Anda di halaman 1dari 15

Diterbitkan dalam bentuk diedit akhir sebagai:

Luka Perbaikan Regen. 2012 Januari; 20 (1): 38-49. doi: 10,1111 / j.1524-475X.2011.00748.x.

TNFα merupakan target terapi untuk gangguan penyembuhan


luka kulit

Gillian S. Ashcroft, MD 1,2, Moon-Jin Jeong, Ph.D. 4, Jason J. Ashworth, Ph.D. 2,


Matthew Hardman, Ph.D. 2, Wenwen Jin, MA 1, Niki Moutsopoulos, DDS, Ph.D. 1,
Teresa liar, MA1, Nancy McCartney-Francis, Ph.D.1, Davis Sim, MD1, George
McGrady, BS 1, Xiao-yu Song, Ph.D. 3, dan Sharon M. Wahl, Ph.D. 1
1
Oral Infection and Immunity Branch, National Institute of Dental & Craniofacial Research,
National Institutes of Health, Bethesda, MD
2
Faculty of Life Sciences, Universitas Manchester, Manchester, UK
3
Centocor, 200 Great Valley Parkway, Malvern, PA

Abstrak
Gangguan penyembuhan luka menyebabkan morbiditas yang cukup besar dan biaya
pengobatan saja mengakibatkan pengeluaran miliaran dolar per tahun di Amerika Serikat.
Baik luka kronis dan luka akut punya karakteristik gangguan yang ditandai dengan
peradangan yang berlebihan, meningkatkan proteolisis, dan deposisi matriks berkurang.
Faktor-faktor perancu ini diperburuk pada orang tua, sebagian, seperti yang kami laporkan di
sini, berkaitan dengan peningkatan tingkat sistemik dan tumor necrosis factor alpha local
(TNFα). Selain itu, kami telah menggunakan sekretorik leukosit protease inhibitor (SLPI)
model null tikus gangguan parah penyembuhan luka dan peradangan yang berlebihan,
sebanding dengan penyembuhan manusia tertunda yang berkaitan dengan usia, untuk
menunjukkan bahwa aplikasi topikal anti-TNFα antibodi penetral blunts leukosit perekrutan
dan NF aktivasi, mengubah keseimbangan antara M1 dan M2 makrofag, dan mempercepat
penyembuhan luka. Berikut antagonisme dari TNF, sintesis matriks ditingkatkan, terkait
dengan penekanan dari kedua parameter inflamasi dan NF mengikat aktivitas. Data kami
menunjukkan bahwa menghambat TNF adalah peristiwa penting dalam membalikkan respon
penyembuhan gangguan parah terkait dengan tidak adanya SLPI, dan mungkin berlaku untuk
profilaksis dan / atau pengobatan luka terganggu negara penyembuhan pada manusia

Kata kunci
penyembuhan luka; peradangan; SLPI; TNFα; makrofag

PENGANTAR
Penyembuhan luka kulit merupakan proses yang kompleks meliputi beberapa peristiwa yang
tumpang tindih setelah cedera, termasuk koagulasi, perekrutan leukosit, deposisi matriks,
epitelisasi, dan resolusi peradangan dengan pembentukan bekas luka matang. Namun,
kaskade peristiwa ini mungkin menjadi terganggu, menyebabkan penyembuhan tertunda luka
akut atau kronis pengembangan nonhealing luka / borok. Baik yang akut dan kronis dan
secara perlahan-penyembuhan luka pada orang tua yang ditandai dengan leukositosis ber
lebihan, sitokin augmented dan kemokin, dan kemudian, degradasi matriks konstituen (1)
ditingkatkan. Berlimpah berimplikasi bukti peradangan sebagai faktor penyebab dalam
penyembuhan tertunda, dan menunjukkan bahwa, dengan tidak adanya infeksi, respon
inflamasi mungkin tidak tepat berlebihan. Tidak hanya gagal penyembuhan memiliki dampak
lokal yang mendalam, tetapi peradangan keras telah dikaitkan dengan beberapa gangguan
lokal dan sistemik, dari aterosklerosis kanker (2). Dalam kondisi tertentu patofisiologi
inflamasi yang dimediasi, dicontohkan oleh arthritis kronis, TNFα diakui sebagai faktor
kontribusi penting (3-5) Gangguan penyembuhan di model hewan dan penyembuhan yang
tertunda terkait usia menunjukkan peningkatan luka akut manusia tingkat lokal (6) dan
sistemik TNFα yang dapat paralel dengan fenotip proinflamasi (6,7).Meskipun penelitian
sebelumnya menunjukkan bahwa ulkus vena cairan TNFα dapat mengganggu fungsi
fibroblast , dan bahwa peningkatan sel mast TNFα berhubungan dengan ulkus vena (8, 9), ada
kelangkaan literatur mengatasi kemungkinan kontribusi dari TNFα ke negara luka kronis pada
manusia. Sementara bermanfaat dalam pertahanan tuan rumah patogen, lebih, TNFα dikaitkan
dengan efek merusak host.

Kami baru-baru menjelaskan model hewan penyembuhan tertunda, menyerupai


penyembuhan luka kronis pada manusia lanjut usia, yang memiliki kesamaan infiltrasi
leukosit augmented dan aktivitas protease selama tahap-tahap awal cedera dan kerusakan
jaringan (10-12). Patologi ini hasil dari tidak adanya anti-inflamasi dan anti-proteolitik agen
sekretorik leukosit protease inhibitor (SLPI) di mouse SLPI null. SLPI adalah inhibitor
protein 12kDa protease serin (13,14) dan juga telah terbukti memiliki beberapa fungsi yang
relevan dengan pertahanan tuan rumah bawaan, termasuk anti-mikroba dan aktivitas anti-
inflamasi (3, 15-17). Peran lebih lanjut untuk SLPI disarankan oleh penghambatan produksi
makrofag TNF (18) dan induksi ekspresi SLPI oleh TNF dirinya dalam sel epitel (19).
Menariknya, aktivasi NF in vitro dan in vivo dihambat oleh SLPI (10, 20), menunjukkan
umpan balik dan melibatkan para TNFα jalur pro-inflamasi sebagai target potensial kritis
tindakan anti-inflamasi SLPI. Meskipun demikian, bukti juga mendukung peran untuk TNF
dalam mempromosikan penyembuhan, sebagian melalui mengemudi tulang morfogenetik
protein (BMP) -2 dan parsial epitel-mesenchymal transisi yang mendasari motilitas epitel
(21). Dengan demikian, masih belum jelas apakah TNF merupakan mediator yang diperlukan
atau pencela untuk memperbaiki jaringan yang optimal.

Dalam penelitian ini kami melaporkan bahwa tingkat TNF, baik secara sistemik dan dalam
luka akut, meningkat secara signifikan pada manusia cenderung untuk penyembuhan
gangguan, dan bahwa peningkatan kadar jaringan lokal menurun secara paralel dengan
penyembuhan. Selanjutnya, dengan menggunakan model nol SLPI, kami menunjukkan
bahwa penghambatan TNF lokal membalikkan fenotip penyembuhan gangguan, jika tidak
ditandai dengan populasi berkelanjutan makrofag M1 klasik-diaktifkan. Selain itu, TNFα
blokade Meningkatkan kolagen deposisi bahkan dalam jenis tikus liar, menunjukkan bahwa
tingkat jaringan sitokin ini, dengan tidak adanya infeksi, mungkin menghambat
penyembuhan luka. TNFα penghambatan oleh antibodi atau SLPI eksogen juga berhubungan
dengan penurunan aktivitas NF, konsisten dengan interkoneksi antara faktor transkripsi ini
dan tanggapan TNFα- dimediasi.

MATERIAL DAN METODE

Jaringan manusia dan serum


Untuk penyembuhan luka studi akut, biopsi 4mm pukulan di lengan atas bagian dalam dari
perempuan pasca menopause (dengan ulserasi vena dan sehat usia yang sama) dilakukan di
bawah anestesi dan luka daerah lokal dipotong pada hari ke 7 pasca melukai (1). persetujuan
Komite Etik Penelitian lokal (Central Manchester LREC01 / 218; Proyek 02.018,
Universitas Manchester) diperoleh dan peserta memberikan persetujuan tertulis. Subyek
mengambil HRT atau obat-obatan immunoregulatory dikeluarkan. ulkus vena kronis dari
lansia (50-90yrs) laki-laki dan perempuan yang dibiopsi pada presentasi menggunakan
pukulan 4mm di tepi luka. Biopsi di tepi ulkus penyembuhan terkemuka diambil 1 bulan
setelah pengobatan standar dengan 4-layer pembalut (1). Tissue diproses di 10% formalin
dan parafin-embedded untuk histopatologi.
Serum diperoleh dari darah subyek kontrol dengan varises (VV) tetapi tidak ada riwayat
ulserasi (yaitu, yang mendasari patologi tanpa penyembuhan gangguan) (n = 38 laki-laki, 43
perempuan) dan dari subyek dengan riwayat ulserasi vena kronis (CU ) (n = 17 laki-laki, 25
perempuan) dan disimpan pada -80 ° C. Selain itu, sampel serum juga dikumpulkan dari
individu yang ulkus vena telah sembuh (n = 6 laki-laki, 9 perempuan). Tingkat serum TNF
ditentukan dengan ELISA (R & D Systems, Minneapolis, MN).

Penyembuhan luka murine

SLPI tikus kekurangan (SLPI - / -) yang dihasilkan dan dipelihara dalam kondisi bebas
patogen tertentu (10). Delapan sampai sepuluh minggu mencit jantan berusia dibius, dorsum
dicukur, dibersihkan dengan alkohol, dan 4 sama jauh 1 cm dengan ketebalan penuh luka
insisi dibuat melalui kulit dan panniculus carnosus otot dan dibiarkan sembuh dengan niat
sekunder (10). Luka yang dipanen pada hari ditunjukkan dan membelah untuk histologi,
jepret-beku dalam nitrogen cair untuk RNA ekstraksi analisis / protein, atau ditempatkan
dalam ex-vivo Media (BioWhittaker, Walkersville, MD) dengan 1% Fungizone (CAMBREX
Biosciences, Walkersville, MD) dan PenStrep 50U / ml (Gibco, Gaithersburg, MD). Untuk
subset dari hewan, segera sebelum melukai (hari 0), area yang akan menorehkan disuntik
subkutan dengan 100μl dari 1-10μg tikus anti-tikus TNF (Centocor, Malvern, PA), PBS, atau
termanipulasi. Perlakuan diputar untuk memastikan tidak ada situs Bias.
Histologi, immunocytochemistry dan analisis citra

Bagian histologis diwarnai dengan H & E, Masson Trichrome, Picrosirius Merah, atau
mengalami imunohistokimia.Jaringan diwarnai dengan antibodi kelinci untuk TNF (anti-
TNFα; Abcam ab6671, 1: 500), anti-iNOS (Millipore 06-573, 1: 100), anti arginase (Santa
Cruz Biotechnology sc-20150, 1: 100) , mac2 (1: 100, hadiah murah hati Dr. S. Vogel, Univ
MD) dan anti-phosphoNFκBp65 (Sel Signaling, Ser276, # 3037, 01:50). antibodi primer
dideteksi menggunakan antibodi sekunder FITC-label (DAKO) atau menggunakan
VECTOR peroksidase kit (VECTOR, Burlingame, CA). H & E bernoda lintas-bagian yang
diukur untuk lebar celah epitel dan untuk daerah luka, yang didefinisikan oleh daerah
inflamasi di bawah gumpalan / bekas luka, di atas otot panniculus dan lapisan lemak, dan
diapit oleh tepi luka, seperti dijelaskan menggunakan Program Optimas (1, 10, 12). Untuk
jumlah sel inflamasi, bagian diwarnai dengan Giemsa dan enam daerah (20X) ditangkap per
luka oleh kamera Nikon DXM1200 (10). Untuk imunohistokimia, gambar yang ditangkap
menggunakan AperioT3 Scanscope (Aperio Technologies, Vista, CA).

MMP9 aktivitas assay

Dalam 1 jam dari eksisi, jaringan luka yang dibagi menjadi 6-8 potong dan dibagi antara
dua sumur yang mengandung 200μl media dan dikultur pada 37 ° C selama 3 hari. Setiap
hari 100μl medium terkondisi (CM) telah dihapus, dibekukan pada -80 ° C dan 100μl media
segar menambahkan. Kegiatan MMP9 ditentukan di CM dengan ELISA (Amersham MMP9
Biotrak Kegiatan, GE Healthcare, Piscataway, NJ).

Gel Shift dan Western blot

Ekstrak protein nuklir dibuat seperti yang dijelaskan (3). Akhir-berlabel oligonukleotida
probe (0.5ng; 0,5-10 5 jumlah / min) diinkubasi 10 menit pada suhu kamar dalam mengikat
penyangga reaksi (20mm HEPES, pH7.9; 60mm NaCl; 5mm MgCl2, 1mM DTT; 0.5mm
PMSF; 17% gliserol) yang mengandung 1μg poli (dI-dC) dan nuklir 5μg ekstrak. kompleks
DNA-protein dipisahkan dengan elektroforesis (6% poliakrilamida gel) di 0.25XTris borate-
EDTA untuk phosphorimaging. Untuk IκBα, jumlah yang sama dari protein dipisahkan oleh
SDS- HALAMAN di 10% gel akrilamida, ditransfer ke membran nitroselulosa (Schleicher &
Schuell) dan bercak diinkubasi dengan antibodi di TBS + 0,05% Tween-20 (TBST). Setelah
poliklonal anti-IκBα (1: 1000), bercak diinkubasi 2 jam dengan lobak peroxidase-
terkonjugasi kambing anti-rabbit antibodi (Santa Cruz, 1: 2000). Protein divisualisasikan
dengan Sistem ECL Amersham dan intensitas pita dihitung dengan Scion Image (Program
NIHimage).
Budaya makrofag murine

Makrofag yang ditimbulkan oleh injeksi intraperitoneal 4% thioglycollate atau Biogel. Pada
4-5days pasca-injeksi, sel dipanen oleh lavage peritoneal, disaring melalui 70-pM nilon mesh,
dicuci, dan diresuspensi dalam DMEM bebas serum yang mengandung gentamisin (10μg /ml)
dan glutamine (2mm). Sel ditambahkan ke piring 6-baik (4-5 × 10 6 / ml / baik) dan setelah 2
jam, media telah dilengkapi dengan 5% panas dilemahkan-FCS dan budaya diinkubasi
semalam sebelum menghilangkan sel-sel nonadherent. Sel diinkubasi 1 jam dengan atau tanpa
SLPI rekombinan (10μg / ml, R & D Systems), diikuti oleh LPS (30ng / ml) dan / atau IFNγ
(100units / ml, Peprotech), TNF (50ng / ml) atau IL-4 (100ng / ml, R & D Systems) selama
30 menit untuk protein atau 2 jam untuk RNA. Semua pekerjaan hewan dilakukan sesuai
dengan protokol yang disetujui oleh National Institute of Gigi dan Craniofacial Penelitian
Perawatan Hewan dan Komite Penggunaan (Studi Animal Proposal Nomor: 10-552).

RT-PCR

RNA total diisolasi dari makrofag dengan RNeasy dan jaringan dengan Trizol (Invitrogen).
Untuk konvensional RT-PCR, cDNA (2μl) diamplifikasi dan urutan untuk pasangan primer
(5'-3') adalah: GAPDH maju, TGCACCACCAACTGCTTAG, sebaliknya,
GATGCAGGGATGATGTTC; TNF maju, AAAGATGGGGGGCTTCCAGAACTC,
reverse AAGATGATCTGAGTGTGAGGGTCTG. produk diperkuat dianalisis dengan
etidium bromida pewarnaan setelah agarose (1,8%) elektroforesis gel dan band kuantitatif
menilai menggunakan sistem digital imaging (Alpha Innotech). Untuk real time PCR, cDNA
diamplifikasi (ABI7500 urut Detector, Applied Biosystems) menggunakan TaqMan ekspresi
tes untuk TNF (Mm00443258_m1), ADAM17 (Mm00456428_m1), MMP2
(Mm00439506_m1), MMP9 (Mm00600163_m1), COL1A1 (Mm00801666_g1), iNOS
(Mm00440485_m1) , arginase (Mm00475988_m1), dan HPRT (Mm00446968_m1). Hasil
dinyatakan sebagai peningkatan fold- oleh 2- ΔΔCT metode.

Analisis statistik
Perbedaan statistik yang ditentukan dengan menggunakan t-test, uji Wilcoxon-Mann-
Whitney U atau ANOVA.Nilai p dari <0,05 dianggap signifikan.
HASIL
Peningkatan TNFα pada subyek manusia cenderung untuk kondisi luka kronis

Dalam rangka untuk memohon peran potensial untuk TNFα di gangguan respons
penyembuhan manusia, kita dipantau tingkat TNF baik secara sistemik dan pada tingkat
jaringan di biopsi akut dan luka kronis pada subyek manusia berusia. Pertama, serum kadar
TNF meningkat secara signifikan di subyek berusia dengan ulserasi vena kronis aktif
dibandingkan dengan populasi kontrol dengan mendasari patologi, tetapi tidak ada ulkus
(hipertensi vena / varises) (Gambar 1A;. p <0,0001), independen gender. Demikian pula,
tingkat serum TNF secara signifikan (p <0,05) lebih tinggi pada subyek dengan ulkus vena
aktif (61,9 pg / ml pada laki-laki, 60,7 pg / ml pada wanita) dibandingkan dengan mereka
dengan ulkus sembuh (48,0 pg / ml pada laki-laki, 45,1 pg / ml pada wanita). Cukup
menarik Namun, subyek dengan ulkus sembuh menunjukkan secara signifikan
meningkatkan kadar TNF sistemik relatif terhadap tingkat diukur pada populasi kontrol
(Gambar 1A, 32,4 pg / ml pada laki-laki, 30,1 pg / ml pada wanita;. P <0,05). Hasil ini
menunjukkan bahwa yang meningkat serum TNF bukan hanya refleksi dari spillover oleh
luka non-penyembuhan lokal, melainkan perbedaan fenotipik yang masuk akal antara
subjek. Berdasarkan peningkatan deteksi serum TNF dalam mata pelajaran yang ditandai
dengan luka non-penyembuhan, kita selanjutnya memeriksa jaringan mereka ulserasi untuk
TNF. luka kronis pada presentasi menunjukkan ditandai TNF pewarnaan (Gambar. 1B,
perwakilan pasien, n = 4). Namun, tingkat jaringan terdeteksi TNFα menurun secara
substansial sebagai menurun infiltrat, resolusi dan penyembuhan ulkus kronis berkembang
(Gambar 1C;. 30days pasca pengobatan). Meskipun wanita cenderung memiliki borok yang
lebih besar (> 10cc), tidak ada perbedaan yang signifikan dalam durasi baik varises atau
borok atau bias gender yang jelas dibandingkan dengan serum atau jaringan tingkat TNF
(Gambar. 1D-F). Dalam studi korelatif tambahan, luka akut diinduksi di situs distal (lengan
atas bagian dalam) dalam mata pelajaran (n = 4) dengan, atau yang sebelumnya memiliki,
ulserasi kronis, dan individu-individu dipamerkan mengangkat tingkat lokal protein TNF,
bahkan pada hari 7 setelah melukai, dibandingkan dengan kontrol usia yang sama tanpa
gangguan inflamasi kronis didiagnosis yang ditampilkan mengurangi jumlah sel inflamasi
dan TNF pada yang sama interval waktu ini (Gambar. 1G, H).

Ditingkatkan TNFα di nol luka SLPI

Berikut ketebalan penuh punggung insisi melukai tikus kekurangan SLPI dan jenis Wild- (WT)
littermates, tingkat gangguan penyembuhan itu tampak jelas di SLPI nol hewan, seperti dilansir
(10-12). Sejak SLPI dilaporkan menghambat ekspresi TNF makrofag in vitro ( 18) dan SLPI-
kekurangan makrofag menghasilkan tingkat lebih tinggi dari TNFα diinduksi dari WT
(Gambar. 2A), kita beralasan bahwa, dengan tidak adanya SLPI, jaringan yang terluka lokal
TNF akan meningkat. Dengan konvensional RT-PCR, ekspresi TNF meningkat pada yang
tidak diobati atau PBS- dirawat luka di nol tikus untuk sebagian besar dari WT (Gambar. 2B),
dicerminkan oleh peningkatan deteksi TNFα menggunakan immunostaining (Gbr. 2C, D).
Selain infiltrasi sel inflamasi, TNFα pewarnaan muncul di keratinosit kulit berdekatan dengan
luka (Gambar. 2C, D). Ketika nol tikus diobati secara lokal dengan eksogen SLPI (10), tingkat
ditambah dari TNFα menurun (Gambar 2B;. P <0,05), bersamaan dengan penyembuhan
dipercepat. Sebagai perbandingan, eksogen SLPI tidak muncul untuk tingkat TNF alter secara
signifikan dalam luka SLPI-penuh. Tidak hanya ekspresi SLPI menghambat makrofag TNF
(Gambar. 3A, p <0,05), tetapi target protease utama SLPI adalah elastase dan dalam
lingkungan SLPI-kekurangan, aktivitas elastase over-berlimpah cenderung menyediakan
mekanisme untuk augmented aktivasi TNF (22). Selain itu, peningkatan TNF menginduksi
tidak hanya lebih TNF (Gambar 3B;. P <0,05), namun dalam konser, pemicu peningkatan TNF
converting enzyme (TACE) / ADAM17 (Gambar 3C, p <0,05.), Mampu membelah larut aktif
17kDa TNFα dari prekursor membran-terkait 26kDa (23), menetapkan dalam gerak siklus
terus-menerus dari diperburuk aktivasi sel inflamasi dan gejala sisa.

Netralisasi TNFα mempercepat penyembuhan gangguan

Kami selanjutnya meneliti apakah langsung antagonis TNF bisa mengubah tanggapan
penyembuhan menyimpang karakteristik dari lingkungan SLPI-kekurangan. Netralisasi
TNFα di situs insisi mempercepat laju penyembuhan secara makroskopis (Gambar. 3D, E)
dan dalam cara yang tergantung dosis sebagai divisualisasikan mikroskopis di SLPI nol
hewan di hari 3 pasca-melukai (Gambar. 3F-

H). Kuantifikasi luka mengungkapkan bahwa antibodi TNF secara signifikan mengurangi
daerah luka di SLPI nol hewan (Gambar. 3F, p = 0,05, hari 3). Sedangkan satu aplikasi dari
10μg / ml anti-TNF diberikan pada saat melukai tingkat dipercepat secara signifikan
penyembuhan di nol tikus, itu juga memfasilitasi penyembuhan di wildtype, meskipun tidak
signifikan, dan 1μg / ml tidak cukup pada luka baik (Gbr. 3F- H).

Menyimpang MMP dan matriks pada luka nol

Dalam menganalisis bagian luka Masson Trichrome-bernoda, kami mencatat kolagen lebih
berlimpah pada luka nol anti-TNF-diperlakukan relatif terhadap perbaikan tertunda di
termanipulasi atau PBS-diperlakukan luka (Gambar. 3G, H, biru noda = kolagen),
menunjukkan TNFα- efek tergantung pada akumulasi ECM. Momok mengangkat TNFα,
peradangan, dan proteolisis yang berlebihan dapat didamaikan tidak hanya oleh mapan efek
pro-inflamasi TNF, namun, di samping itu, dengan bukti aktivasi MMP9 (24) terlihat di situs
luka PBS-diperlakukan 1 -3 hari setelah insisi (Gambar. 4A). Oleh karena itu kami beralasan
bahwa MMP9 disregulasi harus berkontribusi untuk penyembuhan luka disfungsional dalam
ketiadaan SLPI, dan akan menanggapi pengobatan dengan menetralkan TNF antibodi.
Sedangkan luka nol supernatan jaringan-budaya menunjukkan aktivitas MMP9 ditingkatkan
dibandingkan dengan kulit tidak terluka (Gambar. 4A), paralel spesimen berbudaya dari luka
diobati dengan anti-TNF telah nyata mengurangi tingkat aktivitas MMP9. Data ini
menekankan bahwa aktivitas MMP9 ditingkatkan, dan protease kemungkinan lain yang terkait
dengan penyembuhan tertunda di nol tikus, terjadi sebagai konsekuensi dari kurangnya SLPI
dan / atau kelebihan TNF. Dalam hal ini, TNF langsung meregulasi MMP9, serta MMP2
(Gambar. 4B inset), dan rangsangan makrofag lainnya terkait dengan aktivasi klasik atau
fenotipe M1 juga menginduksi ekspresi MMP. Dalam makrofag SLPI-habis, aktivasi M1
melalui IFN dan LPS mengakibatkan MMP secara signifikan lebih tinggi, seperti yang
ditunjukkan untuk MMP2 (Gambar 4B;. P <0,01), sedangkan alternatif diaktifkan / makrofag
M2, yaitu, IL-4-dirangsang, tidak signifikan MMPs upregulate (Gambar. 4B). Data ini
menggarisbawahi peran yang TNF, bersama dengan makrofag M1, supercharged dengan tidak
adanya SLPI, mungkin bermain di resolusi gagal peradangan. Sejak ekspresi tinggi aktivitas
MMP pada jaringan yang terluka dapat dibasahi dengan mengganggu satu gigi, khususnya
sitokin TNF (Gambar. 4A), tampaknya ada umpan balik yang melibatkan SLPI dan TNF yang
mempengaruhi peradangan lokal dan kerusakan jaringan. Sejalan dengan itu, pengobatan
dengan anti-TNF mengakibatkan tidak hanya dalam peradangan lembab, tetapi juga dalam
akumulasi matriks ditingkatkan. Kolagen deposisi sebagai dideteksi dengan Picrosirius Red
meningkat pada luka anti-TNF-diobati, tidak hanya di SLPI nol (Gambar. 4E, F), tetapi juga di
WT (Gambar. 4C, D). Diperparah dengan kerusakan jaringan ditingkatkan melalui protease
inflamasi, termasuk MMP, mengurangi produksi kolagen, seperti dipantau oleh COL1A1
RNA setelah cedera (Gambar. 4G), memberikan kontribusi untuk fenotipe nonhealing. Jadi,
deposisi ECM meningkat setelah penanganan TNFα antagonis untuk menekan protease
pembawa TNFα dan regulasi sintesis komponen struktur ECM (25)

Blokade TNFα memodulasi peradangan lokal

Tidak hanya luka makroskopik dan mikroskopik diperbesar di SLPI nol tikus, namun
peningkatan substansial dalam sel per satuan luas dibandingkan dengan WT mencerminkan
akumulasi berkepanjangan neutrofil dan makrofag, seperti dilaporkan sebelumnya (10-12)
(Gambar. 5A). Dalam hal ini, TNF antagonisme secara signifikan menurun infiltrat sel
inflamasi pada luka SLPI nol (Gambar. 5A) serta lebih sedikit, tetapi tidak signifikan, pada
luka WT. Karena TNFα dan MMP9 meningkat pada respon patologis di SLPI nol tikus dan
karena kedua

terkait dengan populasi makrofag M1, kami dievaluasi terluka jaringan untuk sebuah
representasi proporsional potensi makrofag M1 proinflamasi dibandingkan dengan populasi
M2, yang putatively mendukung resolusi dan penyembuhan luka (26). Dengan tidak adanya
SLPI, bukti adalah indikasi dari infiltrasi dominan M1-seperti makrofag, dalam deteksi M1
prototypic molekul iNOS oleh RT-PCR lebih tinggi pada luka null, terutama pada hari 3
pasca-melukai, tapi bertahan di ditinggikan tingkat (Gambar. 5B). Ketika diinterogasi lebih
lanjut oleh imunohistokimia, iNOS + makrofag yang diucapkan sebagai ditentukan oleh
mac2 + pewarnaan di iNOS + daerah, tapi iNOS pewarnaan juga terlihat di sel epitel dan
endotel (Gbr. 5B, C). Sebagai perbandingan, arginase, E). Meskipun neutrofil berlimpah awal
setelah melukai, ekspresi arginase mungkin mencerminkan infiltrasi makrofag, neutrofil sejak
murine kekurangan protein arginase (26). Berikut anti-TNF, jumlah sel inflamasi menurun
(Gambar. 5A), termasuk arginase + sel (Gambar. 5D) dan ukuran luka berkurang (Gambar.
3F, 5B inset). Untuk mengeksplorasi hubungan ini lebih lanjut, kami memeriksa apakah SLPI
berbeda-beda dipengaruhi M1 / M2 polarisasi in vitro.
SLPI ditekan aktivasi M1 oleh LPS / IFNγ dipantau oleh iNOS ekspresi (Gambar. 5F, p =
0,03), sedangkan itu tidak menekan M2 (IL-4) makrofag menggunakan arginase sebagai
output (Gambar. 5G, p = NS). Peraturan SLPI tergantung diferensial ini aktivitas M1
dapat mewakili dasar yang mendasari untuk eksaserbasi peradangan dengan kelimpahan
TNFα dan MMP9, meskipun terjadi peningkatan arginase + sel, yang kabarnya
mendukung perbaikan, meskipun makrofag kemungkinan menerima sinyal campuran
dalam lingkungan luka dan tidak ketat M1 atau M2, namun ciri-ciri beruang dari kedua
(26).

Hal ini juga ditetapkan bahwa aktivasi M1 umumnya didorong oleh NF dan tanpa adanya
SLPI, inhibitor NF (10, 20) yang forestalls degradasi IκB seperti yang ditunjukkan untuk
makrofag pada Gambar. 6A, aktivasi NF ditingkatkan secara total spesimen jaringan luka
sebagai ditentukan oleh EMSA (Gambar. 6B). peraturan ketat dari NF tergantung pada
tingkat inhibitor endogen yang IκB, dan mengikuti IκB fosforilasi dan degradasi,
dibebaskan NF translocates ke inti untuk mendorong gen target. Sejak TNFα mengaktifkan
NF untuk kemokin mempotensiasi, molekul adhesi, MMP, dan mediator pro-inflamasi
termasuk TNF sendiri (3, 15), blokade TNFα pada saat melukai mengurangi aktivitas NF di
nol luka SLPI (Gambar. 6B), konsisten dengan kurang jaringan NF phospho-p65
pewarnaan dan sel-sel inflamasi di WT dibandingkan dengan nol (Gambar. 6C, D).
Akibatnya, proinflamasi ini bergantung TNFα siklik
loop dan pemeliharaan rasio M1 / M2 yang meningkat menghalangi kemampuan tuan
rumah untuk menyelesaikannya
peradangan, mengatur orkestra dan selanjutnya, memberikan bukti untuk tidak dihargai dan
peran SLPI yang berkembang dalam regulasi polarisasi makrofag.

DISKUSI
Kondisi penyembuhan luka usia gangguan menyebabkan peningkatan morbiditas dan
mortalitas, dan masalah cenderung meningkat dengan ekspansi berkelanjutan dari populasi
lanjut usia. Pada pasien usia lanjut dengan ulkus vena, kami menemukan bahwa kedua
tingkat sistemik dan lokal TNFα dibangkitkan relatif terhadap mata pelajaran dengan
mendasari patologi, tapi kurang fenotipe non-penyembuhan. Pada pasien dengan
penyembuhan fenotipe tertunda, luka akut yang baru dimulai pada tempat yang jauh yang
biasanya penuh dengan TNF relatif terhadap mata pelajaran usia-cocok kurang respon
penyembuhan menyimpang. Bahkan luka akut penyembuhan pada subyek lansia yang sehat
ditandai dengan peradangan yang berlebihan dan dibesarkan tingkat TNF lokal
dibandingkan dengan populasi yang lebih muda (27). Data kami melibatkan peningkatan
sistemik dan lokal di TNFα di patogenesis, dan kecenderungan untuk, ulkus vena kronis,
dan peningkatan terkait usia di TNFα sistemik dapat menjadi dasar pemersatu untuk
patogenesis sejumlah proinflamasi menyatakan dalam usia (6, 7).

Pada hewan model penyembuhan gangguan menyerupai fenotipe-terkait usia, mengangkat


tingkat TNF juga karakteristik. muncul ini menjadi relatif spesifik, karena tingkat mRNA
dari modulator kunci lainnya peradangan, seperti MIF dan TGF-β1, tidak secara signifikan
dipengaruhi oleh tingkat yang berlaku dari SLPI (10). SLPI, terdiri dari dua domain yang
kaya sistein dengan protease situs penghambatan terletak di leusin 72 di karboksil domain
terminal (14), dilepaskan oleh sel inflamasi diaktifkan, dan juga oleh keratinosit (10)
sampai sedang peradangan dan mengerahkan sifat antimikroba. Sebuah mekanisme kunci
yang menipisnya SLPI ketapel patogenesis gangguan penyembuhan luka, di luar protease
penghambatan gagal, melibatkan peningkatan yang ditandai dalam respon inflamasi dan up-
regulasi sitokin pro-inflamasi, ditandai oleh TNF. Dalam bukti yang menguatkan data ini,
kami telah menunjukkan bahwa netralisasi TNFα dibasahi peradangan yang berlebihan di
SLPI nol hewan dan secara signifikan mempercepat laju penyembuhan luka. Bila dilihat
dalam konteks luka kronis di mana peradangan, mengangkat tingkat TNF, dan infeksi
bakteri berkontribusi untuk penyembuhan tertunda, antagonis TNF, termasuk SLPI,
merupakan calon potensial untuk mempengaruhi beberapa aspek dari respon penyembuhan.

Dalam WT tikus, awal infiltrasi inflamasi mendahului matriks ekstraselular deposisi,


neovaskularisasi, dan kolagen jaringan parut, sedangkan tikus SLPI-kekurangan
memperlihatkan secara tertunda akumulasi matriks (10). Elastase dan aktivitas MMP9 telah
terlibat sebagai faktor penting dalam sejumlah proses patofisiologi yang melibatkan
peradangan dan kerusakan jaringan / renovasi (5, 28). Gangguan luka akut penyembuhan
pada orang tua juga dikaitkan dengan peningkatan secara signifikan tingkat jaringan MMPs
sel yang diturunkan inflamasi, dan penyembuhan luka negara kronis dihubungkan dengan
luka kadar cairan mengangkat MMP9 dan mengurangi protease inhibitor (5, 29, 30).
Beberapa tingkat regulasi dalam ekspresi dan aktivasi MMPs dikenal yang menyatakan
kontrol ketat selama proses fisiologis normal. Selain penghambatan langsung dari elastase
dan akibatnya, penghambatan elastase- dimediasi aktivasi MMP, SLPI adalah penekan
ampuh monosit MMP9 melalui prostaglandin E2 jalur, menunjukkan bahwa disregulasi
MMP9 mungkin menjadi pertanda penyembuhan gangguan dalam patogenesis terkait usia
dan / atau dengan tidak adanya SLPI (15). Sejak TNFα menginduksi ekspresi MMP9 dalam
berbagai jenis sel, kita beralasan bahwa efek menguntungkan dari memblokir TNFα dalam
model penyembuhan tertunda kami akan disejajarkan dengan MMP9 termodulasi. Data
kami menunjukkan bahwa anti-TNF pengobatan mengurangi MMP9 aktivitas di jaringan
SLPI nol luka, melibatkan MMP9 sebagai komponen integral dari sumbu SLPI / TNF in
vivo. Tingkat kolagen (COL1A1) yang berkurang di nol luka SLPI konsonan dengan
dampak negatif dari TNFα pada ekspresi gen kolagen (25, 31), dan menunda akumulasi
fibroblas matriks menghasilkan karena jumlah yang tidak proporsional dari sel-sel inflamasi
menempati dasar luka. Bersama dengan degradasi MMP-dependent matriks baru, ada
kerugian bersih dari akumulasi ECM di SLPI nol relatif terhadap luka WT. Antagonis
TNFα dikaitkan dengan peningkatan deposisi matriks tidak hanya di SLPI nol hewan tapi
juga di WT, menunjukkan bahwa modulasi tingkat TNFα in vivo dapat mempengaruhi baik
patologis dan 'fisiologis' penyembuhan luka tanggapan.

Keterlibatan TNFR1p55 / TNFR2p75 oleh TNF merekrut protein adaptor untuk memulai
jalur pensinyalan hilir yang berujung pada transkripsi gen inflamasi. TNF mengaktifkan
NF, yang pada gilirannya ekspresi gen menginduksi dari sejumlah sitokin inflamasi pro
termasuk TNF sendiri dan protease, seperti MMP dan juga TACE untuk melepaskan larut
TNF, sehingga potentiating efek sitokin ini inflamasi (32). Kami menunjukkan bahwa
aktivitas NF, meningkat pada jaringan luka di awal nol SLPI dibandingkan dengan WT
tikus, ditekan oleh anti-TNF. Data tersebut menggarisbawahi peran SLPI di modulasi
umpan balik positif yang ada antara TNF dan aktivitas NF. Kedua in vitro dan in vivo
SLPI menghambat produksi TNF, kemungkinan besar melalui blok pada aktivasi NF
melibatkan retensi inhibitor nya, IκB. Sedangkan kedua p50 dan p65 homodimers dan
heterodimers sangat penting untuk aktivasi gen pro-inflamasi oleh TNF pada manusia
monosit, terutama p65 Menagatur ICAM-1 ekspresi oleh sel endotel (33). Dalam hal ini,
menarik untuk dicatat bahwa yang normal / tidak terluka kulit dari SLPI nol tikus
menunjukkan bukti aktivasi konstitutif homodimer p65. Salah satu konsekuensi dari ini
dapat ditingkatkan adhesi molekul ekspresi di SLPI nol tikus, efektif priming kapal untuk
infiltrasi leukosit pada cedera.

Meskipun data terakhir menunjukkan bahwa luka fisiologis makrofag memperlihatkan


fenotipe yang kompleks yang tidak memisahkan ke berbeda populasi M1 dan M2,
melainkan termasuk ciri-ciri reflektif dari kedua populasi dalam tanpa lingkungan M2
polarisasi IL-4 atau IL-13 (26), kami data dalam tidak fisiologis tertunda Model
penyembuhan sarankan kelimpahan makrofag mengekspresikan iNOS, MMP9 dan TNF,
mungkin berhubungan dengan aktivasi NF terbatas, semua yang memperburuk respon
inflamasi terhadap cedera jaringan dan dalam lingkaran setan muncul untuk memberikan
umpan balik menegakkan untuk merekrut dan mengaktifkan tambahan inflamasi makrofag
M1-bias. M2 / makrofag alternatif-diaktifkan mengungkapkan tingkat yang lebih tinggi
dari arginase juga melimpah di dasar luka. Sel-sel ini dianggap penting dalam resolusi
peradangan (34), meskipun bukti baru menunjukkan bahwa populasi ini mungkin, dalam
beberapa keadaan, sebenarnya menghamhat fibrosis (35). Gangguan siklus aktivasi dengan
SLPI eksogen (10) atau antagonis TNF seperti ditunjukkan di sini, memiliki efek
menguntungkan yang memungkinkan resolusi peradangan berlebihan dengan pemulihan
penyembuhan jalur, melibatkan TNFα sebagai pengatur master gangguan penyembuhan
luka in vivo.

Sementara perbandingan antara model murine dan patogenesis manusia yang penuh dengan
perbedaan, data paralel kita tentang peningkatan ekspresi TNF di luka kronis manusia baik
secara lokal dan sistemik menjamin pertimbangan lebih lanjut. Yang penting, kami
menyarankan bahwa efek menguntungkan dari pertentangan TNFα dapat diekstrapolasikan
ke kondisi penyembuhan luka manusia terganggu, apakah dengan menetralisir antibodi,
reseptor larut, protein reseptor fusi secara langsung, atau melalui transfer gen atau strategi
lainnya (4, 5, 25, 36- 38). Meskipun TNFα antagonis belum dieksplorasi secara
menyeluruh pada luka nonhealing kronis, sebagai awal, serangkaian studi kasus
menunjukkan dampak menguntungkan dari antibodi TNFα topikal (39) dan baru-baru ini
mencatat bahwa pasien rheumatoid arthritis yang menerima agen anti-TNF belum pernah
terganggu penyembuhan atau negatif konsekuensi dalam penyembuhan situs pasca operasi
(40). Sangat relevan mungkin kemampuan lokal dan temporal disampaikan antagonis TNF,
tanpa perlu pengobatan sistemik atau profilaksis, untuk meningkatkan negara
penyembuhan menyimpang, yang mungkin membatasi konsekuensi negatif yang tak
diinginkan pengiriman sistemik terapi anti-TNF.

Ucapan Terima Kasih

Para penulis berterima kasih kepada Calley Grace untuk bantuan editorial, Azita Adli,
Nancy Marinos, dan Alec Waite untuk bantuan histologis dan keahlian dengan
immunocytochemistry dan Dr S. Vogel, U MD School of Medicine, Baltimore untuk
Mac2 antibodi. Gillian Ashcroft didanai di bawah Wellcome Fellowship Senior Ilmu
Klinis. Penelitian ini didukung sebagian oleh Program Intramural Penelitian dari NIH,
National Institute of Gigi dan Craniofacial Research.

Referensi
1. Ashcroft GS, Greenwell-Wild T, Horan MA, Wahl SM, Ferguson MW. Topical estrogen
accelerates cutaneous wound healing in aged humans associated with an altered
inflammatory response. Am J Pathol. 1999; 155(4):1137–46. [PubMed: 10514397]
2. Schafer M, Werner S. Cancer as an overhealing wound: an old hypothesis revisited. Nat
Rev Mol Cell Biol. 2008; 9(8):628–38. [PubMed: 18628784]
3. Song X, Zeng L, Jin W, Thompson J, Mizel DE, Lei K, Billinghurst RC, Poole AR, Wahl
SM. Secretory leukocyte protease inhibitor suppresses the inflammation and joint damage of
bacterial cell wall-induced arthritis. J Exp Med. 1999; 190(4):535–42. [PubMed: 10449524]
4. Feldmann M, Williams RO, Paleolog E. What have we learnt from targeted anti-TNF
therapy? Ann Rheum Dis. 2010; 69(Suppl 1):i97–9. [PubMed: 19995756]
5. Chan JM, Villarreal G, Jin WW, Stepan T, Burstein H, Wahl SM. Intraarticular gene
transfer of TNFR:Fc suppresses experimental arthritis with reduced systemic distribution of
the gene product. Mol Ther. 2002; 6(6):727–36. [PubMed: 12498769]
6. Bruunsgaard H, Pedersen BK. Age-related inflammatory cytokines and disease. Immunol
Allergy Clin North Am. 2003; 23(1):15–39. [PubMed: 12645876]
7. Bruunsgaard H. Effects of tumor necrosis factor-alpha and interleukin-6 in elderly
populations. Eur Cytokine Netw. 2002; 13(4):389–91. [PubMed: 12517724]
8. Mendez MV, Raffetto JD, Phillips T, Menzoian JO, Park HY. The proliferative capacity
of neonatal skin fibroblasts is reduced after exposure to venous ulcer wound fluid: A
potential mechanism for senescence in venous ulcers. J Vasc Surg. 1999; 30(4):734–43.
[PubMed: 10514213]
9. Huttunen M, Aalto ML, Harvima RJ, Horsmanheimo M, Harvima IT. Alterations in mast
cells showing tryptase and chymase activity in epithelializating and chronic wounds. Exp
Dermatol.2000; 9(4):258–65. [PubMed: 10949547]
10. Ashcroft GS, Lei K, Jin W, Longenecker G, Kulkarni AB, Greenwell-Wild T, Hale-
Donze H, McGrady G, Song XY, Wahl SM. Secretory leukocyte protease inhibitor mediates
non-redundant functions necessary for normal wound healing. Nat Med. 2000; 6(10):1147–
53. [PubMed:11017147]
11. Angelov N, Moutsopoulos N, Jeong MJ, Nares S, Ashcroft G, Wahl SM. Aberrant
mucosal wound repair in the absence of secretory leukocyte protease inhibitor. Thromb
Haemost. 2004; 92(2):288–97. [PubMed: 15269824]
12. Zhu J, Nathan C, Jin W, Sim D, Ashcroft GS, Wahl SM, Lacomis L, Erdjument-
Bromage H,Tempst P, Wright CD, Ding A. Conversion of proepithelin to epithelins: roles of
SLPI and elastase in host defense and wound repair. Cell. 2002; 111(6):867–78. [PubMed:
12526812]
13. Franzke CW, Baici A, Bartels J, Christophers E, Wiedow O. Antileukoprotease inhibits
stratum corneum chymotryptic enzyme. Evidence for a regulative function in desquamation.
J Biol Chem.1996; 271(36):21886–90. [PubMed: 8702990]
14. Eisenberg SP, Hale KK, Heimdal P, Thompson RC. Location of the protease-inhibitory
region of secretory leukocyte protease inhibitor. J Biol Chem. 1990; 265(14):7976–81.
[PubMed: 2110563]
15. Zhang Y, DeWitt DL, McNeely TB, Wahl SM, Wahl LM. Secretory leukocyte protease
inhibitor suppresses the production of monocyte prostaglandin H synthase-2, prostaglandin
E2, and matrix metalloproteinases. J Clin Invest. 1997; 99(5):894–900. [PubMed: 9062347]
16. McNeely TB, Dealy M, Dripps DJ, Orenstein JM, Eisenberg SP, Wahl SM. Secretory
leukocyte protease inhibitor: a human saliva protein exhibiting anti-human
immunodeficiency virus 1 activity in vitro. J Clin Invest. 1995; 96(1):456–64. [PubMed:
7615818]
17. Ma G, Greenwell-Wild T, Lei K, Jin W, Swisher J, Hardegen N, Wild CT, Wahl SM.
Secretory leukocyte protease inhibitor binds to annexin II, a cofactor for macrophage HIV-1
infection. J Exp Med. 2004; 200(10):1337–46. [PubMed: 15545357]
18. Jin FY, Nathan C, Radzioch D, Ding A. Secretory leukocyte protease inhibitor: a
macrophage product induced by and antagonistic to bacterial lipopolysaccharide. Cell. 1997;
88(3):417–26.[PubMed: 9039268]
19. Devoogdt N, Revets H, Kindt A, Liu YQ, De Baetselier P, Ghassabeh GH. The tumor-
promoting effect of TNF-alpha involves the induction of secretory leukocyte protease
inhibitor. J Immunol.2006; 177(11):8046–52. [PubMed: 17114478]
20. Taggart CC, Cryan SA, Weldon S, Gibbons A, Greene CM, Kelly E, Low TB, O’neill
SJ,McElvaney NG. Secretory leucoprotease inhibitor binds to NF-kappaB binding sites in
monocytes and inhibits p65 binding. J Exp Med. 2005; 202(12):1659–68. [PubMed:
16352738]
21. Yan C, Grimm WA, Garner WL, Qin L, Travis T, Tan N, Han YP. Epithelial to
Mesenchymal Transition in Human Skin Wound Healing Is Induced by Tumor Necrosis
Factor-{alpha} through Bone Morphogenic Protein-2. Am J Pathol. 2010; 176(5):2247–58.
[PubMed: 20304956]
22. Meyer-Hoffert U. Neutrophil-derived serine proteases modulate innate immune
responses. Front Biosci. 2009; 14:3409–18. [PubMed: 19273284]
23. Moss ML, Jin SL, Milla ME, Bickett DM, Burkhart W, Carter HL, Chen WJ, Clay WC,
Didsbury JR, Hassler D, Hoffman CR, Kost TA, Lambert MH, Leesnitzer MA, McCauley P,
McGeehan G, Mitchell J, Moyer M, Pahel G, Rocque W, Overton LK, Schoenen F, Seaton
T, Su JL, Becherer JD, et al. Cloning of a disintegrin metalloproteinase that processes
precursor tumour-necrosis factor-alpha. Nature. 1997; 385(6618):733–6. [PubMed:
9034191]
24. Han YP, Tuan TL, Hughes M, Wu H, Garner WL. Transforming growth factor-beta -
and tumor necrosis factor-alpha -mediated induction and proteolytic activation of MMP-9 in
human skin. J Biol Chem. 2001; 276(25):22341–50. [PubMed: 11297541]
25. Buck M, Houglum K, Chojkier M. Tumor necrosis factor-alpha inhibits collagen
alpha1(I) gene expression and wound healing in a murine model of cachexia. Am J Pathol.
1996; 149(1):195–204. [PubMed: 8686743]
26. Daley JM, Brancato SK, Thomay AA, Reichner JS, Albina JE. The phenotype of murine
wound macrophages. J Leukoc Biol. 2010; 87(1):59–67. [PubMed: 20052800]
27. Ashcroft GS, Mills SJ. Androgen receptor-mediated inhibition of cutaneous wound
healing. J Clin Invest. 2002; 110(5):615–24. [PubMed: 12208862]
28. Price NM, Gilman RH, Uddin J, Recavarren S, Friedland JS. Unopposed matrix
metalloproteinase-9 expression in human tuberculous granuloma and the role of TNF-
alphadependent
monocyte networks. J Immunol. 2003; 171(10):5579–86. [PubMed: 14607966]
29. Wysocki AB, Staiano-Coico L, Grinnell F. Wound fluid from chronic leg ulcers contains
elevated levels of metalloproteinases MMP-2 and MMP-9. J Invest Dermatol. 1993;
101(1):64–8. [PubMed: 8392530]
30. Bullen EC, Longaker MT, Updike DL, Benton R, Ladin D, Hou Z, Howard EW. Tissue
inhibitor of metalloproteinases-1 is decreased and activated gelatinases are increased in
chronic wounds. J Invest Dermatol. 1995; 104(2):236–40. [PubMed: 7829879]
31. Verrecchia F, Mauviel A. TGF-beta and TNF-alpha: antagonistic cytokines controlling
type I collagen gene expression. Cell Signal. 2004; 16(8):873–80. [PubMed: 15157666]
32. Sano C, Shimizu T, Tomioka H. Effects of secretory leukocyte protease inhibitor on the
tumor necrosis factor-alpha production and NF-kappaB activation of lipopolysaccharide-
stimulated macrophages. Cytokine. 2003; 21(1):38–42. [PubMed: 12668158]
33. True AL, Rahman A, Malik AB. Activation of NF-kappaB induced by H(2)O(2) and
TNF-alpha and its effects on ICAM-1 expression in endothelial cells. Am J Physiol Lung
Cell Mol Physiol. 2000; 279(2):L302–11. [PubMed: 10926553]
34. Martinez FO, Helming L, Gordon S. Alternative activation of macrophages: an
immunologic functional perspective. Annu Rev Immunol. 2009; 27:451–83. [PubMed:
19105661]
35. Wynn TA, Barron L. Macrophages: master regulators of inflammation and fibrosis.
Semin Liver Dis. 2010; 30(3):245–57. [PubMed: 20665377]
36. Heinrich SA, Messingham KA, Gregory MS, Colantoni A, Ferreira AM, Dipietro LA,
Kovacs EJ. Elevated monocyte chemoattractant protein-1 levels following thermal injury
precede monocyte recruitment to the wound site and are controlled, in part, by tumor
necrosis factor-alpha. Wound Repair Regen. 2003; 11(2):110–9. [PubMed: 12631298]
37. Maish GO 3rd, Shumate ML, Ehrlich HP, Cooney RN. Tumor necrosis factor binding
protein improves incisional wound healing in sepsis. J Surg Res. 1998; 78(2):108–17.
[PubMed: 9733627]
38. Mori R, Kondo T, Ohshima T, Ishida Y, Mukaida N. Accelerated wound healing in
tumor necrosis factor receptor p55-deficient mice with reduced leukocyte infiltration.
FASEB J. 2002; 16(9):963– 74. [PubMed: 12087057]
39. Streit M, Beleznay Z, Braathen LR. Topical application of the tumour necrosis factor-
alpha antibody infliximab improves healing of chronic wounds. Int Wound J. 2006;
3(3):171–9. [PubMed: 16984574]
40. Hirano Y, Kojima T, Kanayama Y, Shioura T, Hayashi M, Kida D, Kaneko A, Eto Y,
Ishiguro N. Influences of anti-tumour necrosis factor agents on postoperative recovery in
patients with rheumatoid arthritis. Clin Rheumatol. 2010; 29(5):495–500. [PubMed:
20069328]