JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2006, p. 1274–1282 Vol. 44, No.

4
0095-1137/06/$08.00⫹0 doi:10.1128/JCM.44.4.1274–1282.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Identification and Quantification of Archaea Involved in Primary

Endodontic Infections
M. E. Vianna,1,2 G. Conrads,2 B. P. F. A. Gomes,1 and H. P. Horz2*
Endodontic Area, Department of Restorative Dentistry, Piracicaba Dental School, State University of Campinas, Piracicaba SP,
Brazil,1 and Division of Oral Microbiology and Immunology, Department of Operative and Preventive Dentistry and
Periodontology, and Department of Medical Microbiology, RWTH University Hospital Aachen, Aachen, Germany2
Received 28 November 2005/Returned for modification 4 January 2006/Accepted 20 January 2006

Members of the domain Archaea, one of the three domains of life, are a highly diverse group of prokaryotes,
distinct from bacteria and eukaryotes. Despite their abundance and ubiquity on earth, including their close
association with humans, animals, and plants, so far no pathogenic archaea have been described. As some
archaea live in close proximity to anaerobic bacteria, for instance, in the human gut system and in periodontal
pockets, the aim of our study was to assess whether archaea might possibly be involved in human endodontic
infections, which are commonly polymicrobial. We analyzed 20 necrotic uniradicular teeth with radiographic
evidence of apical periodontitis and with no previous endodontic treatment. Using real-time quantitative PCR
based on the functional gene mcrA (encoding the methyl coenzyme M reductase, specific to methanogenic
archaea) and on archaeal 16S rRNA genes, we found five cases to be positive. Direct sequencing of PCR

Downloaded from jcm.asm.org by on January 26, 2008

products from both genes showed that the archaeal community was dominated by a Methanobrevibacter
oralis-like phylotype. The size of the archaeal population at the diseased sites ranged from 1.3 ⴛ 105 to 6.8 ⴛ
105 16S rRNA gene target molecule numbers and accounted for up to 2.5% of the total prokaryotic community
(i.e., bacteria plus archaea). Our findings show that archaea can be intimately connected with infectious
diseases and thus support the hypothesis that members of the domain Archaea may have a role as human
pathogens.

With the advent of molecular phylogenetic studies (e.g.,
comparative analyses of small-subunit 16S and 18S rRNAs), it
has become accepted that all cellular life falls into three pri-
mary domains, i.e., Bacteria, Eucarya, and Archaea (37). Or-
ganisms from the domain Archaea differ fundamentally from
eukarya and bacteria in several genetic, biochemical, and struc-
tural features. As “archaebacteria” they have been classified as
an early-branching evolutionary offshoot of the domain Bacte-
ria and have long been considered to represent a primitive
form of life that thrives only in extreme environments such as
hot springs, salt lakes, or submarine volcanic habitats. How-
ever, recent work has shown that archaea are more physiolog-
ically diverse and ecologically widespread than was previously
supposed (2, 3). Like bacteria, archaea are commonly meso-
philic, and some members are known to be closely associated
with eukaryotic hosts, including humans. For instance, high
numbers of methane-producing archaea (methanogens) have
been found in the gastrointestinal tract (17), vagina (5), and
oral cavity (4). Although they are now recognized as a com-
ponent of human microbiota, it is generally assumed that ar-
chaea are not a cause of human disease. However, considering
the range of known pathogens within the domains Bacteria and
Eukarya, the complete absence of recognized pathogens within
Archaea, whose ubiquity and phylogenetic diversity are com-
parable to those of the other two domains, is striking. Instead,
the assumption that methanogens or other archaea are not
* Corresponding author. Mailing address: Division of Oral Mi-
crobiology and Immunology, University Hospital (RWTH), Pau-
welsstrasse 30, D-52057 Aachen, Germany. Phone: 49-241-8088448.
Fax: 49-241-8082483. E-mail: JHorz@ukaachen.de.
causative agents of disease could be partly the result of the fact
that these microbes are completely ignored in routine labora-
tory diagnostics.
Methanogens are a unique group of strictly anaerobic ar-
chaea which metabolize hydrogen, CO2, or acetate as a sub-
strate with the resultant production of methane. As terminal
oxidizers in complex microbial communities, they are vital to
the anaerobic microbial degradation of organic compounds in
natural environments and probably also in defined ecological
niches of the human body (7). Since methanogens coexist and
closely interact with anaerobic bacteria at certain sites (e.g.,
human colon or dental plaque), they could be implicated in
mixed anaeorobic infections. In fact, methanogens have re-
cently been linked to periodontal disease (18, 20), a polymi-
crobial infection that affects the gums and supporting struc-
tures of the teeth and is characterized by periodontal pockets.
In order to find more evidence for the existence of patho-
genic methanogens, we focused on primary endodontic infec-
tions, which are commonly polymicrobial and lead to inflam-
mation and destruction of periradicular tissues, called apical
periodontitis (16). Unlike periodontal diseases, the apical pe-
riodontitis is caused by infection of a tooth’s root canal, a place
devoid of microbes in a healthy state (27). This means that
endodontic microorganisms must have strategies to gain access
into this sterile place and to evade host defense mechanisms,
both features that are characteristically displayed by pathogens
(21, 28).
For assessing the possible existence of archaea, we selected
clinical samples from endodontic infections that had previously
been screened for the detection of bacteria (35). To accom-
plish this, we used real-time quantitative PCR (RTQ-PCR)

1274
VOL. 44, 2006
TABLE 1. Primer descriptions and thermal profiles for PCR
Primer Sequence (5⬘33⬘) Reference
LuF GGTGGTGTMGGATTCACACART 25
AYGCWACAGC
LuR TTCATTGCRTAGTTWGGRTAGTT
A109F ACKGCTCAGTAACACGT 13
A934R GTGCTCCCCCGCCAATTCCT 32
PF1 AGAGTTTGATCCTGGCTCAG 10
PR1 GGCTACCTTGTTACGACTT 9
EuF TCCTACGGGAGGCAGCAGT 26
EuR GGACTACCAGGGTATCTAATCCTGTT
based on the functional gene mcrA, encoding methyl coenzyme
M reductase, the terminal enzyme complex in the methane
generation pathway. The ubiquity of this gene among methan-
ogens (34) has facilitated the development of mcrA as a mo-
lecular marker, allowing the detection and enumeration of
methanogens without requiring laboratory culture (24, 25). We
also determined the total load of archaea as well as bacteria by
using two different 16S rRNA gene-based RTQ-PCR assays.
Here we report for the first time the detection, identification,
and quantification of a defined phylotype of archaea in in-
fected root canals. This finding may contribute to an emerging
view of archaea as potential human pathogens.
MATERIALS AND METHODS
Microbial strains. The following archaeal type strains used in this study were
obtained from the Deutsche Sammlung von Mikroorganismen und Zellkulturen
(DSMZ), Braunschweig, Germany: Methanococcus maripaludis DSM 2067T,
Methanoplanus endosymbiosus DSM 3599T, Methanospirillum hungatei DSM
864T, Methanobrevibacter oralis DSM 7256T, and Methanobrevibacter smithii
DSM 861T.
Bacterial strains used in this study were obtained from the American Type
Culture Collection (ATCC), Manassas, Va. The majority were type strains, as
indicated: Actinomyces odontolyticus ATCC 17929T, Enterococcus faecalis ATCC
29212, Fusobacterium nucleatum ATCC 25586T, Prevotella nigrescens ATCC
33563T, and Tannerella forsythia ATCC 43037T.
Sample collection. Twenty patients who were at the Piracicaba Dental School
for root canal treatment, who were otherwise healthy, and who had not received
antibiotic treatment during the previous 3 months were selected for this study.
The age of the patients ranged from 19 to 63 years. The selected teeth (one tooth
per patient) were uniradicular, presented necrotic pulp tissues, and showed
radiographic evidence of apical periodontitis but an absence of periodontal
diseases. All teeth were asymptomatic. A detailed medical and dental history was
obtained from each patient. The Human Volunteers Research and Ethics Com-
mittee of the Dental School of Piracicaba approved a protocol describing the
specimen collection for this investigation, and all patients signed an informed
consent form to participate in the study. The teeth were isolated with a rubber
dam. The crown and the surrounding rubber dam were disinfected with 30%
(vol/vol) H2O2 for 30 s followed by 2.5% NaOCl for additional 30 s. Subse-
quently, 5% sodium thiosulfate was used to neutralize the disinfectant agents
ARCHAEA IN ENDODONTIC INFECTIONS 1275
Target DNA
Temp profile Molecular analysis
(size in bp)
mcrA (464) 95˚C (10 min); 40 RTQ-PCR
cycles of 95˚C (10
s), 56˚C (7 s),
and 72˚C (25 s)
16S rRNA 95˚C (10 min); 40 RTQ-PCR
gene (798) cycles of 95˚C (10
s), 65˚C (10 s),
and 72˚C (45 s)
16S rRNA 94˚C (2 min); 33 Conventional PCR
gene (1,522) cycles of 94˚C (30
s), 55˚C (30 s),
and 72˚C (90 s)
16S rRNA 95˚C (10 min); 40 RTQ-PCR
gene (466) cycles of 95˚C (10
s), 60˚C (10 s),
Downloaded from jcm.asm.org by on January 26, 2008
and 72˚C (25 s)
(35). An access cavity was prepared with sterile high-speed diamond burs under
irrigation with sterile saline. Before entering the pulp chamber, the access cavity
was disinfected with the same protocol as mentioned above. The sterility of the
crown and the surrounding rubber was checked by taking a swab sample of the
cavity surface and streaking on blood agar plates. The absence of archaea on
the tooth’s surface and surrounding area was confirmed by PCR targeting ar-
chaeal 16S rRNA and mcrA genes as described below. All subsequent procedures
were performed aseptically. The pulp chamber was accessed with sterile burs
refrigerated in saline. The samples were collected with four sterile paper points,
which were consecutively placed in the canal to the total length calculated from
the preoperative radiograph. Afterwards, the four paper points per root canal
were pooled in a sterile tube containing 1 ml reduced transport fluid (33). The
samples were transported on dry ice by an overnight delivery service to the
Division of Oral Microbiology (RWTH Aachen University Hospital, Germany)
for subsequent molecular analysis.
Extraction of total genomic DNA. Prior to DNA extraction, the deep-frozen
endodontic samples were thawed and dispersed by vortexing for 15 s. Microbial
DNA from endodontic samples as well as DNA from pure cultures was extracted
and purified with a Qiamp DNA minikit (QIAGEN, Hilden, Germany) accord-
ing to the manufacturer’s instructions. The DNA concentration (A260) and the
purity (A260/A280) were calculated using a Gene Quant II photometer (Pharma-
cia Biotech, Cambridge, England).
General conditions for RTQ-PCR. Amplification and detection of DNA by
RTQ-PCR were performed on a LightCycler 2.0 (Roche Applied Science, Penz-
berg, Germany) using LightCycler FastStart DNA MasterPlus SYBR Green I in
a total volume of 20 ␮l. Final reaction mixtures contained 100 nM of each primer
and 3 ␮l of template DNA (approximately 75 ng). Primer sequences as well as
the temperature profiles used for the detection of mcrA genes from methano-
genic archaea, 16S rRNA genes from total archaea, and 16S rRNA genes from
total bacteria are specified in Table 1. Data acquisition and subsequent analysis
were performed using LightCycler software 3.5 (Roche Applied Science). Melt-
ing curve analysis was performed to determine the melting point of the ampli-
fication products and to assess reaction specificity. To avoid any possible primer
dimer interference, the temperature at which the fluorescence was read during
each cycle was adjusted to a degree just below the melting point of the ampli-
fication product.
The amount of initial target DNA was calculated by determining the crossing
point, i.e., the cycle at which the fluorescence exceeds a threshold value signif-
icantly higher than the background fluorescence. Quantification was performed
using the automated (default) algorithm, a strategy that calculates the crossing
point as the first maximum of the second derivative of the amplification curve.
The conversion of crossing points to initial gene target molecule numbers was
1276 VIANNA ET AL. J. CLIN. MICROBIOL.

based on dilution series of target DNA with defined target molecule amounts as TABLE 2. Total load of bacteria and archaea, expressed as
described below. Abundance data determined for archaea and bacteria in this 16S rRNA gene target molecule numbers, determined
study will be referred to as target molecule numbers of the respective genes ana- by RTQ-PCR from 20 root canals with primary
lyzed. All samples were run in triplicate, and the mean value was used for analysis. endodontic infections
The coefficient of variation of the crossing point values among replicates was
below 1%. Total Total
Sample % Archaeaa
Quantification of archaea. DNA from M. oralis DSM 7256T was amplified with bacteria archaea
the mcrA-specific primers LuF and LuR and with universal archaeal primers Endo1 2.5 ⫻ 106 0 0
A109f and A934b (Table 1), and the resulting amplicons were cloned into a Endo2 3.5 ⫻ 106 0 0
plasmid by using the TOPO TA cloning kit (Invitrogen Corp., San Diego, CA), Endo3 6.0 ⫻ 106 0 0
following the protocol of the manufacturer. After reamplification with vector- Endo4 1.0 ⫻ 108 6.8 ⫻ 105 0.68
specific primers (M13F and M13R), the PCR products were purified using the Endo5 4.5 ⫻ 107 0 0
QIAGEN purification kit (QIAGEN, Hilden, Germany) according to the man- Endo6 8.2 ⫻ 106 0 0
ufacturer’s instructions. Purified PCR products were subsequently quantified Endo7 7.8 ⫻ 107 0 0
with the PicoGreen double-stranded DNA quantification kit (Molecular Probes, Endo8 8.1 ⫻ 106 0 0
Leiden, The Netherlands). Knowing the exact size of the amplicons (Table 1) Endo9 7.1 ⫻ 106 0 0
and using the average molecular weight of a single DNA base pair, the measured Endo10 1.0 ⫻ 108 0 0
DNA amount could then be converted to target molecule numbers per microli- Endo11 2.8 ⫻ 107 0 0
ter. Dilution series of these PCR products were then used as calibration stan- Endo12 1.2 ⫻ 108 6.7 ⫻ 105 0.56
dards for measuring samples with unknown contents of methanogens and ar- Endo13 4.2 ⫻ 107 0 0
chaea by using the assay primers LuF/LuR and A109f/A934b by RTQ-PCR Endo14 4.5 ⫻ 107 1.3 ⫻ 105 0.29
(Table 1). The linear scope of detection for both assays ranged from 102 to 108 Endo15 2.1 ⫻ 108 5.8 ⫻ 105 0.28
target molecule numbers, with amplification efficiencies of 1.88 (error, 0.01) for Endo16 3.2 ⫻ 106 0 0
the mcrA-based assay and 1.88 (error, 0.05) for the archaeal 16S rRNA gene- Endo17 1.5 ⫻ 107 3.9 ⫻ 105 2.53
based assay. Endo18 8.3 ⫻ 106 0 0

Downloaded from jcm.asm.org by on January 26, 2008

Quantification of bacteria. DNAs from five bacterial species that have been
frequently found in endodontic infections were used to establish the standard
curve. The representatives of A. odontolyticus, E. faecalis, F. nucleatum, P. nigre-
scens, and T. forsythia were amplified using the universal bacterial primers PF1
and PR1 (Table 1). The resulting amplicons were purified and quantified as
described above, again enabling the conversion of the DNA amount to target
molecule numbers. Dilution series of the PCR products from all five bacterial
species were then used as calibration standards for measuring samples with
unknown contents of bacteria, using the universal bacterial primers EuF/EuR as
assay primers for RTQ-PCR (Table 1). The latter primer system has been shown
to cover a broad range of bacterial taxa (15, 26). The mean amplification efficiency
for the five species was 1.95 (coefficient of variation, 2%; error range, 0.03 to 0.07).
Sequencing and phylogenetic analysis. Preparation of plasmid DNA, PCR
amplification of cloned inserts, and nonradioactive sequencing were carried out
as described previously (14). Sequences for M. oralis DSM 7256T were deter-
mined from cloned PCR products from the mcrA gene and the 16S rRNA gene.
Sequences for M. smithii DSM 861T and for the endodontic samples were
determined by direct sequencing (i.e., without cloning) of the respective PCR
products. The identities of the mcrA and 16S rRNA gene sequences were con-
firmed by searching the international sequence databases using the BLAST
program (http://www.ncbi.nlm.nih.gov/BLAST/). The currently available data-
base of mcrA gene sequences was integrated within the ARB program package
(23). DNA sequences were analyzed and edited using the alignment tools im-
plemented in ARB. Phylogenetic tree reconstruction was performed using the
neighbor-joining approach (29) with the Felsenstein correction.
Nucleotide sequence accession numbers. The partial gene sequences deter-
mined in this study (i.e., the mcrA and 16S rRNA gene sequences of M. oralis and
of the endodontic samples as well as the mcrA gene sequence of M. smithii) have
been deposited in the EMBL, GenBank, and DDBJ nucleotide sequence data-
bases under accession numbers DQ251043 to DQ251051.
RESULTS
Identification of mcrA and 16S rRNA genes specific to ar-
chaea. Using the PCR assay based on the mcrA gene, we found
5 of the 20 cases, or 25%, to be positive for methanogens
(samples Endo4, Endo12, Endo14, Endo15, and Endo17)
(Table 2). Melting curve analysis as well as agarose gel elec-
trophoresis confirmed the identity of the target gene (data not
shown). In order to assess whether archaea other than methan-
ogens might also be present in infected root canals, a second
PCR assay based on broad-range 16S rRNA primers targeting
the domain Archaea was tested. While the mcrA-positive sam-
ples were also positive with the archaeal 16S rRNA-based PCR
approach, the remaining 15 samples were negative. Again
Endo19 1.4 ⫻ 108 0 0
Endo20 4.0 ⫻ 107 0 0
a
Percentage refers to total prokaryotic 16S rRNA gene levels (bacteria plus
archaea).
melting curve analysis and gel electrophoresis confirmed the
accuracy of the amplified gene fragments (data not shown).
Direct sequencing of the archaeal 16S rRNA gene PCR prod-
ucts (i.e., without cloning) was performed, and an ambiguity-
free sequence could be obtained for sample Endo12. Prelimi-
nary identification by searching the GenBank database
revealed M. oralis as the closest relative. For a thorough phy-
logenetic analysis, a 794-bp stretch of the 16S rRNA gene of M.
oralis DSM 7256T was sequenced and incorporated into the
ARB database along with the sequence type obtained from
sample Endo12. Figure 1 shows the phylogenetic affiliations of
these 16S rRNA gene sequences in relation to representative
members of the major phylogenetic groups within the domain
Archaea (i.e., Euryarchaeota, Crenarchaeota, Korarchaeota, and
Nanoarchaeota). Sample Endo12 was almost identical to M.
oralis (⬎99%) and shared approximately 97% similarity with
M. smithii. In addition to the 16S rRNA gene sequence of
sample Endo12, we obtained ambiguity-free sequences from
the mcrA gene PCR products of all five samples, allowing a
“cross-linking” of the two data sets and thus the identification
of the predominant archaeal population in all positively tested
endodontic samples. Comparative sequence analysis by search-
ing the GenBank database revealed a similarity value of about
80% to Methanobrevibacter ruminantium and Methanobre-
vibacter aboriphilus as the closest relatives. For proper phylo-
genetic tree reconstruction we also determined the mcrA gene
sequences of M. oralis and M. smithii. Figure 2 shows the
phylogenetic affiliation of these strains along with those of the
oral samples tested in this study. The sequences obtained from
endodontic samples were almost identical to each other (two to
three nucleotide changes over the whole sequence) and
grouped tightly with M. oralis, with a similarity of approxi-
mately 98%. These sequences formed a distinct evolutionary
VOL. 44, 2006 ARCHAEA IN ENDODONTIC INFECTIONS 1277

Downloaded from jcm.asm.org by on January 26, 2008

FIG. 1. Phylogenetic tree showing the positions of 16S rRNA gene types identified in infected root canals of human teeth relative to those of
representative members of the four major lineages from the domain Archaea. Sequences determined in this study are shown in boldface. The scale
bar corresponds to 0.1 substitution per nucleotide. The tree was calculated using 798 nucleotide positions and the neighbor-joining approach (with
the Felsenstein correction), via the ARB program package (23). The statistical significance levels of interior nodes, shown as percentages, were
determined by performing bootstrap analyses (1,000 replications; only values over 50% are shown).

lineage, showing a sequence similarity of approximately 90% to
M. smithii, with which they shared a common branching point.
The sequence similarities to M. ruminantium and M. arboriphi-
lus were 80% and 79%, respectively. The topology of a neigh-
bor-joining tree calculated from the deduced amino acid se-
quences was in accordance with the nucleotide-based tree
(data not shown), with M. oralis showing a similarity of 93% to
M. smithii, 85% to M. ruminantium, and 86% to M. arboriphi-
lus. On the protein level the sequences obtained from the
endodontic samples were identical to M. oralis.
In summary, these data indicate that root canals can be
infected by an M. oralis-like species, which to our knowledge is
the first archaeon that has been observed at this site.
Assessment of total microbial load. We also determined the
total number of archaea and bacteria in the infected root
canals by real-time quantitative PCR. Within the 20 samples
the bacterial load differed considerably and ranged from 2.5 ⫻
106 to 2.1 ⫻ 108 16S rRNA gene target molecules (Table 2). In
contrast, the total load of archaea was much more consistent
within the five positive samples and ranged from 1.3 ⫻ 105 to
6.8 ⫻ 105 target molecules, with the proportion of archaea with
respect to the total microbial community ranging from 0.28%
to 2.53%. We also quantified the methanogenic population
based on the RTQ-PCR of the functional mcrA gene. The total
load of methanogenic archaea ranged from 3.3 ⫻ 104 to 2.8 ⫻
105 mcrA gene target molecules (Fig. 3). These values were
consistently lower than those determined by 16S rRNA gene-
based RTQ-PCR. By targeting both genes, we also quantified
a dilution series extracted from M. oralis and M. smithii. The
ratio between 16S rRNA and mcrA gene target molecule num-
bers of M. oralis was comparable to the ratio determined for
the oral samples Endo4 and Endo12 (ratios of 1.81, 2.43, and
2.39, respectively, calculated from the values shown in Fig. 3),
while higher 16S/mcrA ratios were found with M. smithii (sam-
ples Endo14, Endo15, and Endo17 [ratios of 6.96, 3.94, 2.90, and
4.59, respectively, calculated from the values shown in Fig. 3]).
Melting curve analysis performed by targeting the 16S rRNA
gene showed one defined melting peak for both M. oralis and
M. smithii as well as for the endodontic samples (Fig. 4A). In
contrast, melting curve analysis performed by targeting the mcrA
gene enabled discrimination between M. oralis and M. smithii
(with the melting point differing by approximately 1°C) (Fig. 4B).
The differentiability among other methanogenic species that are
more distantly related was even more pronounced (Fig. 4C).
DISCUSSION
Prevalence and abundance of archaea in infected root ca-
nals. This study was based on an investigation of infected root
canals of human teeth, which in the healthy condition consti-
1278 VIANNA ET AL. J. CLIN. MICROBIOL.

Downloaded from jcm.asm.org by on January 26, 2008

FIG. 2. Phylogenetic tree showing the positions of the mcrA gene types identified in infected root canals of human teeth relative to those of
representative members of methanogenic archaea. Sequences determined in this study are shown in boldface. The scale bar corresponds to 0.1
substitution per nucleotide. The tree was calculated using 464 nucleotide positions and the neighbor-joining approach (with the Felsenstein
correction), via the ARB program package (23). The statistical significance levels of interior nodes, shown as percentages, were determined by
performing bootstrap analyses (1,000 replications; only values over 50% are shown).

tute a sterile anatomical site. The fact that we detected meth-
anogens in 5 of the 20 endodontic samples suggests that mem-
bers of archaea can invade this naturally closed system and
participate in the polymicrobial infection. Comparative se-
quence analysis of PCR products from archaeal 16S rRNA and
mcrA genes demonstrated that archaeal diversity was confined
to Methanobrevibacter oralis-like sequence types. Although we
did not find a 100% match with this species, the few nucleotide
differences among endodontic samples may represent sequenc-
ing errors, intraoperon variability, or different strains of a sin-
gle species and thus may reflect only one defined archaeal
phylotype. It is noteworthy that the prevalence of this archaeon
is comparable to the prevalence of the bacterial phyla Fuso-
bacteria and Actinobacteria, both of which include several rec-
ognized endodontic pathogens (30). We found M. oralis-like
sequence types to be present in the root canal with about 105
to 106 16S rRNA gene target molecule numbers. A direct
comparison with other endodontic pathogens is hardly possi-
ble, as the individual bacterial species in infected root canals
have to our knowledge not yet been quantified. Nonetheless,
the medical importance of a given species might be better
reflected by its proportion relative to the total microbial com-
munity at the infected site. The range of 0.28 to 2.53% for M.
oralis found in our study was comparable to the relative propor-
tion of methanogens previously reported in cases of moderate
periodontal disease (20).
Could the detection of M. oralis in infected root canals be
due to contamination from periodontal pockets and/or the oral
cavity? This is unlikely, first because M. oralis-like sequence
types appear to be present at detectable levels only at diseased
sites of periodontal diseases and not at healthy sites from the
same patients (20), and the teeth selected for our study showed
no evidence of gingivitis or periodontal diseases. Second, the
surfaces of the infected teeth and the surrounding area were
isolated and thoroughly disinfected prior to sampling, and lack
of contamination was confirmed afterwards by archaeal 16S
rRNA gene- and mcrA-based RTQ-PCR (see Materials and
Methods).
VOL. 44, 2006
FIG. 3. Comparison of 16S rRNA gene target molecule numbers (white bars) with mcrA gene target molecule numbers (gray bars), determined
by RTQ-PCR from pure cultures and from samples obtained from primary endodontic infections. Error bars indicate standard deviations from
three replicate RTQ-PCR runs. Mo, M. oralis; Ms, M. smithii.
Detection of methanogens in clinical samples. Because
methanogens might be the only archaea in the human body
and yet are impossible to cultivate on normal laboratory media,
the mcrA gene might represent a valuable marker gene for a
universal screening for archaea in clinical samples. We consis-
tently detected higher levels of archaeal 16S rRNA target mol-
ecules than mcrA target molecules, probably due to different
numbers of operons per cell for both genes. The operon num-
bers of 16S rRNA genes have been reported to range from one
to four copies in archaea (1), while methanogens harbor one to
two copies of the mcrA gene (25). We found a 16S rRNA/mcrA
ratio in M. oralis of approximately 2 (Fig. 3). A comparable
ratio was also determined for samples Endo4 and Endo12,
while higher ratios were determined for the remaining end-
odontic samples. This could indicate the presence of non-
methanogenic archaea (not detectable by the mcrA-based ap-
proach), cross-reaction of archaeal 16S primers with bacterial
16S rRNA genes, and/or variability in operon numbers be-
tween closely related methanogenic strains. These method-
ological constraints hamper the precise determination of
methanogenic cells by 16S rRNA analysis but favor the use of
mcrA as a molecular marker for quantification due to its spec-
ificity for methanogens and the principal lower number of
operons present per cell. This gene has another advantage for
characterizing methanogens, as it allows a fine-scale resolu-
tion of closely related methanogenic species, which becomes
evident when comparing the topology of the 16S rRNA
gene-based tree (Fig. 1) with that of the mcrA-based tree
(Fig. 2). In principal, the mcrA-based phylogeny is consis-
tent with the 16S rRNA gene-based phylogeny of methano-
gens (25); however, the trees differ in their branch lengths
separating individual sequences. The reason for this is prob-
ARCHAEA IN ENDODONTIC INFECTIONS 1279
Downloaded from jcm.asm.org by on January 26, 2008
ably the accumulation of synonymous (neutral) mutations in
the third codon position that do not lead to changes of
amino acid residues but clearly facilitate stronger differen-
tiation of mcrA sequence types. Thus, sequence detection of
mcrA genes in clinical samples might provide valuable in-
formation not only about the prevalence of methanogens in
human infectious diseases but also about the functional
diversity of such putative pathogens.
Although direct sequencing is the gold standard for reliably
identifying methanogenic species in clinical samples without
culturing, melting curve analysis of mcrA RTQ-PCR products
might enable a preliminary identification. This is because the
relatively high degree of diversity among mcrA gene types
facilitates a differentiation of even closely related species,
such as M. oralis and M. smithii, by their individual melting
profiles. Such a differentiation is not possible by melting
curve analysis of the respective 16S rRNA gene PCR prod-
ucts (Fig. 4).
Role of methanogens in infected root canals. Most methan-
ogens, including members of the genus Methanobrevibacter,
metabolize molecular hydrogen (H2) and carbon dioxide
(CO2) with methane as the resultant product. Hydrogen is a
crucial intermediate product in anoxic environments, as a bal-
ance of hydrogen-producing and hydrogen-consuming pro-
cesses is necessary for the efficient anaerobic digestion of or-
ganic matter (8). This is due to the unfavorable energetics of
fermentation reactions in the presence of even low concentra-
tions of hydrogen. While the root canal infection is a dynamic
process in which various bacterial species dominate at different
stages of the infection due to changes in the availability of
nutrition, oxygen level (redox potential), and the local pH, the
hydrogen concentration might steadily increase until it reaches
1280 VIANNA ET AL. J. CLIN. MICROBIOL.

Downloaded from jcm.asm.org by on January 26, 2008

FIG. 4. Dissociation curves of archaeal 16S rRNA gene PCR products (A) and methanogenic mcrA gene PCR products (B and C). E,
endodontic samples; Mo, M. oralis; Ms, M. smithii; Mb, M. bryantii; Mm, M. maripaludis; Mh, M. hungatei; NTC, nontarget control.

a level too high to sustain further microbial growth. By con-
suming H2, methanogens therefore could play an important
role in supporting microbial growth and driving the infection
process in root canals. Such an “interspecies hydrogen trans-
fer” between anaerobic bacteria and methanogens is known
from natural environments and seems to be an important fac-
tor for ecosystem functioning (6, 8, 22).
The fact that we did not find methanogens in all endodontic
samples could be due to a different species combination in the
root canal (i.e., no hydrogen-producing microorganisms and
thus no substrate availability for methanogens) or to exclusion
by other hydrogen-metabolizing bacteria. For instance, dissim-
ilatory sulfate-reducing bacteria such as those of the genera
Desulfomicrobium and Desulfovibrio are potential competitors
for H2. Members of both genera have been found in periodon-
tal pockets (19) but so far not in endodontic infections accord-
ing to our own investigations (data not shown) using RTQ-
PCR primers specific to the gene dsrAB, encoding the key
enzyme dissimilatory sulfite reductase, which is conserved in all
known sulfate-reducing bacteria (36). Other microbial H2 com-
petitors, for example, Treponema populations (20), or unfavor-
able environmental conditions such as host-microbe interac-
tions could be responsible for the absence of methanogens
from those sites. Nonetheless, the presence of methanogens in
relatively high numbers (as mentioned above) in some but not
all cases of primary endodontic infections indicates that they
find favorable conditions that allow growth coupled with syn-
trophic interactions with other endodontic pathogens.
Our findings are in contrast to a recent study in which a
survey of 96 cases was performed to search for archaea in
VOL. 44, 2006
endodontic infections (31). Those authors did not find evi-
dence for the presence of archaea in human endodontic infec-
tions and concluded that they are not implicated in the etiology
of apical periodontitis. Although it is unclear why they did not
detect methanogens in any of their samples, the most plausible
reason might be the different primer systems used. We re-
tested the universal archaeal primers used by Siqueira et al.
(31) under same conditions by conventional PCR and by
RTQ-PCR. Of five tested methanogenic isolates only three,
Methanococcus maripaludis, Methanoplanus endosymbiosus,
and Methanospirillum hungatei, could be amplified (data not
shown). In contrast, M. oralis and M. smithii, which are
known colonizers of the human body as well as the clinical
samples that had tested positive in our study, were not
amplifiable by their primer system. A subsequent database
search of archaeal 16S rRNA genes through the ARB phy-
logenetic software package (23) showed mismatches of the
forward primer Arch21F (11, 31) with several members from
the domain Euryarchaeota. It is therefore plausible that
methanogens were overlooked by Siqueira et al. (31) due to
the primer set used.
Archaea as human pathogens. Molecular and cultural stud-
ies have shown that various bacterial taxa, both cultivable and
uncultivable, can be detected in infected root canals (30).
However, an association of archaea with apical periodontitis
has, to our knowledge, not been described so far. As archaea
such as methanogens are essential syntrophic partners in many
anaerobic systems, there is good reason to assume that they
have an analogous function in root canal infections and prob-
ably also in other mixed anaerobic infections. This raises the
interesting question as to whether some archaea can be con-
sidered potential human pathogens; that is, do they have fea-
tures or strategies that characteristically distinguish pathogenic
bacteria from commensals? This issue has recently been ad-
dressed by two different research groups (7, 12), both of which
compiled literature data about archaea in possible association
with human disease. For instance, higher levels of breath meth-
ane (produced by methanogens) have been detected in pa-
tients with precancerous conditions (ulcerative colitis and co-
lonic polyposis) and cancer of the colon. Cell wall structures of
the archaeon Sulfolobus solfataricus have been demonstrated
to exhibit toxic activity similar to that of lipopolysaccharides in
mice and rabbits, indicating a genetically programmed immune
response in those animals that recognizes archaea as potential
pathogens. Furthermore, various toxin/antitoxin systems have
been found in Methanococcus jannaschii, Archaeoglobus fulgi-
dus, and haloarchaea. In addition, virulence genes for lipopoly-
saccharide biosynthesis and the tadA gene (e.g., required by
Actinobacillus actinomycetemcomitans for nonspecific adher-
ence) have been identified in archaea (reviewed in references
7 and 12).
In summary, these authors (7, 12) have developed a mean-
ingful perspective concerning the potential for archaea to
cause disease, yet there is still a large gap in knowledge re-
garding the diversity and abundance of archaea in the human
body and the types of interactions they are engaged in with
human cells and other microbes. Our results show that meth-
anogens are implicated in an oral infectious disease and thus
support the hypothesis that members of Archaea might func-
tion as human pathogens.
ARCHAEA IN ENDODONTIC INFECTIONS 1281
ACKNOWLEDGMENTS
This work was supported by the Brazilian grant agencies CAPES
(BEX 3410/04-8) and FAPESP (02/13980-9) and the START program
of the Faculty of Medicine, RWTH, Aachen, Germany.
We thank Dana Kemnitz and Ralf Conrad, Max-Planck-Institute for
Terrestrial Microbiology, Marburg, Germany, for kindly donating
some methanogenic strains. We thank Ilse Seyfarth and Vreni Mer-
riam for various forms of assistance.
REFERENCES
1. Acinas, S. G., L. A. Marcelino, V. Klepac-Ceraj, and M. F. Polz. 2004.
Divergence and redundancy of 16S rRNA sequences in genomes with mul-
tiple rrn operons. J. Bacteriol. 186:2629–2635.
2. Barns, S. M., C. F. Delwiche, J. D. Palmer, and N. R. Pace. 1996. Perspec-
tives on archaeal diversity, thermophily and monophyly from environmental
rRNA sequences. Proc. Natl. Acad. Sci. USA 93:9188–9193.
3. Barns, S. M., R. E. Fundyga, M. W. Jeffries, and N. R. Pace. 1994. Remark-
able archaeal diversity detected in a Yellowstone-National-Park hot-spring
environment. Proc. Natl. Acad. Sci. USA 91:1609–1613.
4. Belay, N., R. Johnson, B. S Rajagopal, E. C. de Macario, and L. Daniels.
1988. Methanogenic bacteria from human dental plaque. Appl. Environ.
Microbiol. 54:600–603.
5. Belay, N., B. Mukhopadhyay, D. M. Conway, R. Galask, and L. Daniels.
1990. Methanogenic bacteria in human vaginal samples. J. Clin. Microbiol.
28:1666–1668.
6. Bonchosmolovskaya, E. A., and K. O. Stetter. 1991. Interspecies hydrogen trans-
Downloaded from jcm.asm.org by on January 26, 2008
fer in cocultures of thermophilic archaea. Syst. Appl. Microbiol. 14:205–208.
7. Cavicchioli, R., P. M. G. Curmi, N. Saunders, and T. Thomas. 2003. Patho-
genic archaea: do they exist? Bioessays 25:1119–1128.
8. Conrad, R. 1999. Contribution of hydrogen to methane production and
control of hydrogen concentrations in methanogenic soils and sediments.
FEMS Microbiol. Ecol. 28:193–202.
9. Conrads, G., S. E. Gharbia, K. Gulabivala, F. Lampert, and H. N. Shah.
1997. The use of a 16S rDNA directed PCR for the detection of endodon-
topathogenic bacteria. J. Endod. 23:433–438.
10. Conrads, G., K. Pelz, B. Hughes, I. Seyfarth, and D. A. Devine. 1997.
Optimized oligonucleotides for the differentiation of Prevotella intermedia
and Prevotella nigrescens. Oral Microbiol. Immunol. 12:117–120.
11. DeLong, E. F. 1992. Archaea in coastal marine environments. Proc. Natl.
Acad. Sci. USA 89:5685–5689.
12. Eckburg, P. B., P. W. Lepp, and D. A. Relman. 2003. Archaea and their
potential role in human disease. Infect. Immun. 71:591–596.
13. Grosskopf, R., P. H. Janssen, and W. Liesack. 1998. Diversity and structure
of the methanogenic community in anoxic rice paddy soil microcosms as
examined by cultivation and direct 16S rRNA gene sequence retrieval. Appl.
Environ. Microbiol. 64:960–969.
14. Horz, H.-P., R. Virginia, S. Avrahami, and B. J. M. Bohannan. 2005. Methane-
oxidizing bacteria in a California upland grassland soil: diversity and response
to simulated global change. Appl. Environ. Microbiol. 71:2642–2652.
15. Horz, H.-P., M. E. Vianna, B. P. Gomes, and G. Conrads. 2005. Evaluation
of universal probes and primer sets for assessing total bacterial load in
clinical samples: general implications and practical use in endodontic anti-
microbial therapy. J. Clin. Microbiol. 43:5332–5337.
16. Kakehashi, S., H. R. Stanley, and R. J. Fitzgerald. 1965. The effects of
surgical exposures of dental pulps in germ-free and conventional laboratory
rats. Oral Surg. Oral Med. Oral Pathol. 20:340–349.
17. Karlin, D. A., R. D. Jones, J. R. Stroehlein, A. J. Mastromarino, and G. D.
Potter. 1982. Breath methane excretion in patients with unresected colorec-
tal cancer. J. Natl. Cancer Inst. 69:573–576.
18. Kulik, E. M., H. Sandmeier, K. Hinni, and J. Meyer. 2001. Identification of
archaeal rDNA from subgingival dental plaque by PCR amplification and
sequence analysis. FEMS Microbiol. Lett. 196:129–133.
19. Langendijk, P. S., E. M. Kulik, H. Sandmeier, J. Meyer, and J. S. van der
Hoeven. 2001. Isolation of Desulfomicrobium orale sp nov and Desulfovibrio
strain NY682, oral sulfate-reducing bacteria involved in human periodontal
disease. Int. J. Syst. Evol. Microbiol. 51:1035–1044.
20. Lepp, P. W., M. M. Brinig, C. C. Ouverney, K. Palm, G. C. Armitage, and
D. A. Relman. 2004. Methanogenic archaea and human periodontal disease.
Proc. Natl. Acad. Sci. USA 101:6176–6181.
21. Love, R. M., and H. F. Jenkinson. 2002. Invasion of dentinal tubules by oral
bacteria. Crit. Rev. Oral Biol. Med. 13:171–183.
22. Lovley, D. R. 1985. Minimum threshold for hydrogen metabolism in metha-
nogenic bacteria. Appl. Environ. Microbiol. 49:1530–1531.
23. Ludwig, W., O. Strunk, R. Westram, L. Richter, H. Meier, Yadhukumar, A.
Buchner, T. Lai, S. Steppi, G. Jobb, W. Forster, I. Brettske, S. Gerber, A. W.
Ginhart, O. Gross, S. Grumann, S. Hermann, R. Jost, A. Konig, T. Liss,
R. Lussmann, M. May, B. Nonhoff, B. Reichel, R. Strehlow, A. Stamatakis,
N. Stuckmann, A. Vilbig, M. Lenke, T. Ludwig, A. Bode, and K. H. Schleifer.
2004. ARB: a software environment for sequence data. Nucleic Acids Res.
32:1363–1371.
1282 VIANNA ET AL.
24. Lueders, T., K. J. Chin, R. Conrad, and M. Friedrich. 2001. Molecular
analyses of methyl-coenzyme M reductase alpha-subunit (mcrA) genes in
rice field soil and enrichment cultures reveal the methanogenic phenotype of
a novel archaeal lineage. Environ. Microbiol. 3:194–204.
25. Luton, P. E., J. M. Wayne, R. J. Sharp, and P. W. Riley. 2002. The mcrA gene
as an alternative to 16S rRNA in the phylogenetic analysis of methanogen
populations in landfill. Microbiology 148:3521–3530.
26. Nadkarni, M. A., F. E. Martin, N. A. Jacques, and N. Hunter. 2002. Deter-
mination of bacterial load by real-time PCR using a broad-range (universal)
probe and primers set. Microbiology 148:257–266.
27. Nair, P. N. 2004. Pathogenesis of apical periodontitis and the causes of
endodontic failures. Crit. Rev. Oral Biol. Med. 15:348–381.
28. Relman, D. A., and S. Falkow. 2000. A molecular perspective of microbial
pathogenicity, p. 2–13. In G. L. Mandell et al. (ed.), Principles and practice
of infectious diseases, 5th ed. Churchill Livingstone, Philadelphia, Pa.
29. Saitou, N., and M. Nei. 1987. The neighbor-joining method—a new method
for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406–425.
30. Siqueira, J. F. 2003. Taxonomic changes of bacteria associated with end-
odontic infections. J. Endod. 29:619–623.
J. CLIN. MICROBIOL.
31. Siqueira, J. F., I. N. Rocas, J. C. Baumgartner, and T. Xia. 2005. Searching
for archaea in infections of endodontic origin. J. Endod. 31:719–722.
32. Stahl, D. A., and R. Amann. 1991. Development and application of nucleic
acid probes in bacterial systematics, p. 205–248. In E. Stackebrandt and M.
Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John
Wiley & Sons Ltd., Chichester, England.
33. Syed, S. A., and W. J. Loesche. 1972. Survival of human dental plaque flora
in various transport media. Appl. Microbiol. 24:638–644.
34. Thauer, R. K. 1998. Biochemistry of methanogenesis: a tribute to Marjory
Stephenson. Microbiology 144:2377–2406.
35. Vianna, M. E., H.-P. Horz, B. P.Gomes, and G. Conrads. 2005. Microarrays
complement culture methods for identification of bacteria in endodontic
infections. Oral Microbiol. Immunol. 20:253–258.
36. Wagner, M., A. J. Roger, J. L. Flax, G. A. Brusseau, and D. A. Stahl. 1998.
Phylogeny of dissimilatory sulfite reductases supports an early origin of
sulfate respiration. J. Bacteriol. 180:2975–2982.
37. Woese, C. R., O. Kandler, and M. L. Wheelis. 1990. Towards a natural system
of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc.
Natl. Acad. Sci. USA 87:4576–4579.
Downloaded from jcm.asm.org by on January 26, 2008