 11.0 Hz, 1H), 4.19-4.32 (m, 3H), 4.04 (d, J
= 6.9 Hz, 1H), 3.81 (q, J = 4.0 Hz, 1H), 2.98 (s, 4H), 2.67-2.81 (m, 2H),
2.49 (dd, J = 13.4, 3.8 Hz, 1H), 2.16-2.35 (m, 2H), 1.86-2.05 (m, 5H),
1.25-1.73 (m, 16H), 1.22 (s, 7H), 0.94 (t, J = 5.7 Hz, 3H), 0.54 (s, 3H);
13
C NMR (100 MHz, CDCl3) 144.30, 129.88, 129.71, 124.48, 124.30,
114.84, 71.13, 67.03, 66.76, 56.50, 56.29, 49.89, 49.66, 45.89, 44.53, 44.38, 43.43, 41.75, 41.06,
40.95, 40.38, 36.79, 36.36, 36.06, 35.65, 31.91, 29.68, 29.35, 29.19, 29.02, 27.64, 23.50, 22.68,
22.23, 20.79, 18.78, 14.11, 12.04, 1.00, -0.03 ppm; HRMS (FAB) m/z calcd for C27H47NNaO4S:
504.3123 [M+Na]+; found: 504.3121.
32: yield: 52% (3 steps); []22D = -38.4 (c 0.62 in CHCl3); 1H NMR (400 MHz, CDCl3) 7.75 (d,
J = 8.6 Hz, 2H), 7.30 (d, J = 7.9 Hz, 2H), 6.27 (d, J = 11.4 Hz, 1H), 5.59
3.65 (d, J = 6.9 Hz, 2H), 2.73-2.78 (m, 1H), 2.40-2.46 (m, 6H), 1.95-2.17
(m, 5H), 1.31-1.79 (m, 4H), 1.22-1.25 (m, 12H), 0.84-0.96 (m, 10H), 0.56
(s, 3H); 13C NMR (100 MHz, CDCl3) 143.8, 143.3, 138.1, 130.1, 129.7,
126.9, 124.1, 114.8, 71.1, 67.0, 56.5, 56.3, 49.3, 45.8, 44.4, 40.8, 40.4,
36.4, 36.1, 34.9, 29.7, 29.3, 29.2, 28.9, 27.7, 23.4, 22.2, 21.6, 20.8, 18.8, 12.1 ppm; HRMS (FAB)
m/z calcd for C33H51NNaO4S: 580.3437 [M+Na]+; found: 580.3435.
S13
J = 8.6 Hz, 1H), 8.21-8.30 (m, 2H), 7.49-7.58 (m, 4H), 7.18 (d, J = 6.9
Hz, 1H), 6.23 (d, J = 11.7 Hz, 1H), 5.60 (d, J = 11.7 Hz, 1H), 4.54 (d, J
= 8.3 Hz, 1H), 4.28-4.32 (m, 1H), 3.90 (s, 1H), 3.62 (d, J = 12.7 Hz, 2H),
2.90 (s, 6H), 2.71-2.77 (m, 1H), 2.33-2.49 (m, 2H), 1.94-2.12 (m, 6H),
1.37-1.74 (m, 11H), 1.24-1.34 (m, 12H), 0.95 (d, J = 6.2 Hz, 3H), 0.84-
0.89 (m, 6H), 0.53 (s, 3H); 13
C NMR (100 MHz, CDCl3) 165.42,
144.02, 136.85, 136.10, 130.77, 127.85, 123.91, 114.98, 90.98, 67.29, 60.49, 56.57, 56.35, 55.09,
46.14, 45.93, 42.25, 41.79, 40.41, 39.41, 37.22, 36.39, 36.11, 29.68, 29.00, 27.65, 26.40, 26.32,
23.50, 22.23, 20.52, 18.79, 14.18, 12.04 ppm; HRMS (FAB) m/z calcd for C38H56N2NaO4S:
659.3858 [M+Na]+; found: 659.3860.
34: yield: 76% (3 steps); []22D = +28.4 (c 0.49 in CHCl3); 1H NMR (400 MHz, CD3OD)  6.25
(d, J = 11.0 Hz, 1H), 5.88 (d, J = 11.4 Hz, 1H), 4.13 (q, J = 3.7 Hz, 1H),
3.97-4.01 (m, 1H), 2.81-2.85 (m, 1H), 2.35-2.46 (m, 3H), 1.73-2.12 (m,
9H), 1.22-1.66 (m, 14H), 1.05-1.17 (m, 8H), 0.87-0.97 (m, 5H), 0.57 (t, J
= 4.8 Hz, 3H); 13C NMR (100 MHz, CDOD3)  172.50, 142.64, 133.34,
123.75, 117.07, 71.48, 67.64, 58.02, 57.57, 46.87, 46.75, 45.29, 42.91,
41.93, 39.93, 37.77, 37.48, 36.98, 29.87, 29.27, 29.13, 28.77, 24.55, 23.29, 22.65, 21.91, 19.39,
12.45 ppm; HRMS (FAB) m/z calcd for C28H47NNaO3: 468.3454 [M+Na]+; found: 468.3454.
(dd, J = 15.8, 8.6 Hz, 4H), 6.42 (d, J = 11.4 Hz, 1H), 6.03 (d, J = 8.3 Hz,
1H), 5.83 (d, J = 11.4 Hz, 1H), 4.53 (s, 1H), 3.94 (s, 1H), 2.82 (dd, J =
12.0, 4.5 Hz, 1H), 2.57-2.63 (m, 2H), 2.42-2.48 (m, 1H), 2.23 (dd, J =
12.4, 8.6 Hz, 2H), 2.01 (d, J = 12.4 Hz, 2H), 1.68-1.89 (m, 3H), 1.31-1.57
(m, 5H), 1.20-1.25 (m, 12H), 0.85-0.94 (m, 8H), 0.43 (s, 3H); 13C NMR
(100 MHz, CDCl3)  165.28, 144.28, 136.74, 136.04, 132.02, 131.02,
128.01, 127.81, 123.90, 114.80, 67.88, 60.40, 56.43, 56.21, 46.10, 45.69, 45.53, 44.32, 40.26,
39.37, 36.31, 35.98, 33.54, 31.89, 29.67, 29.32, 29.13, 28.95, 27.53, 23.52, 22.66, 22.23, 21.03,
20.74, 18.73, 14.17, 11.80 ppm; HRMS (FAB) m/z calcd for C34H48F3NNaO3S: 630.3205
[M+Na]+; found: 630.3207.
S14
J = 11.4 Hz, 1H), 6.13 (d, J = 7.9 Hz, 1H), 5.77 (d, J = 11.4 Hz, 1H), 4.28-
4.31 (m, 2H), 3.94 (td, J = 7.9, 4.0 Hz, 1H), 2.80 (dd, J = 11.7, 3.8 Hz,
1H), 2.55 (d, J = 13.4 Hz, 2H), 2.17-2.44 (m, 2H), 1.80-2.05 (m, 5H),
1.25-1.73 (m, 8H), 1.22 (s, 6H), 0.74-0.96 (m, 12H), 0.52 (d, J = 5.8 Hz,
3H); 13
C NMR (100 MHz, CDCl3) 144.84, 144.60, 129.40, 124.57,
114.78, 114.48, 71.13, 67.31, 66.81, 56.52, 56.33, 46.42, 46.32, 45.94, 45.86, 45.00, 44.39, 41.21,
40.39, 38.76, 36.88, 36.49, 36.38, 36.06, 33.19, 31.91, 29.69, 29.37, 29.19, 28.97, 27.65, 23.49,
22.69, 22.23, 20.80, 18.79, 14.12, 12.05, 11.70, -0.02 ppm; HRMS (FAB) m/z calcd for
C28H45F3NO3: 500.3352 [M+H]+; found: 500.3340.
Compound 32b
S7b
32b was synthesized by the same procedure described as 32a.

32b: yield: 87% (3 steps); []27D = -29.8 (c = 0.59 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.75
(d, J = 8.3 Hz, 2H), 7.31 (d, J = 7.9 Hz, 2H), 6.11 (d, J = 11.4 Hz, 1H), 5.78 (d, J = 11.0 Hz, 1H),
4.46 (d, J = 8.6 Hz, 1H), 3.81-3.87 (m, 1H), 3.68 (t, J = 4.3 Hz, 1H), 2.73 (dd, J = 12.7, 3.4 Hz,
2H), 2.44 (s, 4H), 2.29-2.33 (m, 1H), 1.84-2.13 (m, 8H), 1.22-1.73 (m, 19H), 0.85-0.95 (m, 5H),
0.48-0.55 (m, 3H); 13C NMR (100 MHz, CDCl3)  143.9, 143.4, 138.0, 129.9, 129.7, 127.0, 124.2,
114.9, 71.1, 66.7, 56.5, 56.3, 49.7, 45.8, 44.4, 42.4, 40.5, 40.4, 36.9, 36.3, 36.0, 29.3, 29.2, 29.0,
27.6, 23.5, 22.2, 21.5, 20.8, 18.8, 12.0 ppm; HRMS (ESI): m/z calcd for C33H51NNaO4S: 580.3437
[M+Na]+; found: 580.3466.
S15
Compounds S7c and S7d
S6b
S5
S7c S7d
To a solution of sulfone S5 (61.9 mg, 0.102 mmol) in THF (1.0 mL) was added LiHMDS (1.3 M
solution in THF, 0.09 mL, 0.12 mmol) at -78 °C, and the mixture was stirred at the same
temperature for 1 h. A solution of (1,3)-ketone S6b[3] (29 mg, 0.078 mmol) in THF (1.0 mL)
was added to the mixture above at -78 °C, and the reaction mixture was stirred at the same
temperature for 2 h. To the reaction mixture was added H2O, and the aqueous layer was extracted
gel (n-hexane/ethyl acetate; 15:1) to give S7c (12.2 mg, 21%) and S7d (24.0 mg, 40%),
respectively. S7c: []24D = +20.9 (c 0.90 in CHCl3); 1H NMR (300 MHz, CDCl3):  7.80-7.86 (m,
2H), 7.68-7.74 (m, 2H), 6.23 (d, J = 11.4 Hz, 1H), 5.73 (d, J = 11.4 Hz, 1H), 4.10-4.21 (m, 1H),
3.62-3.73 (m, 1H), 2.69-2.83 (m, 3H), 2.39-2.47 (m, 2H), 2.24 (t, J = 11.7 Hz, 1H), 1.79-2.02 (m,
3H), 1.25-1.68 (m, 9H), 1.14-1.18 (m, 6H), 0.83-1.00 (m, 28H), 0.55 (q, J = 7.7 Hz, 9H), 0.07-
0.10 (m, 3H), 0.06 (d, J = 3.4 Hz, 3H); 13C NMR: (75 MHz, CDCl3):  168.0, 142.6, 133.8, 131.9,
131.8, 123.0, 121.9, 115.5, 73.3, 69.7, 56.5, 56.2, 47.3, 46.1, 45.6, 45.4, 40.4, 39.2, 36.3, 36.0,
30.9, 29.9, 29.7, 28.7, 27.5, 25.7, 23.4, 22.2, 20.7, 18.7, 17.9, 12.1, 7.0, 6.7, -4.66, -4.74 ppm ;
HRMS (ESI): m/z calcd for C46H75NO4Si2Na: 784.5132 [M+Na]+; found: 784.5136. S7d: []24D
= +15.5 (c 0.62 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.80-7.84 (m, 2H), 7.70 (q, J = 2.9 Hz,
2H), 6.23 (d, J = 11.0 Hz, 1H), 5.85 (d, J = 12.0 Hz, 1H), 4.11-4.18 (m, 1H), 3.54-3.59 (m, 1H),
3.00 (t, J = 11.9 Hz, 2H), 2.77 (d, J = 15.1 Hz, 1H), 2.49 (dd, J = 23.2, 12.2 Hz, 1H), 2.17-2.25
(m, 1H), 1.90-2.05 (m, 5H), 1.23-1.69 (m, 10H), 1.19 (s, 7H), 0.89-1.04 (m, 24H), 0.52-0.60 (m,
10H), 0.05-0.10 (m, 6H); 13C NMR: (75 MHz, CDCl3)  168.1, 142.8, 133.8, 132.1, 131.9, 123.0,
121.9, 115.4, 73.4, 69.6, 56.6, 56.3, 48.2, 45.6, 45.4, 40.4, 39.5, 39.1, 38.1, 36.4, 36.1, 29.9, 29.8,
S16
28.8, 27.6, 25.8, 23.5, 22.1, 20.8, 18.8, 18.1, 12.0, 7.1, 6.7, -4.7, -4.8 ppm; HRMS (ESI) m/z calcd
for C46H75NO4Si2Na: 784.5132 [M+Na]+; found: 784.5144.
Compound 32c
S7c
To a solution of coupling product S7c (16.7 mg, 0.022 mmol) in EtOH (0.55 mL) was added
H2NNH2·H2O (5.3 L, 0.11 mmol) at room temperature, and the reaction mixture was stirred at
60 °C. The reaction mixture was filtered through a plug of cotton and concentrated in vacuo. To
a solution of the residue in CH2Cl2 (0.6 mL) were added Et3N (4.0 mL, 0.0278 mmol) and p-TsCl
(2.5 mg, 0.0133 mmol) at 0 °C, and the mixture was stirred at same temperature. To the reaction
mixture was added H2O, and the aqueous layer was extracted with CH2Cl2 three times. The
combined organic layer was washed with brine, dried over MgSO4, and concentrated in vacuo.
The residue was purified by column chromatography on silica gel to give silyl-protected. To a
solution of silyl-protected in THF (0.60 mL) was added HF·Py (110 L, 1.22 mmol) at 0 °C, and
the reaction mixture was stirred at room temperature. Saturated NaHCO3 aq. was added to the
reaction mixture, and the aqueous layer was extracted with ethyl acetate three times. The
The residue was purified by column chromatography on silica gel to give 32c (4.29 mg, 69%, 3
steps). 32c: yield: 69% (3 steps); []28D = +58.2 (c 0.43 in CHCl3); 1H NMR (300 MHz, CDCl3)
 7.76 (d, J = 8.3 Hz, 2H), 7.29 (d, J = 8.3 Hz 2H), 6.26 (d, J = 11.7 Hz, 1H), 5.69 (d, J = 11.4
Hz, 1H), 5.20 (d, J = 8.9 Hz, 1H), 3.91 (t, J = 3.4 Hz, 1H), 3.47-3.53 (m, 1H), 2.74-2.79 (m, 1H),
2.43 (s, 5H), 2.25-2.37 (m, 1H), 2.15 (q, J = 6.7 Hz, 1H), 1.86-2.02 (m, 3H), 1.25-1.71 (m, 5H),
1.23 (s, 7H), 0.85-0.95 (m, 6H), 0.55 (d, J = 4.8 Hz, 3H); 13C NMR (75 MHz, CDCl3)  143.0,
142.9, 138.3, 129.6, 126.8, 123.4, 115.2, 71.1, 68.5, 56.4, 56.1, 50.1, 45.7, 44.7, 44.3, 40.3, 40.0,
36.3, 36.1, 34.9, 29.2, 29.1, 28.8, 27.7, 23.4, 22.2, 21.5, 20.7, 18.7, 12.0 ppm; HRMS (ESI) m/z
calcd for C33H51NNaO4S: 580.3437 [M+Na]+; found: 580.3401.
S17
Compound 32d
S7c
32d was synthesized by the same procedure described as 32a.

32d: yield: 83% (3 steps); []26D = +94.7 (c 0.60 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.76
5.20 (d, J = 8.6 Hz, 1H), 3.85 (td, J = 7.1, 3.4 Hz, 1H), 3.43 (tt, J = 11.8, 3.9 Hz, 1H), 2.71-2.78
(m, 1H), 2.53 (dd, J = 13.8, 3.1 Hz, 1H), 2.43 (s, 4H), 2.22-2.34 (m, 2H), 1.86-2.09 (m, 6H), 1.25-
1.70 (m, 13H), 1.23 (d, J = 5.2 Hz, 12H), 0.85-1.10 (m, 6H), 0.56 (s, 3H); 13C NMR (75 MHz,
CDCl3) 143.3, 143.1, 138.3, 129.6, 127.0, 123.5, 115.1, 71.1, 68.3, 56.4, 56.2, 50.7, 45.7, 44.3,
43.1, 40.4, 39.9, 36.5, 36.3, 36.0, 29.3, 29.1, 28.8, 27.6, 23.4, 22.2, 21.5, 20.7, 18.7, 12.0 ppm;
HRMS (ESI) m/z calcd for C33H51NNaO4S: 580.3437 [M+Na]+; found: 580.3478.
Compound S6c
S6b S6c
To a solution of ketone S6b (79.4 mg, 0.213 mmol) in THF (1.2 mL) was added BH3·SMe2 (2.0
M solution in THF, 0.45 mL, 0.90 mmol) at 0 °C, and the reaction mixture was stirred at the same
temperature for 2 h. Saturated NaHCO3 aq. was added to the reaction mixture, and the aqueous
layer was extracted with ethyl acetate three times. The combined organic layer was washed with
brine, dried over MgSO4, and concentrated in vacuo. The residue was purified by column
chromatography on silica gel (n-hexane/ethyl acetate; 5:1 to 2:1) to give alcohol (65.0 mg, 81%).
To a solution of the alcohol (107.8 mg, 0.2871 mmol) in CH2Cl2 (3.0 mL) were added Et3N (0.16
mL, 1.2 mmol), DMAP (12.4 mg, 0.101 mmol), and BzCl (0.10 mL, 0.87 mmol) at 0 °C, and the
reaction mixture was stirred at the same temperature for 1.5 h. Saturated NH4Cl aq. was added to
the reaction mixture, and the aqueous layer was extracted with ethyl acetate three times. The
S18
The residue was purified by column chromatography on silica gel (n-hexane/ethyl acetate; 8:1) to
give benzoate (174.0 mg, quant.). To a solution of TBS ether (0.2871 mmol) in THF (3.0 mL)
was added TBAF (1.0 M solution in THF, 2.2 mL, 2.2 mmol) at 0 °C, and the reaction mixture
was stirred at the same temperature for 1.5 h. Saturated NH4Cl aq. was added to the reaction
mixture, and the aqueous layer was extracted with ethyl acetate three times. The combined organic
layer was washed with brine, dried over MgSO4, and concentrated in vacuo. The residue was
purified by column chromatography on silica gel (n-hexane/ethyl acetate; 1:1) to give alcohol
(90.1 mg, 86% in 2 steps). To a solution of the alcohol (10.6 mg, 0.0290 mmol) in CH 2Cl2 (0.3
mL) was added DMP (20.0 mg, 0.0472 mmol) at 0 °C, and the reaction mixture was stirred at
room temperature for 1 h. The reaction mixture was purified by column chromatography on silica
gel (n-hexane/ethyl acetate; 2:1) to give ketone S6c (10.4 mg, 99%, colorless solid). S6c: []21D=
+10.2 (c 0.87 in CHCl3); 1H NMR (300 MHz, CDCl3)  8.00 (d, J = 7.6 Hz, 2H), 7.79-7.85 (m,
2H), 7.66-7.78 (m, 2H), 7.49-7.57 (m, 1H), 7.41 (t, J = 7.6 Hz, 2H), 5.26-5.40 (m, 1H), 4.62 (tt, J
= 12.6, 4.4 Hz, 1H), 3.40 (t, J = 13.8 Hz, 1H), 2.44-3.01 (m, 5H); 13C NMR: (75 MHz, CDCl3): 
203.8, 167.6, 165.3, 134.2, 133.2, 131.5, 129.5, 128.3, 123.4, 68.0, 46.2, 43.7, 33.7 ppm; HRMS
(ESI): m/z calcd for C21H17NO5Na: 386.1004 [M+Na]+; found: 386.0995.
Compound S8a and S8b
S5 S6c
S8a S8b
To a solution of (1,3)-ketone S6c (64.0 mg, 0.176 mmol) and sulfone S5 (112.5 mg, 0.186
mmol) in THF (3.6 mL) was added LiHMDS (1.3 M solution in THF, 0.43 mL, 0.56 mmol) at -
78 °C, and the reaction mixture was stirred at the same temperature for 2 h. To the reaction mixture
was added H2O, and the aqueous layer was extracted with ethyl acetate three times. The combined
was purified by column chromatography on silica gel (n-hexane/ethyl acetate; 20:1 to 5:1) to give
S19
coupling product (125.7 mg, 95%). To a solution of coupling product (125.7 mg, 0.1671 mmol)
in EtOH (2.0 mL) and THF (2.0 mL) was added H2NNH2·H2O (0.084 mL, 1.7 mmol) at room
temperature, and the reaction mixture was stirred at 60 °C for 2 h. The reaction mixture was
filtered through a plug of cotton and concentrated in vacuo. To a solution of the residue in CH2Cl2
(5.6 mL) were added Et3N (0.07 mL, 0.50 mmol) and p-TsCl (50.4 mg, 0.264 mmol) at 0 °C, and
the mixture was stirred at same temperature for 2.5 h. To the reaction mixture was added H 2O,
and the aqueous layer was extracted with CH2Cl2 three times. The combined organic layer was
washed with brine, dried over MgSO4, and concentrated in vacuo. The residue was purified by
column chromatography on silica gel (n-hexane/ethyl acetate; 8:1 to 4:1) to give tosylate (69.5
mg, 54% in 2 steps). To a solution of tosylate (69.5 mg, 0.09 mmol) in MeOH (0.9 mL) and THF
(0.9 mL) was added K2CO3 (28.9 mg, 0.21 mmol) at 0 °C, and the mixture was stirred at room
temperature for 1 d. Saturated NHCl4 aq. was added to the reaction mixture, and the aqueous layer
was extracted with ethyl acetate three times. The combined organic layer was washed with brine,
dried over MgSO4, and concentrated in vacuo. The residue was purified by column
chromatography on silica gel (n-hexane/ethyl acetate; 2:1) to give S8a (26.8 mg, 45%) and S8b
(26.3 mg, 44%), respectively. S8a: []26D = +1.0 (c 1.37 in CHCl3); 1H NMR (300 MHz, CDCl3)
 7.76 (d, J = 8.3 Hz, 2H), 7.29 (d, J = 7.9 Hz, 2H), 6.24 (d, J = 11.4 Hz, 1H), 5.64 (d, J = 11.4
Hz, 1H), 5.17 (d, J = 8.6 Hz, 1H), 3.80 (q, J = 3.8 Hz, 1H), 3.40 (td, J = 8.1, 4.1 Hz, 1H), 2.73-
2.78 (m, 1H), 2.42-2.51 (m, 7H), 1.90-2.14 (m, 7H), 1.25-1.75 (m, 12H), 1.18 (d, J = 11.7 Hz,
7H), 0.88-1.04 (m, 9H), 0.53-0.60 (m, 13H); 13C NMR (100 MHz, CDCl3)  143.4, 143.2, 138.4,
129.7, 129.4, 126.9, 123.6, 115.1, 73.5, 68.8, 56.6, 56.3, 50.2, 45.8, 45.5, 44.9, 40.4, 40.2, 36.4,
36.1, 35.2, 30.0, 29.8, 28.9, 27.7, 23.5, 22.3, 21.5, 20.8, 18.8, 12.0, 7.1, 6.8 ppm; HRMS (ESI)
m/z calcd for C39H65NNaO4SSi: 694.4301 [M+Na]+; found: 694.4304. S8b: []25D = -14.5 (c 1.31
in CHCl3); H NMR (300 MHz, CDCl3)  7.76 (d, J = 8.3 Hz, 2H), 7.30 (d, J = 8.3 Hz, 2H), 6.06
(d, J = 11.4 Hz, 1H), 5.76 (d, J = 11.4 Hz, 1H), 5.44 (d, J = 8.6 Hz, 1H), 3.94 (s, 1H), 3.54 (s, 1H),
2.69-2.74 (m, 1H), 2.41 (t, J = 5.5 Hz, 6H), 2.27-2.34 (m, 1H), 1.81-2.13 (m, 5H), 1.23-1.71 (m,
10H), 1.18 (s, 7H), 0.86-1.03 (m, 14H), 0.47-0.60 (m, 12H); 13C NMR (100 MHz, CDCl3)  143.5,
143.1, 138.7, 129.6, 129.0, 127.0, 124.2, 115.0, 73.4, 68.5, 56.6, 56.3, 50.6, 45.8, 45.5, 42.9, 40.4,
38.8, 36.4, 36.3, 36.1, 30.0, 29.8, 29.0, 27.6, 23.5, 22.2, 21.5, 20.8, 18.8, 12.0, 7.1, 6.8 ppm;
HRMS (ESI) m/z calcd for C39H65NNaO4SSi: 694.4301 [M+Na]+; found: 694.4283.
S20
Compound 32e
S8a
To a solution of TES ether S8a (4.0 mg, 0.006 mmol) in THF (0.26 mL) was added 3HF·Et3N
MgSO4, and concentrated in vacuo. The residue was purified by preparative TLC (n-hexane/ethyl
acetate; 3:4) to give 32e (2.5 mg, 75%). 32e: []22D = -5.6 (c 0.25 in CHCl3); 1H NMR (300 MHz,
CDCl3)  7.76 (d, J = 8.3 Hz, 2H), 7.30 (d, J = 7.9 2H), 6.25 (d, J = 11.4 Hz, 1H), 5.67 (d, J =
11.4 Hz, 1H), 5.05 (d, J = 8.6 Hz, 1H), 3.81-3.88 (m, 1H), 3.37-3.47 (m, 1H), 2.74-2.79 (m, 1H),
2.43-2.50 (m, 6H), 1.92-2.20 (m, 7H), 1.36-1.66 (m, 7H), 1.23-1.32 (m, 17H), 1.05 (s, 2H), 0.79-
0.95 (m, 6H), 0.55 (s, 3H); 13C NMR (100 MHz, CDCl3)  143.4, 143.3, 138.5, 129.8, 129.6,
127.0, 123.7, 115.3, 71.2, 68.9, 56.6, 56.4, 50.3, 45.9, 45.0, 44.5, 40.5, 40.3, 36.5, 36.2, 35.3, 29.5,
C33H51NNaO4S: 580.3437 [M+Na]+; found: 580.3402.
Compound 32f
S8b
To a solution of TES ether S8b (2.3 mg, 0.0034 mmol) in THF (0.25 mL) was added 3HF·Et3N
MgSO4, and concentrated in vacuo. The residue was purified by preparative TLC (n-hexane/ethyl
S21
acetate; 3:4) to give 32f (1.0 mg, 52%). 32f: []22D = -6.7 (c = 0.12 in CHCl3); 1H NMR (300
MHz, CDCl3)  7.76 (d, J = 8.3 Hz, 2H), 7.30 (d, J = 8.3 Hz, 2H), 6.08 (d, J = 11.4 Hz, 1H), 5.76
(d, J = 11.0 Hz, 1H), 5.35 (d, J = 8.9 Hz, 1H), 3.97 (s, 1H), 3.57 (d, J = 8.9 Hz, 1H), 2.72 (dd, J
= 11.4, 4.1 Hz, 1H), 2.42 (d, J = 7.2 Hz, 6H), 2.28-2.35 (m, 1H), 1.82-2.13 (m, 6H), 1.25-1.68 (m,
8H), 1.22 (s, 7H), 0.82-0.95 (m, 10H), 0.54 (d, J = 6.9 Hz, 3H); 13C NMR (100 MHz, CDCl3) 
143.4, 143.1, 138.7, 129.7, 129.0, 127.0, 124.2, 115.0, 71.1, 68.5, 56.5, 56.2, 50.6, 45.8, 44.4,
42.9, 40.4, 38.7, 36.4, 36.1, 29.7, 29.4, 29.2, 27.7, 23.5, 22.3, 21.5, 20.8, 18.8, 12.1 ppm; HRMS
(ESI) m/z calcd for C33H51NNaO4S: 580.3437 [M+Na]+; found: 580.3484.
Compound S6d
S6a S6d
To a solution of ketone S6a (71.2 mg, 0.191 mmol) in THF (9.5 mL) was added L-Selectride (1.0
M solution in THF, 0.230 mL, 0.230 mmol) at -78 °C, and the reaction mixture was stirred at the
same temperature for 45 min. Saturated NHCl4 aq. was added to the reaction mixture, and the
column chromatography on silica gel (n-hexane/ethyl acetate; 5:1) to give alcohol (61.7 mg, 86%).
To a solution of the alcohol (61.7 mg, 0.164 mmol) in CH2Cl2 (1.6 mL) were added Et3N (0.15
mL, 1.1 mmol), DMAP (7.8 mg, 0.064 mmol), and BzCl (0.095 mL, 0.82 mmol) at 0 °C, and the
reaction mixture was stirred at 40 °C for 1 d. Saturated NaHCO3 aq. was added to the reaction
mixture, and the aqueous layer was extracted with CH2Cl2 three times. The combined organic
purified by column chromatography on silica gel (n-hexane/ethyl acetate; 15:1 to 2:1) to give
benzoate (52.6 mg, 69%). To a solution of TBS ether (52.6 mg, 0.110 mmol) in THF (0.22 mL)
was added 3HF·Et3N (0.066 mL, 0.40 mmol) at 0 °C, and the reaction mixture was stirred at 60 °C
for 9 h. Saturated NaHCO3 aq. was added to the reaction mixture, and the aqueous layer was
over MgSO4, and concentrated in vacuo. The residue was purified by column chromatography on
silica gel (n-hexane/ethyl acetate; 1:1) to give alcohol (35.9 mg, 90%). To a solution of the alcohol
(35.9 mg, 0.0983 mmol) in CH2Cl2 (4.9 mL) was added DMP (62.5 mg, 0.147 mmol) at 0 °C, and
the reaction mixture was stirred at room temperature for 3 h. The reaction mixture was purified
S22
by column chromatography on silica gel (n-hexane/ethyl acetate; 2:1) to give ketone S6d (32.7
mg, 92%). S6d: []21D= +89.6 (c 0.84 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.99-8.07 (m,
2H), 7.81-7.85 (m, 2H), 7.72-7.76 (m, 2H), 7.58 (t, J = 7.4 Hz, 1H), 7.39-7.48 (m, 2H), 5.76 (t, J
= 3.3 Hz, 1H), 5.01 (tt, J = 12.2, 4.6 Hz, 1H), 3.34-3.49 (m, 1H), 2.91-3.01 (m, 1H), 2.68-2.88
(m, 3H), 2.34 (d, J = 13.8 Hz, 1H); 13C NMR: (75 MHz, CDCl3):  204.8, 167.9, 165.3, 134.3,
133.4, 131.6, 129.7, 129.5, 128.5, 123.5, 69.1, 45.0, 44.6, 44.5, 32.4 ppm; HRMS (ESI): m/z calcd
for C21H17NO5Na: 386.1004 [M+Na]+; found: 386.0994.
Compound 32h and 32g
S5 S6d
S9a S9b
To a solution of sulfone S5 (56.3 mg, 0.093 mmol) in THF (0.2 mL) was added LiHMDS (1.3 M
solution in THF, 0.07 mL, 0.09 mmol) at -78 °C, and the mixture was stirred at same temperature
for 50 min. A solution of ketone S6d (25.3 mg, 0.07 mmol) in THF (1.2 mL) was added to the
mixture above at -78 °C, and the reaction mixture was stirred at the same temperature for 2 h. To
the reaction mixture was added H2O, and the aqueous layer was extracted with ethyl acetate three
times. The combined organic layer was washed with brine, dried over MgSO4, and concentrated
in vacuo. The residue was purified by column chromatography on silica gel (n-hexane/ethyl
acetate; 20:1 to 10:1) to give coupling product (24.7 mg, 47%). To a solution of coupling product
(24.7 mg, 0.032 mmol) in EtOH (1.0 mL) was added H2NNH2·H2O (0.016 mL, 0.33 mmol) at
S23
room temperature, and the reaction mixture was stirred at 60 °C for 3 h. The reaction mixture was
(1.1 mL) were added Et3N (0.014 mL, 0.10 mmol) and p-TsCl (17.6 mg, 0.092 mmol) at 0 °C,
and the mixture was stirred at same temperature for 3 h. To the reaction mixture was added H2O,
column chromatography on silica gel (n-hexane/ethyl acetate; 10:1 to 3:1) to give tosylate (12.0
mg, 47% in 2 steps). To a solution of tosylate (12.0 mg, 0.016 mmol) in MeOH (0.2 mL) and THF
(0.1 mL) was added K2CO3 (10.5 mg, 0.076 mmol) at 0 °C, and the mixture was stirred at 50 °C
for 10 h. Saturated NHCl4 aq. was added to the reaction mixture, and the aqueous layer was
over MgSO4, and concentrated in vacuo. The residue was purified by preparative TLC (n-
hexane/ethyl acetate; 2:1) to give S9a (6.5 mg, 62%) and S9b (4.0 mg, 38%), respectively. To a
solution of TES ether S9a (4.1 mg, 0.006 mmol) in THF (0.2 mL) was added 3HF·Et3N (0.04 mL,
0.25 mmol) at 0 °C, and the reaction mixture was stirred at room temperature for 18 h. Saturated
NaHCO3 aq. was added to the reaction mixture, and the aqueous layer was extracted with ethyl
acetate three times. The combined organic layer was washed with brine, dried over MgSO 4, and
concentrated in vacuo. The residue was purified by column chromatography on silica gel (n-
hexane/ethyl acetate; 1:1) to give 32g (3.4 mg, quant.). 32g: []26D = +89.3 (c 0.69 in CHCl3); 1H
NMR (300 MHz, CDCl3)  7.75 (d, J = 8.3 Hz, 2H), 7.30 (d, J = 7.9 Hz, 2H), 6.28 (d, J = 11.7
Hz, 1H), 5.58 (d, J = 11.0 Hz, 1H), 4.43 (d, J = 7.9 Hz, 1H), 3.90-3.95 (m, 1H), 3.65 (s, 1H), 2.76
(dd, J = 12.4, 3.1 Hz, 1H), 2.28-2.48 (m, 7H), 1.83-2.17 (m, 11H), 1.02-1.67 (m, 12H), 0.85-0.95
(m, 7H), 0.53 (s, 3H); 13C NMR (100 MHz, CDCl3) 143.9, 143.3, 137.9, 129.9, 129.7, 126.9,
124.2, 114.8, 71.1, 67.1, 56.5, 56.2, 49.3, 45.8, 44.4, 40.8, 40.3, 36.4, 36.1, 34.5, 29.7, 29.3, 29.2,
28.9, 27.7, 23.4, 22.3, 21.6, 20.8, 18.8, 12.0 ppm; HRMS (ESI): m/z calcd for C33H51NNaO4S:
580.3437 [M+Na]+; found: 580.3481. To a solution of TES ether S2b (4.0 mg, 0.006 mmol) in
THF (0.2 mL) was added 3HF·Et3N (0.04 mL, 0.25 mmol) at 0 °C, and the reaction mixture was
stirred at room temperature for 1d. Saturated NaHCO3 aq. was added to the reaction mixture, and
the aqueous layer was extracted with ethyl acetate three times. The combined organic layer was
column chromatography on silica gel (n-hexane/ethyl acetate; 1:1) to give 32h (3.0 mg, 90%).
32h: []26D = +143.8 (c 0.16 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.76 (d, J = 8.3 Hz, 2H),
7.31 (d, J = 7.9 Hz, 2H), 6.14 (d, J = 11.7 Hz, 1H), 5.77 (d, J = 10.7 Hz, 1H), 4.44 (d, J = 8.3 Hz,
1H), 3.91 (d, J = 11.7 Hz, 1H), 3.65 (s, 1H), 2.59-2.75 (m, 2H), 2.44 (s, 3H), 2.14-2.36 (m, 2H),
1.79-2.05 (m, 6H), 1.22-1.71 (m, 21H), 0.85-0.96 (m, 5H), 0.58 (s, 3H); 13C NMR (100 MHz,
CDCl3)  144.0, 143.5, 137.9, 129.8, 127.0, 124.3, 114.9, 71.1, 66.7, 56.5, 56.3, 49.7, 45.9, 44.4,
S24
42.8, 40.6, 40.4, 36.5, 36.4, 36.1, 29.4, 29.2, 28.9, 27.6, 23.5, 22.3, 21.5, 20.7, 18.8, 12.2 ppm;
HRMS (ESI) m/z calcd for C33H51NNaO4S: 580.3437 [M+Na]+; found: 580.3429.
Compound 37c
S10c 37c
To a solution of alcohol S10c (18.0 mg, 0.031 mmol) in CH2Cl2 (0.6 mL) was added DAST (5.0
L, 0.038 mmol) at -78 °C, and the reaction mixture was stirred at the same temperature for 50
min. To the reaction mixture was added saturated NH4Cl aq., and the aqueous layer was extracted
gel (n-hexane/ethyl acetate; 10:1) to give fluoride (10.5 mg, 58%). To a solution of coupling
product (10.5 mg) in EtOH (2.0 mL) was added H2NNH2·H2O (2.4 L, 0.048 mmol) at room
temperature, and the reaction mixture was stirred at 60 °C for 2 h. The reaction mixture was
(3.1 mL) were added Et3N (3.8 L, 0.028 mmol) and p-TsCl (2.7 mg, 0.014 mmol) at 0 °C, and
the mixture was stirred at same temperature for 1.5 h. To the reaction mixture was added H 2O,
washed with brine, dried over MgSO4, and concentrated in vacuo. Then, MOM group was
deprotected as it left at room temperature. Purification conducted by preparative TLC (n-
hexane/ethyl acetate; 4:1) to give 37c (0.97 mg, 14% in 3 steps). 37c: []26D = +34.7 (c 0. 30 in
CHCl3); 1H NMR (300 MHz, CDCl3)  7.75 (d, J = 8.3 Hz, 2H), 7.29 (d, J = 8.3 Hz, 2H), 6.31 (d,
J = 11.4 Hz, 1H), 5.68 (d, J = 11.7 Hz, 1H), 4.83 (dd, J = 9.6, 2.8 1H), 4.71 (brd, J = 44 Hz 1H),
3.49-3.75 (m, 2H), 2.76-2.80 (m, 1H), 2.31-2.48 (m,9H), 1.83-2.09 (m, 6H), 1.06-1.73 (m, 18H),
0.94 (t, J = 5.7 Hz, 3H), 0.54 (s, 3H); 13C NMR (100 MHz, CDCl3)  144.02, 143.22, 138.40,
129.68, 126.96, 125.11, 115.01, 71.12, 56.52, 56.26, 49.37, 45.80, 44.38, 42.08, 40.39, 36.38,
36.12, 34.76, 31.91, 29.68, 29.35, 29.22, 28.92, 27.71, 23.50, 22.68, 22.26, 21.56, 20.82, 18.78,
14.11, 12.07 ppm; HRMS (ESI) m/z calcd for C33H50FNNaO3S: 582.3393 [M+Na]+; found:
582.3384.
S25
Compound 37d
S10d 37d
37d was synthesized by the same procedure described as 37c.

37d: yield: 29% (4 steps); []26D = +93.4 (c 0.64 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.76
4.90 (dd, J = 9.6, 3.1 Hz, 1H), 4.68 (dt, J = 47.8, 3.1 Hz, 1H), 3.55 (t, J = 4.8 Hz, 1H), 2.58-2.76
(m, 2H), 2.22-2.52 (m, 6H), 1.22-2.13 (m, 26H), 0.78-1.14 (m, 6H), 0.50-0.61 (m, 3H); 13C NMR
(400 MHz, CDCl3)  144.02, 143.28, 138.45, 129.67, 127.01, 124.95, 114.86, 90.71, 88.99, 71.10,
56.50, 56.27, 49.81, 45.86, 44.37, 42.48, 40.43, 37.12, 36.93, 36.35, 36.05, 33.99, 33.77, 29.36,
C33H50FNNaO3S: 582.3393 [M+Na]+; found: 582.33845.
Compound 37e
S8a 37e
To a solution of alcohol S8a (10.4 mg, 0.016 mmol) in CH2Cl2 (0.9 mL) was added DAST (3.0
MgSO4, and concentrated in vacuo. To a solution of TES ether in THF (1.0 mL) was added
3HF·Et3N (0.05 mL, 0.31 mmol) at 0 °C, and the reaction mixture was stirred at room temperature
for 1 d. Saturated NaHCO3 aq. was added to the reaction mixture, and the aqueous layer was
S26
hexane/ethyl acetate; 2:1) to give 37e (2.9 mg, 33% in 2 steps). 37e: []26D = +6.7 (c 0.18 in
CHCl3); 1H NMR (400 MHz, CDCl3)  7.76 (dd, J = 8.5, 2.1 Hz, 2H), 7.30 (d, J = 8.2 Hz, 2H),
6.30 (d, J = 11.4 Hz, 1H), 5.68 (d, J = 11.4 Hz, 1H), 4.79 (dd, J = 9.1, 2.3 Hz, 1H), 4.57-4.72 (m,
1H), 3.50 (t, J = 4.8 Hz, 1H), 2.75-2.79 (m, 1H), 2.27-2.46 (m, 7H), 1.86-2.03 (m, 4H), 1.25-1.76
(m, 16H), 1.23 (s, 6H), 0.86-0.97 (m, 4H), 0.56 (s, 3H); 13C NMR (100 MHz, CDCl3)  144.20,
143.34, 138.49, 129.79, 127.29, 127.22, 127.05, 124.98, 115.05, 90.92, 89.20, 71.21, 56.66, 56.42,
49.55, 49.49, 46.00, 44.49, 42.28, 42.07, 40.53, 37.72, 37.54, 36.48, 36.16, 34.98, 29.78, 29.49,
C33H50FNNaO3S: 582.3393 [M+Na]+; found: 582.3379.
Compound 37f
S8b 37f
To a solution of alcohol S8b (10.5 mg, 0.016 mmol) in CH2Cl2 (0.9 mL) was added DAST (3.0
MgSO4, and concentrated in vacuo. To a solution of TES ether in THF (0.6 mL) was added
3HF·Et3N (0.05 mL, 0.37 mmol) at 0 °C, and the reaction mixture was stirred at room temperature
for 1 d. Saturated NaHCO3 aq. was added to the reaction mixture, and the aqueous layer was
hexane/ethyl acetate; 2:1) to give 37f (1.9 mg, 22% in 2 steps). 37f: []26D = +14.1 (c 0.07 in
CHCl3); 1H NMR (300 MHz, CDCl3)  7.75 (d, J = 8.3 Hz, 2H), 7.30 (d, J = 8.3 Hz, 2H), 6.08 (d,
J = 11.7 Hz, 1H), 5.75 (d, J = 11.4 Hz, 1H), 4.92 (dd, J = 9.6, 3.8 Hz, 1H), 4.76 (dt, J = 49 Hz,
1H), 3.61-3.68 (m, 1H), 2.69-2.79 (m, 2H), 2.28-2.43 (m, 6H), 1.79-2.17 (m, 7H), 1.07-1.73 (m,
19H), 0.87-0.94 (m, 4H), 0.54 (d, J = 11.0 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 144.03, 143.23,
138.66, 129.71, 127.03, 125.20, 114.84, 71.12, 56.49, 56.25, 49.80, 45.81, 44.40, 42.34, 40.39,
36.37, 36.10, 33.92, 33.71, 29.35, 29.23, 29.01, 27.65, 23.53, 22.22, 21.54, 20.81, 18.80, 12.05
ppm; HRMS (ESI) m/z calcd for C33H50FNNaO3S: 582.3393 [M+Na]+; found: 582.3406.
S27
Compound S12
S11 S12
To a solution of alcohol S11[4] (350.9 mg, 0.899 mmol) in CH2Cl2 (18.0 mL) was added NMO
(440.7 mg, 3.76 mmol) and MS 4A (455.7 mg) at 0 °C, and the reaction mixture was stirred at the
same temperature for 30 min. To the reaction mixture was added TPAP (45.5 mg, 0.130 mmol)
at 0 °C, and the resulting mixture was stirred at room temperature for 1.5 h. The reaction mixture
was directly subjected to silica gel column chromatography (n-hexane/ethyl acetate = 2:1) to give
ketone (347.5 mg, 99%). To a suspension of NaH (60% oil dispersion, 346.1 mg, 8.653 mmol) in
THF (6.0 mL) was added triethyl phosphonoacetate (1.6 mL, 8.0 mmol) at 0 °C, and the mixture
was stirred at room temperature for 2 h. A solution of ketone (347.5 mg, 0.895 mmol) in THF (3.0
mL) was added to the mixture above at room temperature. After being stirred at same temperature
for 4 d, H2O was added to the reaction mixture, and the aqueous layer was extracted with ethyl
acetate three times. The combined organic layer was washed with brine, dried over MgSO4, and
hexane/ethyl acetate; 20:1) to give ,-unsaturated ester (337.3 mg, 82%). To a solution of ,-
unsaturated ester (1.1452 g, 3.2670 mmol) in CH2Cl2 (32 mL) was added DIPEA (1.35 mL, 7.55
mmol) and MOMCl (0.52 mL, 6.85 mmol) at 0 °C, and the reaction mixture was stirred at same
temperature for 20 h. To the reaction mixture was added saturated NH4Cl aq. and the aqueous
layer was extracted with ethyl acetate three times. The combined organic layer was washed with
brine, dried over MgSO4, and concentrated in vacuo. The residue was purified by column
chromatography on silica gel (n-hexane/ethyl acetate; 50:1 to 8:1) to give ,-unsaturated ester
protected MOM ether (360 mg, 67%). To a solution of ,-unsaturated ester protected MOM
ether (359.8 mg, 0.716 mmol) was added DIBAL-H (1.0 M solution in PhMe, 2.3 mL, 2.3 mmol)
at -78 °C, and the reaction mixture was stirred at same temperature for 30 min. To the reaction
mixture were added MeOH (1.6 mL) and saturated Rochelle salt aq. (2.8 mL), and the aqueous
layer was extracted with CHCl3 three times. The combined organic layer was washed with brine,
S28
dried over MgSO4, and concentrated in vacuo. The residue was purified by column
chromatography on silica gel (n-hexane/ethyl acetate; 4:1) to give allylic alcohol (338.6 mg,
quant.). To a solution of allylic alcohol (338.6 mg, 0.716 mmol) in CH2Cl2 (3.6 mL) were added
2-mercaptobenzothiazole (135.5 mg, 0.810 mmol), PPh3 (215.0 mg, 0.820 mmol), and DIAD
(0.16 mL, 0.80 mmol) at 0 °C, and the reaction mixture was stirred at same temperature for 1 h.
The reaction mixture was concentrated in vacuo. The residue was purified by column
chromatography on silica gel (n-hexane/ethyl acetate; 100:1) to give sulfide (462.8 mg). To a
solution of sulfide (462.8 mg) in EtOH (3.6 mL) and THF (3.6 mL) were added
(NH4)6Mo7O24·4H2O (270.7 mg, 0.219 mmol) and 30% H2O2 aq. (2.4 mL) at 0 °C, and the
reaction mixture was stirred at room temperature for 1 h. To the reaction mixture was added
saturated Na2S2O3 aq. at 0 °C and the aqueous layer was extracted with ethyl acetate three times.
The residue was purified by column chromatography on silica gel (n-hexane/ethyl acetate; 10:1)
to give sulfone S12 (446.3 mg, 97% in 2 steps). S12: []21D= +46.0 (c 0.47 in CHCl3); 1H NMR
(300 MHz, CDCl3)  8.17-8.22 (m, 1H), 7.98-8.01 (m, 1H), 7.61 (dtd, J = 16.6, 7.3, 1.3 Hz, 2H),
5.01 (t, J = 7.9 Hz, 1H), 4.87-4.91 (m, 2H), 4.43 (dd, J = 14.4, 8.9 Hz, 1H), 4.15-4.23 (m, 1H),
3.41-3.45 (m, 3H), 2.54 (d, J = 13.1 Hz, 1H), 1.73-2.04 (m, 5H), 1.11-1.62 (m, 15H), 0.84-0.90
(m, 4H), 0.23 (d, J = 9.6 Hz, 3H); 13C NMR (75 MHz, CDCl3)  165.46, 165.32, 152.32, 151.72,
151.36, 136.45, 127.48, 127.15, 124.76, 124.47, 121.81, 120.63, 106.88, 103.86, 92.26, 80.10,
79.72, 79.36, 56.73, 55.98, 55.70, 55.40, 53.70, 53.38, 45.21, 44.81, 39.42, 36.70, 35.74, 35.26,
34.12, 33.37, 28.47, 28.13, 26.92, 26.37, 24.46, 22.67, 21.57, 21.43, 20.82, 19.52, 18.97, 18.45,
18.11, 11.00 ppm; HRMS (ESI) m/z calcd for C29H37F6NNaO4S2: 664.1966 [M+Na]+; found:
664.1932.
Compound S13a and S13b
S12 S6b
S13a S13b
S29
To a solution of (1,3)-ketone S6b (34.6 mg, 0.093 mmol) and sulfone S12 (60.0 mg, 0.094
78 °C, and the reaction mixture was stirred at the same temperature for 1.5 h. To the reaction
mixture was added H2O, and the aqueous layer was extracted with ethyl acetate three times. The
The residue was purified by column chromatography on silica gel (n-hexane/ethyl acetate; 20:1)
to give coupling product (65.3 mg, 88%). To a solution of coupling product (65.3 mg) in EtOH
(0.6 mL) was added H2NNH2·H2O (11.5 L, 0.237 mmol) at room temperature, and the reaction
mixture was stirred at 60 °C for 1.5 h. The reaction mixture was filtered through a plug of cotton
and concentrated in vacuo. To a solution of the residue in CH2Cl2 (0.9 mL) were added Et3N (6.0
L, 0.043 mmol) and p-TsCl (8.4 mg, 0.044 mmol) at 0 °C, and the mixture was stirred at the
same temperature for 1.5 h. To the reaction mixture was added H2O, and the aqueous layer was
extracted with CH2Cl2 three times. The combined organic layer was washed with brine, dried over
gel (n-hexane/ethyl acetate; 4:1) to give tosylate (16.2 mg, 73% in 3 steps). To a solution of
tosylate (16.2 mg, 0.0197 mmol) in THF (0.5 mL) was added TBAF (1.0 M in THF, 30.0 L, 0.03
mmol) at room temperature, and the mixture was stirred at the same temperature for 40 min. Brine
was added to the reaction mixture, and the aqueous layer was extracted with ethyl acetate three
times. The combined organic layer was washed with brine, dried over MgSO4, and concentrated
in vacuo. The residue was purified by preparative TLC (n-hexane/ethyl acetate; 1:1) to give S13a
(4.8 mg, 31%) and S13b (6.0 mg, 43%), respectively. S13a: []26D = +58.8 (c 0.84 in CHCl3); 1H
NMR (300 MHz,CDCl3) δ 7.76 (d, J = 8.3 Hz, 2H), 7.29 (d, J = 8.3 Hz, 2H), 6.26 (d, J = 11.4 Hz,
1H), 5.70 (d, J = 11.7 Hz, 1H), 5.23 (d, J = 8.6 Hz, 1H), 4.92 (d, J = 7.6 Hz, 2H), 3.90 (d, J = 3.1
Hz, 1H), 3.49 (d, J = 8.6 Hz, 5H), 2.75-2.80 (m, 1H), 1.07-2.43 (m, 27H), 0.90-0.96 (m, 3H), 0.51
(d, J = 24.1 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 143.11, 143.04, 138.42, 129.65, 129.23,
126.96, 123.96, 115.32, 92.77, 68.69, 56.57, 56.41, 56.21, 50.18, 45.74, 44.77, 40.40, 39.19, 36.37,
35.98, 35.12, 28.86, 28.78, 27.71, 23.46, 22.26, 21.54, 18.99, 18.72, 12.08 ppm; HRMS (ESI) m/z
calcd for C35H49F6NNaO5S: 732.3133 [M+Na]+; found: 732.3093. S5b: []26D = +102.6 (c 1.22
in CHCl3); 1H NMR (300 MHz, CDCl3) δ 7.76 (d, J = 8.3 Hz, 2H), 7.30 (d, J = 8.3 Hz, 2H), 6.10
(d, J = 11.4 Hz, 1H), 5.76 (d, J = 11.0 Hz, 1H), 5.22 (d, J = 8.9 Hz, 1H), 4.92 (s, 2H), 3.85 (d, J
= 3.8 Hz, 1H), 3.42-3.46 (m, 4H), 2.71-2.75 (m, 1H), 2.22-2.56 (m, 7H), 1.28-2.13 (m, 19H), 0.92
(dd, J = 17.0, 6.4 Hz, 4H), 0.56 (s, 4H); 13C NMR (75 MHz, CDCl3) δ 143.19, 143.12, 138.32,
129.63, 126.97, 123.58, 115.18, 92.71, 68.38, 56.52, 56.32, 56.19, 50.72, 45.74, 43.05, 40.36,
39.84, 36.50, 36.31, 35.88, 28.72, 27.58, 23.41, 22.21, 21.47, 18.90, 18.67, 12.05 ppm; HRMS
(ESI) m/z calcd for C35H49F6NNaO5S: 732.3133 [M+Na]+; found: 732.3181.
S30
Compound 38c
S13a 38c
To a solution of alcohol S13a (4.3 mg, 0.061 mmol) in CH2Cl2 (0.5 mL) was added DAST (1.5
MgSO4, and concentrated in vacuo. To a solution of MOM ether in MeOH (1.2 mL) was added
MsOH (20 L) at 0 °C, and the reaction mixture was stirred at room temperature for 1 d. Saturated
acetate three times. The combined organic layer was washed with brine, dried over MgSO4, and
concentrated in vacuo. The residue was purified by preparative TLC (n-hexane/ethyl acetate; 4:1)
to give 38c (2.6 mg, 65% in 2 steps). 38c: []26D = +59.2 (c 0.26 in CHCl3); 1H NMR (300 MHz,
CDCl3)  7.75 (d, J = 8.6 Hz, 2H), 7.29 (d, J = 7.9 Hz, 2H), 6.31 (d, J = 11.1 Hz, 1H), 5.70 (d, J
= 11.0 Hz, 1H), 4.84 (dd, J = 9.5 Hz, 1H), 4.70 (dt, J = 49 Hz, 1H), 3.55-3.60 (m, 1H), 2.76-2.87
(m, 2H), 2.33-2.47 (m, 8H), 1.09-2.08 (m, 17H), 0.88-0.96 (m, 5H), 0.56 (d, J = 12.4 Hz, 3H);
13
C NMR (100 MHz, CDCl3)  143.80, 143.23, 138.40, 129.69, 126.97, 125.10, 115.13, 90.90,
89.20, 56.41, 56.22, 49.38, 45.80, 42.08, 41.86, 40.38, 37.04, 36.86, 36.15, 35.97, 34.80, 30.80,
29.69, 28.89, 27.71, 23.47, 22.25, 21.55, 18.67, 18.53, 14.12, 12.08 ppm; HRMS (ESI) m/z calcd
for C33H44F7NNaO3S: 690.2828 [M+Na]+; found: 690.2804.
Compound 38d
S13b 38d
To a solution of alcohol S13b (6.0 mg, 0.085 mmol) in CH2Cl2 (0.5 mL) was added DAST (2.0
S31
MgSO4, and concentrated in vacuo. To a solution of MOM ether in MeOH (1.7 mL) was added
MsOH (30 L) at 0 °C, and the reaction mixture was stirred at room temperature for 1 d. Saturated
concentrated in vacuo. The residue was purified by preparative TLC (n-hexane/ethyl acetate; 4:1)
to give 38d (3.3 mg, 59% in 2 steps). 38d: []26D = +80.0 (c 0.33 in CHCl3); 1H NMR (400 MHz,
CDCl3) δ 7.76 (d, J = 8.2 Hz, 2H), 7.31 (d, J = 8.2 Hz, 2H), 6.11 (d, J = 11.0 Hz, 1H), 5.76 (d, J
= 11.0 Hz, 1H), 4.89 (dd, J = 9.6, 3.2 Hz, 1H), 4.68 (dt, J = 48.0, 3.2 Hz, 1H), 4.26-4.36 (m, 1H),
3.51-3.57 (m, 1H), 2.28-2.91 (m, 8H), 0.68-2.17 (m, 20H), 0.55-0.62 (m, 3H), -0.01-0.07 (m, 3H);
13
C NMR (100 MHz, CDCl3) δ 143.84, 143.31, 138.48, 130.91, 129.69, 128.82, 127.04, 125.00,
114.97, 90.77, 89.06, 56.39, 56.24, 49.86, 45.88, 42.48, 40.43, 37.01, 36.82, 36.15, 35.90, 33.98,
33.76, 30.80, 29.69, 28.84, 27.62, 23.46, 22.22, 21.54, 18.69, 18.47, 12.12 ppm; HRMS (ESI) m/z
calcd for C33H44F7NNaO3S: 690.2828 [M+Na]+; found: 690.2801.
S32
Compound 38e and 38f
S12 S6c
S13c S13d
38e 38f
To a solution of (1,3)-ketone S6c (59.5 mg, 0.164 mmol) and sulfone S12 (126.9 mg, 0.198
78 °C, and the reaction mixture was stirred at the same temperature for 2 h. To the reaction mixture
was added H2O, and the aqueous layer was extracted with ethyl acetate three times. The combined
was purified by column chromatography on silica gel (n-hexane/ethyl acetate; 20:1) to give
coupling product (137.5 mg, quant.). To a solution of coupling product (137.5 mg) in EtOH (2.0
mL) was added H2NNH2·H2O (40.0 L, 0.154 mmol) at room temperature, and the reaction
mixture was stirred at 60 °C for 1.5 h. The reaction mixture was filtered through a plug of cotton
and concentrated in vacuo. To a solution of the residue in CH2Cl2 (5.4 mL) were added Et3N (70.0
L, 0.047 mmol) and p-TsCl (53.2 mg, 0.28 mmol) at 0 °C, and the mixture was stirred at the
same temperature for 1.5 h. To the reaction mixture was added H2O, and the aqueous layer was
extracted with CH2Cl2 three times. The combined organic layer was washed with brine, dried over
gel (n-hexane/ethyl acetate; 4:1) to give tosylate (62.5 mg, 47% in 3 steps). To a solution of
tosylate (62.5 mg, 0.0768 mmol) in MeOH (0.75 mL) and THF (0.75 mL) was added K2CO3 (26.7
S33
mg, 0.193 mmol) at 0 °C, and the mixture was stirred at room temperature for 16 h. Saturated
NHCl4 aq. was added to the reaction mixture, and the aqueous layer was extracted with ethyl
hexane/ethyl acetate; 8:1 to 4:1) to give S13c (15.4 mg, 28%) and S13d (27.8 mg, 51%),
respectively. To a solution of alcohol S13c (15.4 mg, 0.022 mmol) in CH2Cl2 (1.2 mL) was added
DAST (4.5 L, 0.034 mmol) at -78 °C, and the reaction mixture was stirred at the same
temperature for 1 h. To the reaction mixture was added saturated NH4Cl aq., and the aqueous layer
was extracted with ethyl acetate three times. The combined organic layer was washed with brine,
dried over MgSO4, and concentrated in vacuo. To a solution of MOM ether in MeOH (2.0 mL)
was added MsOH (40 L) at 0 °C, and the reaction mixture was stirred at room temperature for
1 d. Saturated NaHCO3 aq. was added to the reaction mixture, and the aqueous layer was extracted
MgSO4, and concentrated in vacuo. The residue was purified by preparative TLC (CHCl3/ethyl
acetate; 25:1) to give 38e (2.8 mg, 19% in 2 steps). 38e: []26D = +9.5 (c 0.19 in CHCl3); 1H NMR
(300 MHz, CDCl3)  7.75 (d, J = 7.9 Hz, 2H), 7.30 (d, J = 8.3 Hz, 2H), 6.31 (d, J = 11.4 Hz, 1H),
5.69 (d, J = 12.0 Hz, 1H), 4.81 (d, J = 10.3 Hz, 1H), 4.66 (dt, J = 44 Hz, 1H), 3.52 (s, 1H), 2.89
(s, 1H), 2.75-2.80 (m, 1H), 2.34-2.49 (m, 10H), 1.12-2.17 (m, 15H), 0.89-0.97 (m, 5H), 0.54 (d,
J = 14.1 Hz, 3H); 13C NMR (100 MHz, CDCl3)  143.88, 143.25, 138.40, 129.71, 127.03, 126.96,
125.24, 124.88, 115.08, 68.51, 56.44, 56.28, 49.47, 49.40, 45.90, 41.97, 40.41, 37.34, 36.15, 35.88,
34.93, 30.80, 29.69, 28.90, 27.69, 23.48, 22.21, 21.55, 18.69, 18.46, 12.06 ppm; HRMS (ESI) m/z
calcd for C33H44F7NNaO3S: 690.2828 [M+Na]+; found: 690.2801. To a solution of alcohol S13d
(15.4 mg, 0.022 mmol) in CH2Cl2 (1.2 mL) was added DAST (4.5 L, 0.034 mmol) at -78 °C,
and the reaction mixture was stirred at the same temperature for 1 h. To the reaction mixture was
added saturated NH4Cl aq., and the aqueous layer was extracted with ethyl acetate three times.
To a solution of MOM ether in MeOH (2.0 mL) was added MsOH (40 L) at 0 °C, and the reaction
mixture was stirred at room temperature for 1 d. Saturated NaHCO3 aq. was added to the reaction
mixture, and the aqueous layer was extracted with ethyl acetate three times. The combined organic
purified by preparative TLC (CHCl3/ethyl acetate; 25:1) to give 38f (5.2 mg, 36% in 2 steps). 38f:
[]26D = -5.8 (c 0.42 in CHCl3); 1H NMR (300 MHz, CDCl3)  7.76 (d, J = 8.3 Hz, 3H), 7.31 (d,
J = 7.9 Hz, 2H), 6.09 (d, J = 11.0 Hz, 1H), 5.75 (d, J = 11.0 Hz, 1H), 4.92-4.95 (m, 1H), 4.76 (d,
J = 47.1 Hz, 1H), 3.64 (t, J = 4.8 Hz, 2H), 2.70-2.81 (m, 3H), 1.07-2.43 (m, 57H), 0.89-0.95 (m,
6H), 0.53 (s, 4H); 13C NMR (100 MHz, CDCl3)  143.81, 143.24, 138.65, 129.71, 127.02, 125.15,
114.94, 90.96, 89.27, 56.36, 56.20, 49.80, 45.80, 42.35, 40.37, 36.62, 36.43, 36.13, 35.93, 33.92,
S34
33.70, 30.78, 28.97, 27.64, 23.49, 22.20, 21.54, 18.67, 18.51, 12.05 ppm; HRMS (ESI) m/z calcd
for C33H44F7NNaO3S: 690.2828 [M+Na]+; found: 690.2831.
S35
2. Experimental procedure for biological experiments and material information
Cell Culture
CHO-K1 cells were maintained in medium A (1:1 mixture of Ham’s F-12 medium and
DMEM, supplemented with 100 units/mL penicillin, 100 g/mL streptomycin sulfate, and 5%
[v/v] fetal bovine serum) at 37 C in a humidified 5% CO2 incubator.
Antibodies
Primary antibodies used for immunoblotting were as follows: mouse monoclonal anti-
hamster-SCAP (IgG-9D5, Santa Cruz Biotechnology); mouse monoclonal anti-hamster-SREBP-
2 (IgG-7D4)[5]; rabbit polyclonal anti-hamster-SOAT1 (NB400-141, Novus Biologicals); mouse
monoclonal anti-actin (IgG-AC-40, Abcam). Secondary antibodies used for immunoblotting were
ECL® peroxidase-labeled anti-mouse antibody (GE Healthcare) and anti-rabbit IgG, HRP-linked
antibody (Cell Signaling).
Luciferase Reporter Assay

CHO-K1 cells were seeded into 96-well plates at 8103 cells per well in medium A and
incubated for 24 h. For SREBP reporter assay, cells were co-transfected with an SRE-1-driven
luciferase reporter plasmid (pSRE-Luc) and an actin promoter-driven -galactosidase expression
plasmid (pAc--gal) at a 20:1 ratio, using FuGENE HD Transfection Reagent (Promega)
according to the manufacturer’s protocol. For VDR reporter assay, Cignal Vitamin D Receptor
Reporter (QIAGEN) was transfected instead of pSRE-Luc. After 20 h, the medium was changed
to medium B (1:1 mixture of Ham’s F-12 medium and DMEM, supplemented with 100 units/mL
penicillin, 100 g/mL streptomycin sulfate, 5% [v/v] lipid-depleted serum, 50 M compactin
(Tokyo Chemical Industry), and 50 M lithium mevalonate (Sigma-Aldrich)) containing the
specific test compounds. After a 24-h incubation, the cells in each well were lysed with 100 L
of 1x Reporter Lysis Buffer (Promega), and 50 μL of aliquots were used to measure luciferase
and -gal activities. Luciferase activity was measured using the Steady-Glo Luciferase Assay
System (Promega), and -gal activity was measured using the -Galactosidase Enzyme Assay
System (Promega). Luciferase activity was normalized to -gal activity.
Western Blot Analysis

Cells were washed three times with cold PBS, and lysed with buffer A (50 mM Tris-HCl
[pH 7.5], 150 mM NaCl, 1% [v/v] Nonidet P-40, 0.5% [w/v] sodium deoxycholate, 8 M urea, and
protease inhibitor cocktail (Nacalai Tesque)). The cell lysates were passed 16 times through a 25G
needle and centrifuged at 7,000  g at 4 C for 10 min. The supernatants were transferred to new
S36
tubes, and the pellets were extracted with a buffer A. The resulting buffer was centrifuged at 7,000
 g at 4 C for 10 min, and the supernatants were combined to respective original supernatants.
The resulting lysate was mixed with 0.2 volume of 6SDS sample buffer (Nacalai Tesque) and
incubated at room temperature for 30 min. The samples were separated by SDS-PAGE and blotted
using specific antibodies. The specific bands were visualized using enhanced chemiluminescence
(ECL Prime Western Blotting Detection Reagent, GE Healthcare) on an ImageQuant LAS 500
(GE Healthcare).
RNA Sequencing (RNA-seq)

CHO-K1 cells were added to 6-well plates at 3105 cells per well in medium A and
incubated for 24 h. The medium was then replaced with medium B containing each compound (5
and the cells were incubated for another 24 h. Total RNA was isolated with ISOGEN
(NIPPON GENE) following the manufacturer protocol. RNA sequence analysis was performed
by Takara Bio. The data was submitted to the GEO database (accession number GSE134965).
Before selecting the candidate genes, we filtered the data to remove the genes that showed
0 FPKM in all the samples and/or less than 16 read counts in any samples treated with compounds.
We then selected candidate genes that showed over 2-fold changes in their expression levels in
both of the samples treated with 25(OH)D3 (compound 2) or compound 38d, and 0.5-1.5 fold
changes in the samples with compound 6. A total of 209 genes were selected as candidate genes
(listed in a supplementary Excel file).
Gene Ontology (GO) Analysis

CHO-K1 cells that we used for RNA sequencing is the cells isolated from Chinese hamster.
Since the number of the Chinese hamster genes registered in GO is not large enough for GO
analysis, gene IDs of corresponding mouse genes were used for the GO analysis
(ftp://ftp.ncbi.nih.gov/gene/DATA/gene_orthologs.gz). The GO analysis was performed using the
geneontology database (http://www.geneontology.org/ontology/subsets/goslim_generic.obo).
Real-time Quantitative PCR (qPCR)

Total RNA was isolated as described for RNA sequencing. cDNA was synthesized with
Primescript 1st strand synthesis kit (Takara Bio). For qPCR analysis, cDNA was added to a
solution containing the primers (500 nM each) and Fast SYBR Green Reagent (Thermo Fisher
Scientific), and the reaction (in triplicates) was run in 7500 Fast Real Time PCR System (Applied
Biosystems). The sequence of primers for the respective genes (Acsl5, Abca1, Acot1, Pla2q12a,
Dgat2, Soat1, Hmgcr, Fasn, Srebp-1, Srebp-2) are shown in Table S1. Data were analyzed by -
Ct method with -actin as reference control.
S37
RNA Interference (RNAi)
CHO-K1 cells were added to 6-well plates at 1105 cells per well in medium A and
incubated for 24 h. Then, siRNAs targeting EGFP (Ambion) or SREBP-1/SREBP-2 (each 12.5
pmol) (sequence shown in Table S2) were transfected with Lipofectamine RNAi MAX
Transfection Reagent (Thermo Fisher Scientific). After 24 h, the medium was replaced with
medium B and the cells were further incubated for 24 h. Each mRNA level was analyzed by qPCR.
For western blotting, transfected cells were washed with PBS and treated with 1x RIPA
buffer (25 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1% [v/v] Nonidet P-40, 1% [w/v] sodium
deoxycholate) containing protease inhibitor cocktail. The cell lysates were passed 10 times
through a 25G needle. After centrifugation at 5,000  g for 15 min, the supernatant was collected
and mixed with 0.2 volume of 6SDS sample buffer. Proteins were analyzed by immunoblotting.
Table S1. qPCR primer sequences

Target Gene
Forward Reverse
(hamster)
Acs15 GTGGGGATTGAGGGAGGAGCACG GGTCCATTGTCAGACACAACAAG
Abca1 AACAGTTTGTGGCCCTTTTG AGTTCCAGGCTGGGGTACTT
Acot1 CCACCCTGAGGTGAAGGG GCAGACCTTCCACAACATCC
Pla2q12a CATCTGAACATTGGCATCCCTTCC CCACAGTTGTTTCACATGCC
Dgat2 TGAGGTGCCATCGTCTGCAAG GCAGCCACAGGAAAGATGTTGGATG
Soat1 CAGATACACAGAGCAATGGTCGC CAAGAATGGAGAAGGTTGTGAGAGC
Hmgcr AGATACTGGAGAGTGCCGAGAAA TTTGTAGGCTGGGATGTGCTT
Fasn AGCCCCTCAAGTGCACAGTG TGCCAATGTGTTTTCCCTGA
Srebp-1 GGAACCCAGTGGATCCCC TGGAGCTGACAGAGAAGCTGC
Srebp-2 GCTGGTAAATGGTGTGATTG CGGCCCAAAACTGATAAAC
beta-actin AGTGTGACGTTGACATCCGT GCAGCTCAGTAACAGTCCGC
Table S2. siRNA sequence

Target gene sequence
hamster_srebp-1 sense GUACCAUUGGUUGUGGAUAdTdT
anti-sense UAUCCACAACCAAUGGUACdTdT
hamster_srebp-2 sense CUCAAUGUCAGUGGAGCUAdTdT
anti-sense UAGCUCCACUGACAUUGAGdTdT
S38
Table S3. Candidate genes whose expressions are suppressed by SREBPs.
38d (SREBP inhibitor) 6 (VDR agonist) 25(OH)D3
Acsl5 2.24 1.42 6.52
Abca1 9.97 0.78 9.90
Acot1 3.83 1.25 3.21
Pla2g12a 2.76 1.38 5.96
Dgat2 3.06 1.35 10.87
Soat1 2.13 1.06 3.22
Values, which were assessed by RNA-seq analysis, are gene expression ratios to control.
S39
A) B)
C) D)
Figure S1. Cellular Component analysis by gene ontology.

(A-C) Cellular component analysis of the genes induced by 25(OH)D3 (2) (A), 38d (B), or 6 (C).
(D) Cellular component analysis of the 209 candidate genes. The candidate genes showed over 2-
fold changes in their expression levels in both of the samples treated with 25(OH)D3 (compound
2) or compound 38d, and 0.5-1.5 fold changes in the samples with compound 6 (listed in a
supplementary Excel file).
S40
A) B)
C) D)
Figure S2. Molecular function analysis by gene ontology.

(A-C) Molecular function analysis of the genes induced by 25(OH)D3 (2) (A), 38d (B), or 6 (C).
(D) Molecular function analysis of the 209 candidate genes. The candidate genes showed over 2-
fold changes in their expression levels in both of the samples treated with 25(OH)D3 (compound
2) or compound 38d, and 0.5-1.5 fold changes in the samples with compound 6 (listed in a
supplementary Excel file).
S41
Figure S3. Confirmation of the lipid metabolism-related genes by qPCR analysis.
CHO-K1 cells were incubated in medium B containing each compound for 24 h. The mRNA
levels of Acsl5 (A), Abca1 (B), Acot1 (C), Pla2g12a (D) and Dgat2 (E) were evaluated by qPCR
analysis. Data were analyzed by the -Ct method with -actin as a reference control.
S42
Reference
1. Akagi, Y.; Usuda, K.; Tanami, T.; Yasui, K.; Asano, L.; Uesugi, M.; Nagasawa, K., Asian J.
Org. Chem. 2016, 5, 1247-1252.
2. (a) Glebocka, A.; Sicinski, R. R.; Plum, L. A.; Clagett-Dame, M.; DeLuca, H. F. J. Med.
Chem. 2006, 49, 2909-2920; (b) Yoshida, A.; Ono, K.; Suhara, Y.; Saito, N.; Takayama, H.;
Kittaka, A. Synlett 2003, 8, 1175-1179.
3. Watanabe, M.; Asano, R.; Nagasawa, K.; Uesugi, M., PCT Int. Appl. 2016, WO 2016103722
A1 20160630.
4. Kawagoe, F.; Sugiyama, T.; Uesugi, M.; Kittaka, A., J. Steroid. Biochem. Mol. Biol. 2018,
177, 250-254.
5. Sakai, J.; Duncan, E. A.; Rawson, R. B.; Hua, X.; Brown, M. S.; Goldstein, J. L., Cell 1996,
85 (7), 1037-46.
S43
3. 1H and 13C NMR spectra for compounds 11-38f, S3-S13b
Compound 11
11
CDCl3, 300 MHz
11
CDCl3, 100 MHz
S44
Compound 12
12
CDCl3, 300 MHz
12
CDCl3, 125 MHz
S45
Compound 13
13
CDCl3, 300 MHz
13
CDCl3, 125 MHz
S46
Compound 14
14
CDCl3, 300 MHz
14
CDCl3, 125 MHz
S47
Compound 15
15
CDCl3, 300 MHz
15
CDCl3, 125 MHz
S48
Compound 16
16
CDCl3, 300 MHz
16
CDCl3, 100 MHz
S49
Compound 17
17
CDCl3, 300 MHz
17
CDCl3, 100 MHz
S50
Compound 18
18
CDCl3, 300 MHz
18
CDCl3, 100 MHz
S51
Compound 19.
19
CDCl3, 300 MHz
19
CDCl3, 100 MHz
S52
Compound 20.
20
CDCl3, 300 MHz
20
CDCl3, 125 MHz
S53
Compound 21
21
CDCl3, 300 MHz
21
CDCl3, 100 MHz
S54
Compound 22
22
CDCl3, 300 MHz
22
CDCl3, 100 MHz
S55
Compound 23
23
CDCl3, 300 MHz
23
CDCl3, 100 MHz
S56
Compound 24
24
CDCl3, 300 MHz
24
CDCl3, 100 MHz
S57
Compound 25
25
CDCl3, 400 MHz
25
CDCl3, 125 MHz
S58
Compound 26
26
CDCl3, 300 MHz
26
CDCl3, 75 MHz
S59
Compound 27
27
CDCl3, 300 MHz
27
CDCl3, 100 MHz
S60
Compound 28
28
CDCl3, 300 MHz
28
CDCl3, 125 MHz
S61
Compound 29
29
CDCl3, 300 MHz
29
CDCl3, 125 MHz
S62
Compound 30
30
CDCl3, 300 MHz
30
CDCl3, 125 MHz
S63
Compound 31
31
CDCl3, 300 MHz
31
CDCl3, 100 MHz
S64
Compound 32a
32a
CDCl3, 300 MHz
32a
CDCl3, 100 MHz
S65
Compound 32b
32b
CDCl3, 300 MHz
32b
CDCl3, 100 MHz
00 MHz
S66
Compound 32c
32c
CDCl3, 300 MHz
32c
CDCl3, 75 MHz
S67
Compound 32d
32d
CDCl3, 300 MHz
32d
CDCl3, 75 MHz
S68
Compound 32e
32e
CDCl3, 300 MHz
32e
CDCl3, 100 MHz
S69
Compound 32f
32f
CDCl3, 300 MHz
32f
CDCl3, 100 MHz
S70
Compound 32g
32g
CDCl3, 300 MHz
32g
CDCl3, 100 MHz
S71
Compound 32h
32h
CDCl3, 300 MHz
32h
CDCl3, 100 MHz
S72
Compound 33
33
CDCl3, 300 MHz
33
CDCl3, 100 MHz
S73
Compound 34
34
CD3OD, 400 MHz
34
CD3OD, 300 MHz
S74
Compound 35
35
CDCl3, 300 MHz
35
CDCl3, 100 MHz
S75
Compound 36
36
CDCl3, 300 MHz
36
CDCl3, 100 MHz
S76
Compound S3
S3
CDCl3, 300 MHz
S3
CDCl3, 75 MHz
S77
Compound S4
S4
CDCl3, 300 MHz
S4
CDCl3, 75 MHz
S78
Compound S6c
S6c
CDCl3, 300 MHz
S6c
CDCl3, 75 MHz
S79
Compound S6d
S6d
CDCl3, 300 MHz
S6d
CDCl3, 300 MHz
S80
Compound S7c
S7c
CDCl3, 300 MHz
S7c
CDCl3, 75 MHz
S81
Compound S7d
S7d
CDCl3, 300 MHz
S7d
CDCl3, 75 MHz
S82
Compound S10c
S10c
CDCl3, 300 MHz
S10c
CDCl3, 100 MHz
S83
Compound S10d
S10d
CDCl3, 300 MHz
S10d
CDCl3, 100 MHz
S84
Compound 37c
37c
CDCl3, 300 MHz
37c
CDCl3, 100 MHz
S85
Compound 37d
37d
CDCl3, 300 MHz
37d
CDCl3, 100 MHz
S86
Compound 37e
37e
CDCl3, 100 MHz
37e
CDCl3, 100 MHz
S87
Compound 37f
37f
CDCl3, 300 MHz
37f
CDCl3, 300 MHz
Compound 38c
S88
38c
CDCl3, 300 MHz
38c
CDCl3, 100 MHz
Compound 38d
S89
38d
CDCl3, 400 MHz
38d
CDCl3, 100 MHz
Compound 38e
S90
38e
CDCl3, 300 MHz
38e
CDCl3, 100 MHz
S91
Compound 38f
38f
CDCl3, 300 MHz
38f
CDCl3, 100 MHz
S92

Synthetic Chemical Probes That Dissect Vitamin D Activities

Diunggah oleh

Informasi Dokumen

Hak Cipta

Format Tersedia

Bagikan dokumen Ini

Bagikan atau Tanam Dokumen

Opsi Berbagi

Apakah menurut Anda dokumen ini bermanfaat?

Apakah konten ini tidak pantas?

Hak Cipta:

Format Tersedia

Synthetic Chemical Probes That Dissect Vitamin D Activities

Diunggah oleh

Hak Cipta:

Format Tersedia

Supporting Information for

Synthetic Chemical Probes That Dissect Vitamin D Activities

1. Experimental procedures for synthesis and characterization of compounds

Compounds 11, 17, and 19-30

32b was synthesized by the same procedure described as 32a.

32d was synthesized by the same procedure described as 32a.

37d was synthesized by the same procedure described as 37c.

Compound S13a and S13b

Luciferase Reporter Assay

Western Blot Analysis

RNA Sequencing (RNA-seq)

Gene Ontology (GO) Analysis

Real-time Quantitative PCR (qPCR)

Table S1. qPCR primer sequences

Table S2. siRNA sequence

Figure S1. Cellular Component analysis by gene ontology.

Figure S2. Molecular function analysis by gene ontology.

Anda mungkin juga menyukai