Toxicology 366 (2016) 68–73

Contents lists available at ScienceDirect Toxicology

journal homepage: www.elsevier.com/locate/toxicol

Metallothionein does not sequester arsenic(III) ions in condition of acute arsenic

toxicity
Roobee Garlaa,*, Renuka Gangera, Biraja P. Mohantya, Shivcharan Vermab, Mohinder P. Bansala, Mohan
L. Garga
a
Department of Biophysics, Panjab University, Chandigarh 160014, India b Department of Physics, Panjab University, Chandigarh 160014, India

ARTICLE INFO

Article history:

Received 1 June 2016

Received in revised form 6 August 2016 Accepted 8 August 2016

Available online 11 August 2016

Keywords:

Arsenic Metallothionein Sequestration PIXE

ESI–MS

1. Introduction

Arsenic and its compounds have been classified as human carcinogens by the International Agency for Research on Cancer (IARC) (2012).
Several countries like Argentina, Bangladesh, Chile, China, India, Mongolia and Taiwan are severely affected due to the exposure of arsenic
contaminated drinking water (Tseng, 2009). In India alone, arsenic contamination in ground water affects nearly 70 million people in 86 districts
across 10 states (First Report Committee on Estimates, 2014). Chronic arsenic exposure of inorganic arsenic through drinking water causes skin
lesions, hyperkeratosis, cancers, blackfoot disease, vascular diseases and diabetes (Tseng, 1977; Tseng et al., 2000; Kitchin, 2001; Wang et al.,
2007a,b; Flora, 2011). The toxicity of arsenic compounds is highly dependent upon their oxidation state and chemical composition (Del Razo et
al., 2001). Inorganic arsenate (As(V)) being a molecular analogue of phosphate, competes for binding to the phosphate anion transporters and
replaces phosphate in some biochemical

* Corresponding author.

E-mail address: rubygarla@yahoo.co.in (R. Garla).

http://dx.doi.org/10.1016/j.tox.2016.08.008

0300-483X/ã 2016 Elsevier Ireland Ltd. All rights reserved.

ã 2016 Elsevier Ireland Ltd. All rights reserved.

reactions. However, the toxicity of trivalent arsenicals is through their interaction with the sulfhydryl groups in proteins (Shen et al., 2013).
Inorganic arsenite (As(III)) can inhibit a number of vital proteins (e.g. pyruvate dehydrogenase, glutathione reductase, glutathione S-transferase,
thioredoxin reductase, and DNA ligases etc.) by binding directly to their thiol groups leading to manifestations of various diseases (Styblo et al.,
1997; Snow et al., 1999; Chouchane and Snow, 2001; Wang et al., 2007a,b; Bergquist et al., 2009). In this context, the sulfhydryl rich protein,
Metallothionein (MT), provides a favorable condition for the binding of As(III) ions to it. It has a significant role in heavy metal detoxification
through various processes. In one of the processes, either the heavy element is directly sequestered by the apo-MT or it displaces Zn ions already
bound to MT. Thus, the concentration of Zn in the free pool increases which leads to the binding of Zn to metal transcription factor 1 (MTF1),
consequently initiating MT expression. Newly synthesized MT will further sequester the unbound heavy metal ions present in the cytosol. This
mechanism is prevalent in case of acute toxicity of Cd and Ag (Suzuki and Yoshikawa, 1976; Klaassen et al., 2009). Other metals like Ni, Co and
Mn do not directly interact with MT but induce oxidative stress in the cytosol (Haq et al., 2003). Thus, the concentration of Zn in the

ABSTRACT

The major cause of toxicity of trivalent arsenicals is due to their interaction with the sulfhydryl groups in proteins. Because of its high content, Metallothionein (MT)
provides one of the most favorable conditions for the binding of As(III) ions to it. MT has long been anticipated for providing resistance in case of arsenic (As)
toxicity with similar mechanism as in case of cadmium toxicity. The present study investigates whether the sequestration of As ions by MT is one of the mechanisms
in providing protection against acute arsenic toxicity. A rat model study on the metal stoichiometric analysis of MT1 isoform isolated from the liver of arsenic treated,
untreated and zinc treated animals has been carried out using the combination of particle induced X-ray emission (PIXE) and electrospray ionisation mass
spectrometry (ESI–MS). The results revealed the absence of arsenic bound MT1 in the samples isolated from arsenic treated animals. Although, both Cu and Zn ions
were present in MT1 samples isolated from all the treatment groups. Moreover, only partially metallated MT1 with varying number of Zn ions were observed in all
the groups. These results suggest that the role of MT during acute arsenic toxicity is different from its already established role in case of cadmium toxicity.

free pool increases, as the donor potential of MT increases under more oxidizing conditions, leading to MT induction (Maret and Vallee, 1998;
Maret, 2011). In some cases, the metal ion binds directly to MTF1, which in turn initiates MT induction. For example arsenic (III) is directly
sensed by the C-terminal cysteine cluster of MTF1, initiating the binding of MTF1 to metal response elements (MRE) and induction of MT1 (He
and Ma, 2009). Although, it has been demostrated that MT is induced in case of acute arsenic toxicity (He and Ma, 2009), there is no evidence for
direct binding of As(III) ions with MT in such conditions. Various in vivo studies also provide evidence for the protective role of MT in case of
chronic as well as acute arsenic toxicity (Kreppel et al., 1994; Liu et al., 2000; Park et al., 2001). One report shows that LD50 of As is 1.4 fold
higher for wild type mice than MT null-mice (Park et al., 2001). Arsenic exposure is more toxic to MT1/II-null mice and also decreases GSH
content and induces apoptotic factors such as caspase-3 (Liu et al., 2000). Pretreatment with zinc, an effective inducer of MT synthesis provides
protection against As toxicity (Kreppel et al., 1994). The in vitro studies on binding of As to MT reveal that As(III) ions binds to MT in a ratio of
6:1 and the resulting complex is stable in a wide pH range (Toyama et al., 2002; Jiang et al., 2003; Ngu and Stillman, 2006; Ngu et al., 2008;
Irvine et al., 2013; Garla et al., 2013).

The present study was designed to determine whether, like in case of cadmium, the sequestration of As(III) ions by MT is one of the mechanism
for providing protection in case of acute arsenic toxicity. To address this, metal stoichiometric analysis of the isolated rat liver MT1 induced by
acute arsenic toxicity has been carried out using the combination of particle induced X-ray emission (PIXE) and electrospray ionisation mass
spectrometry (ESI–MS). Identical protocol was followed to analyse the MT samples isolated from untreated rats (i.e. animals without any metal
supplementation) and Zn treated rats which serve as control and positive control respectively in this study. To confirm the expression of MT in
various treatment groups, analysis of MT-1 mRNA expression was also carried out. Moreover, elemental analysis of the liver tissue samples was
also performed to observe the accumulation of various heavy metals.

2. Materials and methods

2.1. Chemicals and reagents

Sodium arsenite (NaAsO2) and Zinc sulfate (ZnSO47H2O) were obtained from Central Drug House (P) Ltd, New Delhi, India; TRI- Reagent, one
step with Platinum1 Taq DNA Polymerase Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) kit was pro- cured from Invitrogen,
USA. All other reagents used for MT isolation and RNA analysis were of molecular biology grade from Sigma Chemical Co. St. Louis (USA).

2.2. Animal treatment

Male Wistar adult rats, weighing 200–250 g, procured from the Central Animal House, Panjab University, Chandigarh, India, were used for the
present study. The rats were fed with standard pelleted diet and drinking water ad libitum. For the induction and isolation of MT, the rats were
randomly divided into three groups of 10 animals each: Animals in Group I (control) were injected subcutaneously (sc) with saline. Animals in
group II (Zn) were injected sc with 153 mmol of ZnSO4/kg body weight in saline, once a day for two days. Group III (As) animals were injected
sc with 75 mmol of NaAsO2/kg body weight in saline once (Albores et al., 1992). All doses were prepared in isotonic saline. After 18 h of the
last injection the animals were sacrificed by cervical dislocation under anesthesia and the livers were excised. The concentration of

MT in liver, induced by metal supplementation through injection, has been observed to be maximum at 18 h post treatment (Albores et al., 1992).
The experimental design and procedures were approved by the institutional Ethical Committee on Animal experiments, Panjab University,
Chandigarh.

2.3. RNA isolation and RT-PCR

Total RNA was isolated from the liver tissue of various treatment groups using Tri-Reagent. The purity and quantity of RNA was determined by
monitoring A260/A280 ratio and absorbance at 260 nm (A260). For the RT-PCR analysis, the following forward and reverse primers of MT-1 were
used: forward “TGTGCCTGAAGT- GACGAACAG” and reverse “TTCACATGCTCGGTAGAAAACG” (Liu et al., 2007). The PCR products
were analyzed on 1.2% agarose gel electrophoresis and the densitometric analysis of bands was done using IMAGE J Software from National
Institutes of Health, USA.

2.4. Statistical analysis

Statistical analysis software, SPSS (version 14) was employed for statistical processing of the data. Data are expressed as mean standard
deviation. The statistical significance of the difference between various groups was determined using one- way analysis of variance (ANOVA).
This was followed by multiple post-hoc least significant difference (LSD) test for comparison between different groups. The level of significance
was set at p 0.05 in all cases.

2.5. MT isolation

A combination of gel filtration and anion exchange chromatog- raphy was used for the isolation of MT from the rat liver of control and different
metal supplemented groups by following the protocol reported earlier (Garla et al., 2013). The fractionation procedure was repeated multiple
times to obtain the required amount of protein for both PIXE and ESI–MS studies. About 100– 150 mg of MT was recovered from the liver of
one animal.
2.6. PIXE

Elemental analysis of the MT samples isolated from rat liver was carried out using the PIXE facility at the Panjab University Cyclotron,
Chandigarh, India (Puri et al., 2006). Details of the experimental procedure and calibration of the set up for the analysis of protein samples are
described elsewhere (Hajivaliei et al., 1999; Garla et al., 2013). Briefly, 20 m L of MT solution was dispensed and dried on a Kapton foil. After
drying, the sample appears as a circular spot of $5 mm diameter. Three X-ray spectra from each sample were recorded by irradiating the sample
spot at three different locations by 2.7 MeV protons. An average of three measurements represents the elemental concentration for each sample.

PIXE analysis of rat liver tissue was performed at the 3 UD pelletron accelerator at the Institute of Physics (IOP), Bhubaneswar, India (Hajivaliei
et al., 1999; Balouria et al., 2011). The liver tissue samples were prepared by following the protocol reported by Balouria et al. (2011). Briefly,
liver tissue was freeze dried and 200mg of each sample was ground and mixed thoroughly with graphite powder (100mg) with the help of Agate
pestle and mortar. The mixture was further ground for the time, till it turned into a homogeneous fine powder. The resultant powder was made
into pellets of 13 mm diameter with the help of a hydraulic press. These pellets were irradiated with 3 MeV protons and the emitted X-rays were
detected using a Si(Li) detector positioned at 90 angle with respect to the beam. Calibration of the experimental facility

R. Garla et al. / Toxicology 366 (2016) 68–73 69

70 R. Garla et al. / Toxicology 366 (2016) 68–73

was performed using pellets of standard reference materials (SRM) from NIST and IAEA prepared under the identical condition as that for the
samples. The computer code GUPIX (Campbell et al., 2000) was used to evaluate the elemental concentrations by fundamental parameter
method.

In both the PIXE experiments, the beam current was optimized such that the detector dead time was <1%. The data was recorded for sufficient
period so that the statistical errors in the intensities of all the major X-ray lines are below 3%.

2.7. ESI–MS

ESI–MS experiments were performed with Waters1 micro- mass1 quadrupole time-of-flight (Q-TOF) Mass Spectrometer at Regional
Sophisticated Instrumentation Centre (RSIC), Panjab University, Chandigarh, India. The experimental conditions were as follows: capillary
voltage 3973 V, sample cone voltage 21 V and extraction cone voltage 2 V. Leucine enkephalin was used for the calibration of the spectrometer.
MT usually exhibits an ESI mass spectrum with a series of charge states of measurable intensity between +4 and +10, depending on the
metallation status and the pH of the analyzed sample (Merrifield et al., 2004). Therefore, the mass spectra of MT1 were recorded in the m/z range
of 500– 2000 amu. All samples were prepared under the environment of argon gas to avoid the oxidation of MT and were analyzed thrice.

3. Results

A significant increase in the MT-1 mRNA expression was observed in the zinc treated groups (p 0.001) as compared to the control (Fig. 1). Also,
an enhancement in the MT-1 mRNA

expression in the arsenic treated groups is significant (p 0.05) as compared to the control (Fig. 1).

The ESI–MS spectrum of MT1 isolated from the liver of untreated group (control) shows only the presence of partially metallated ions of MT1
i.e. Zn5MT1 carrying +9 charges (m/ z = 701.5) and Zn1MT1 carrying +9 charges (m/z = 679.5) (Fig. 2A(b), Table 1). The ions of the fully
metallated Zn7MT1 were not observed. The ESI–MS spectrum of MT1 samples from Zn treated group also shows only the presence of partially
metallated ions of MT1 i.e. Zn5MT1 carrying +9 charges and Zn1MT1 carrying +9 charges (Fig. 2B(b), Table 2). The ESI–MS spectrum of MT1
samples isolated from the liver of arsenic intoxicated group also shows only the presence of Zn 5MT1 carrying +9 charges and Zn1MT1 carrying
+9 charges (Fig. 2C(b), Table 3). Despite the fact that, in this case, the induction of MT was done with arsenic treatment, no arsenic bound MT
ion was observed. In this case, Zn5MT1 ions carrying +9 charges were the dominant species.

The left panel of Fig. 2, represents the PIXE spectra of MT1 isolated from liver of control, zinc and arsenic treated animals. In the PIXE spectra,
the S, Cu and Zn peaks are from the MT1, Cl and K peaks are from the sample buffer and the Ca and Fe are from the kapton foil. Details about
the identification of elements from the sample buffer and the Kapton foil have been discussed elsewhere (Garla et al., 2013). Though, PIXE is a
multi-elemental analysis technique, it could not detect any arsenic ions in the MT samples from arsenic treated animals (Fig. 2C(a)). The ratio of
Zn to S, Cu to S and Cu to Zn concentrations in the isolated rat liver MT1 samples from control, Zn and As groups were evaluated using GUPIX
code and is given in Table 4. The Zn to S ratio increases by $80% (still less than fully metallated Zn7MT1) in MT1 samples from Zn group as
compared to control group whereas; the Cu to S ratio remains

Fig. 1. Relative mRNA expression of MT-1 in rat liver in different metal substituted groups using RT-PCR (a) Lane 1, As group; Lane 2, control group; Lane 3, Zn
group; (b)

Histogram represents the relative density values and are expressed as mean SD (n = 4). These values differ significantly from the control group (a2p all values are
normalized with b-actin.

0.001, a3p 0.05); and

Calculated mass
6311.1 6349.1 6477.3 6115.5

Calculated mass

6311.1 6115.5

Table 1

Major species observed in the ESI–MS spectrum of the isolated MT1 from the liver of control group.

m/z Peak intensity (%)

701.5 10 0 705.4 43.5 719.4 39.2 679.5 34.3

Table 2

Molecular ion ([ion]charge)

[Zn5MT NH3 + 9H]9+ [Zn5MT + Na + 9H]9+ [Zn5MT + Na + K + 7H]9+ [Zn1MT + K + 8H]9+

Experimental mass

6313.5 6348.6 6474.6 6115.5

Experimental mass

6316.2 6119.1

Major species observed in the ESI–MS spectrum of the isolated Zn induced MT1 from rat liver.

m/z Peak intensity (%)

701.8 100 679.9 29.2

Molecular ion ([ion]charge)

[Zn5MT-NH3 + 9H]9+ [Zn1MT + K + 8H]9+

invariant. On As supplementation, the Zn to S ratio increases by $27% with respect to the control group but, the Cu to S ratio increases by
$120%. Under the present experimental conditions, the minimum detection limit (MDL) for zinc was $0.09 nmol/cm2 and in our samples zinc
concentration was 0.9–1.25nmol/cm2. Whereas, for arsenic MDL was similar to that of Zn (0.13 nmol/cm2), still no arsenic was detected.

Table 3

Major species observed in the ESI–MS spectrum of the isolated As induced MT1 from rat liver.

m/z Peak intensity (%)

701.5 100 679.5 31.6

Molecular ion ([ion]charge)

[Zn5MT NH3 + 9H]9+ [Zn1MT + K + 8H]9+

Experimental mass

6313.5 6115.5

Calculated mass

6311.1 6115.5

R. Garla et al. / Toxicology 366 (2016) 68–73 71

Fig. 2. (a) PIXE and (b) ESI–MS spectra of isolated rat liver MT1 from control (untreated) (A), Zn induced (B), As induced (C).

The concentrations of sulfur, zinc and copper in the liver tissue of rat from different metal supplemented groups are given in Table 5. No arsenic
was detected in the liver of arsenic treated rats. Increase in the concentrations of zinc in liver tissue is observed for the Zn and As supplemented
groups as compared to the control group whereas, the concentration of copper remains largely unaffected in all the groups. A significant reduction
(p 0.01) in

72 R. Garla et al. / Toxicology 366 (2016) 68–73

Table 4
Ratio of different elements found in the PIXE spectrum of the control MT1, Zn induced MT1 and As induced MT1 isolated from rat liver.

been observed. Direct binding of MT to various metals such as Cd, Zn, Cu, Ag, Pb (after 14–44 h of metal injection) in in vivo conditions has
been observed (Suzuki and Yoshikawa, 1976). Sequestration of these metals by MT helps in providing protection against their toxic effects. In
the present study, the absence of MT complexed with arsenic in rat liver suggests that the metabolism of arsenic is different from the other MT
inducing heavy metals.

PIXE analysis of the liver tissue samples collected 18h after arsenic treatment does not show any traces of arsenic in the whole tissue (Table 5).
Nevertheless, a decrease in sulfur concentration and an increase in Zn concentration in these tissue samples have been observed. Moreover, a
significant decrease in the levels of GSH and total S content in the liver of arsenic intoxicated rats has also been observed. These results indicate
that 18 h post treatment all of the arsenic has got excreted out of the liver tissue. GSH plays a crucial role in the expulsion of arsenic from the
intracellular environment to bile by conjugating to it and forming arsenic triglutathione and monomethyl arsenio diglutathione (Kala et al., 2000).
The decrease in GSH and total sulfur content in the liver tissue supports the likelihood of this process. Although, GSH plays a similar role in the
expulsion of Cd from the liver, even then, MT bound cadmium has been observed in the liver of Cd treated animals. This indicates that MT has a
higher affinity for Cd than As in the intracellular environment.

Arsenic, being a metalloid, doesnot exists in ionic form as As3+ like other metal ions such as Zn2+ and Cd2+ in acidic to neutral pH conditions.
Instead, in solution, As(III) exists in coordination with three hydroxyl ions as As(OH) 3 (Rey et al., 2004; Rahman and De Ley, 2016). The
coordination of As(III) with thiol (-SH) group occurs concomitantly with the deprotonation of the later and the binding of the dissociated proton
to a hydroxyl group of As(OH)3, releasing a water molecule (Rey et al., 2004). This might be the reason behind the observation of Waalkes et al.
(1984) which evidenced that arsenic has limited ability to displace Zn from Zn-MTs whereas Cd, Pb, Cu, Hg, Ag, Ni and Co can effectively
displace it. Here, it can be noted that except for arsenic, all the other ions are metals, which exist in their ionic forms in the solution. Moreover,
under both physiological and oxidative stress conditions, the intramolecular disulfide bonds are present in apo-MT (Feng et al., 2006; Bell and
Vallee, 2009). This leads to the unavailability of protons from thiol groups of metallated as well as apo-MT for binding to the hydroxyl groups of
As(OH)3. Taken together all the above facts imply that the As(III) ions entering into the hepatocytes after a single acute dose, as in the present
study, could neither displace Zn from already existing ZnMT nor bind to apo-MT. In summary, the sequestration of As(III) by MT is not the
mechanism for providing protection in event of its acute toxicity.

5. Conclusion

The results of the present study indicate that unlike other toxic heavy elements, the metabolism of arsenic in liver, in event of its acute toxicity, is
different. Although, there is induction of MT due to arsenic toxicity, the sequestration of arsenic(III) ions by metal- lothionein was not observed.
Therefore, it can be concluded that the sequestration of arsenic by MT in liver is not the mechanism for providing protection in case of acute
arsenic toxicity unlike cadmium. These observations suggest that the role of MT in heavy element toxicity is different for different elements and
extrapola- tion of the effect of one element to another should be avoided.

Acknowledgments

The authors are thankful to Dr. Ashok Kumar and the staff of Panjab University Cyclotron, Chandigarh, India and Pelletron Laboratory, IOP,
Bhubaneshwar, India for the support rendered

Control MT1

Zn induced MT1 As induced MT1

Table 5

Zn/S

0.12 0.01

0.22 0.02 0.16 0.01

Cu/S

0.06 0.01 0.06 0.01 0.14 0.01

Cu/Zn

0.51 0.05 0.26 0.03 0.87 0.09

Particle Induced X-ray Emission (PIXE) analysis of elements in the rat liver from different metal substituted groups.

Elements Group I (Control) Sulfur 10850 560

Group II (Zinc)

Group III (Arsenic)

7000 2000a1 Copper 7311 707 7012

8500 900

Zinc 36026 44090 38060

a1
Values are significantly different from the control group (p 0.01).

sulfur concentrations was observed in As intoxicated group as compared to the control group.

4. Discussion

As(III) is a potent inducer of MT gene expression and it has high affinity for the thiol moiety of proteins, thus suggesting a high possibility of
binding of As ions to MT. Also, Ngu et al. (2008) have reported that the complexation of ba-rhMT1 with As(III) is stable in the pH range of 1–9
in vitro. For other heavy metals like Cd and Hg, where MT plays a key role in their detoxification, metal (Cd, Hg) bound MT has been observed
(Satoh et al., 1997; Klaassen et al., 2009). In contrast to this, from the PIXE and ESI–MS results of the present study, no MT1 molecules in
complexation with arsenic ions was observed in the isolated MT1 samples, even though the MT1 was induced by arsenic intoxica- tion.
Although, the single dose of sodium arsenite used was effective in producing the characteristics signs of acute arsenic toxicity like lowering of
the levels of GSH and reduced activities of GR and ALP as well as elevated levels of LPO and SOD activities (Ganger et al., 2016). In addition,
histopathological alterations in the liver of the animals from arsenic treated group were observed when compared to the control group (Ganger et
al., 2016). The selected dose of arsenic was effective in significantly enhancing the MT1 mRNA expression as compared to the control group
(Fig. 1) which is in accordance with the previous reports, thus, indicating direct binding of As to MTF 1 (Liu et al., 2009; He and Ma, 2009).
Moreover, it has also been reported that As(III) injection increased accumulation of MT protein and MT1 mRNA in liver (Albores et al., 1992).

In a previous study (Albores et al., 1992), the authors report the absence of As in the gel filtration fractions of rat liver cytosol, prepared 24 h after
As(III) injection (90 mmol per kg body weight), even though, the presence of Zn was observed. In another study using mice pre-supplemented
with Zn (Kreppel et al., 1994), Arsenic-73 was not observed in the gel filtration fractions of rat liver cytosol, prepared 2 h post Arsenic-73
injection. In contrast to atomic absorption spectrometry (AAS) used in both these studies, PIXE analysis being multi-elemental in nature provides
the information about elements other than arsenic as well which are bound to the MT. Presence of Zn and Cu ions in the isolated MT1 samples as
revealed by their PIXE analysis and the identification of moleculer ions of MT1 in complexation with Zn and Cu from ESI– MS analysis confirms
the integrity and purity of the isolated MT samples. Hence, it can be summarized that had there been any arsenic complexed MT molecule in the
rat liver would have been present in the purified protein sample and its signature would have

during PIXE experiments. Department of Science and Technology (DST), New Delhi, India and Sophisticated Analytical Instrumenta- tion
Facility (SAIF), Panjab University, Chandigarh, India are gratefully acknowledged for providing ESI–MS facility. This work is funded by
University Grant Commission (UGC), New Delhi, India. Roobee Garla and Renuka Ganger are thankful to UGC, New Delhi, India for providing
financial assistance in the form of Junior/Senior Research Fellowship. BPM thankfully acknowledge the financial assistance provided by Indian
Council Medical Research (ICMR), India in the form of Research Associateship.

References

Albores, A., Koropatnick, J., Cherian, M.G., Zelazowski, A.J., 1992. Arsenic induces and enhances rat hepatic metallothionein production in vivo. Chem. Biol.
Interact. 85, 127–140.

Balouria, P., Oswal, M., Kumar, S., Govil, I.M., Mohanty, B.P., Singh, S.P., Garg, M.L., 2011. PIXE analysis of blood samples of orthodontic patients to detect Ni
poisoning. Int. J PIXE 21, 95–100.

Bell, S.G., Vallee, B.L., 2009. The metallothionein/thionein system: an oxidoreductive metabolic zinc link. Chembiochem 10, 55–62.

Bergquist, E.R., Fischer, R.J., Sugden, K.D., Martin, B.D., 2009. Inhibition by methylated organo-arsenicals of the respiratory 2-oxo-acid dehydrogenases. J.
Organomet. Chem. 694, 973–980.

Campbell, J.L., Hopman, T.L., Maxwell, J.A., Nejedly, Z., 2000. The Guelph PIXE software package III: alternative proton database. Nucl. Instrum. Methods Phys.
Res. B 170, 193–204.

Chouchane, S., Snow, E.T., 2001. In vitro effect of arsenical compounds on glutathione-related enzymes. Chem. Res. Toxicol. 14, 517–522.

Del Razo, L.M., Quintanilla-Vega, B., Brambila-Colombres, E., Calderón-Aranda, E.S., Manno, M., Albores, A., 2001. Stress proteins induced by arsenic. Toxicol.
Appl. Pharmacol. 177, 132–148.

Feng, W., Benz, F.W., Cai, J., Pierce, W.M., Kang, Y.J., 2006. Metallothionein disulfides are present in metallothionein-overexpressing transgenic mouse heart and
increase under conditions of oxidative stress. J. Biol. Chem. 281, 681–687.

First Report Committee on Estimates (Sixteenth Lok Sabha), 2014. Occurrence of high arsenic content in ground water. Lok Sabha Secretariat, New Delhi. Flora, S.J.,
2011. Arsenic-induced oxidative stress and its reversibility. Free. Radic.

Biol. Med. 51, 257–281.

Ganger, R., Garla, R., Mohanty, B.P., Bansal, M.P., Garg, M.L., 2016. Protective effects of

zinc against acute arsenic toxicity by regulating antioxidant defense system and

cumulative metallothionein expression. Biol. Trace Elem. Res. 169, 218–229. Garla, R., Mohanty, B.P., Ganger, R., Sudarshan, M., Bansal, M.P., Garg, M.L., 2013.
Metal stoichiometry of isolated and arsenic substituted metallothionein: PIXE

and ESI–MS study. Biometals 26, 887–896.

Hajivaliei, M., Garg, M.L., Handa, D.K., Govil, K.L., Kakavand, T., Vijayan, V., Singh, K.P.,

Govil, I.M., 1999. PIXE analysis of ancient Indian coins. Nucl. Instrum. Methods

Phys. Res. B 150, 645–650.

Haq, F., Mahoney, M., Koropatnick, J., 2003. Signaling events for metallothionein

induction. Mutat. Res. 533, 211–226.

He, X., Ma, Q., 2009. Induction of metallothionein I by arsenic via metal-activated

transcription factor 1: critical role of C-terminal cysteine residues in arsenic

sensing. J. Biol. Chem. 284, 12609–12621.

International Agency for Research on Cancer (IARC), 2012. Monographs on the

evaluation of the carcinogenic risks to humans. Arsenic, Metals and Fibers;

Volume 100C Arsenic and Arsenic Compounds, Lyon, France, pp. 41–93. Irvine, G.W., Summers, K.L., Stillman, M.J., 2013. Cysteine accessibility during As 3+

metalation of the a-and b-domains of recombinant human MT1a. Biochem.

Biophy. Res. Commun. 433, 477–483.

Jiang, G., Gong, Z., Li, X.F., Cullen, W.R., Le, X.C., 2003. Interaction of trivalent

arsenicals with metallothionein. Chem. Res. Toxicol. 16, 873–880.

Kala, S.V., Neely, M.W., Kala, G., Prater, C.I., Atwood, D.W., Rice, J.S., Lieberman, M.W.,

2000. The MRP2/cMOAT transporter and arsenic-glutathione complex formation are required for biliary excretion of arsenic. J. Biol. Chem. 275, 33404– 33408.

Kitchin, K.T., 2001. Recent advances in arsenic carcinogenesis: modes of action, animal model systems, and methylated arsenic metabolites. Toxicol. Appl.
Pharmacol. 172, 249–261.

Klaassen, C.D., Liu, J., Diwan, B.A., 2009. Metallothionein protection of cadmium toxicity. Toxicol. Appl. Pharmacol. 238, 215–220.

Kreppel, H., Liu, J., Liu, Y., Reichl, F.X., Klaassen, C.D., 1994. Zinc-induced arsenite tolerance in mice. Fundam. Appl. Toxicol. 23, 32–37.

Liu, J., Liu, Y., Goyer, R.A., Achanzar, W., Waalkes, M.P., 2000. Metallothionein-I/II null mice are more sensitive than wild-type mice to the hepatotoxic and
nephrotoxic effects of chronic oral or injected inorganic arsenicals. Toxicol. Sci. 55, 460–467.

Liu, J., Cheng, M.L., Yang, Q., Shan, K.R., Shen, J., Zhou, Y., Zhang, X., Dill, A.L., Waalkes, M.P., 2007. Blood metallothionein transcript as a biomarker for metal
sensitivity: low blood metallothionein transcripts in arsenicosis patients from Guizhou, China. Environ. Health Perspect. 115, 1101–1106.

Liu, J., Zhou, Z.X., Zhang, W., Bell, M.W., Waalkes, M.P., 2009. Changes in hepatic gene expression in response to hepatoprotective levels of zinc. Liver Int. 29,
1222– 1229.

Maret, W., Vallee, B.L., 1998. Thiolate ligands in metallothionein confer redox activity on zinc clusters. Proc. Natl. Acad. Sci. U. S. A. 95, 3478–3482.

Maret, W., 2011. Metals on the move: zinc ions in cellular regulation and in the coordination dynamics of zinc proteins. Biometals 24, 411–418.

Merrifield, M.E., Ngu, T.T., Stillman, M.J., 2004. Arsenic binding to Fucus vesiculosus metallothionein. Biochem. Biophys. Res. Commun. 324, 127–132.

Ngu, T.T., Stillman, M.J., 2006. Arsenic binding to human metallothionein. J. Am. Chem. Soc. 128, 12473–12483.

Ngu, T.T., Easton, A., Stillman, M.J., 2008. Kinetic analysis of arsenic-metalation of human metallothionein: significance of the two-domain structure. J. Am. Chem.
Soc. 130, 17016–17028.

Park, J.D., Liu, Y., Klaassen, C.D., 2001. Protective effect of metallothionein against the toxicity of cadmium and other metals. Toxicology 163, 93–100.

Puri, N.K., Balouria, P., Govil, I.M., Mohanty, B.P., Garg, M.L., 2006. Development of regional PIXE facility at Panjab University cyclotron, Chandigarh (India). Int.
J. PIXE 16, 7–20.

Rahman, M.T., De Ley, M., 2016. Arsenic Induction of Metallothionein and Metallothionein Induction Against Arsenic Cytotoxicity. DOI: 10.1007/ 398_2016_2.

Rey, N.A., Howarth, O.W., Pereira-Maia, E.C., 2004. Equilibrium characterization of the As(III)-cysteine and the As(III)-glutathione systems in aqueous solution. J.
Inorgan. Biochem. 98, 1151–1159.

Satoh, M., Nishimura, N., Kanayama, Y., Naganuma, A., Suzuki, T., Tohyama, C., 1997. Enhanced renal toxicity by inorganic mercury in metallothionein-null mice.
J. Pharm. Exp. Ther. 283, 1529–1533.
Shen, S., Li, X.F., Cullen, W.R., Weinfeld, M., Le, X.C., 2013. Arsenic binding to proteins. Chem. Rev. 113, 7769–7792.

Snow, E.T., Hu, Y., Yan, C.C., Chouchane, S., 1999. Modulation of DNA repair and glutathione levels in human keratinocytes by micromolar arsenite. In: Chappell,
W.R., Abernathy, C.O., Calderon, R.L. (Eds.), Arsenic Exposure and Health Effects. Elsevier, Oxford, UK, pp. 243.

Styblo, M., Serves, S.V., Cullen, W.R., Thomas, D.J., 1997. Comparative inhibition of yeast glutathione reductase by arsenicals and arsenothiols. Chem. Res. Toxicol.
10, 27–33.

Suzuki, Y., Yoshikawa, H., 1976. Induction of hepatic zinc-binding proteins of rats by various metals. Ind. Health 14, 25–31.

Toyama, M., Yamashita, M., Hirayama, N., Murooka, Y., 2002. Interactions of arsenic with human metallothionein-2. Biochemistry 132, 217–221.

Tseng, C.H., Tai, T.Y., Chong, C.K., Tseng, C.P., Lai, M.S., Lin, B.J., Chiou, H.Y., Hsueh, Y. M., Hsu, K.H., Chen, C.J., 2000. Long-term arsenic exposure and
incidence of non-insulin-dependent diabetes mellitus: a cohort study in arseniasis- hyperendemic villages in Taiwan. Environ. Health Perspect. 108, 847–851.

Tseng, W.P., 1977. Effects and dose-response relationships of skin cancer and blackfoot disease with arsenic. Environ. Health Perspect. 19, 109–119.

Tseng, C.H., 2009. A review on environmental factors regulating arsenic methylation in humans. Toxicol. Appl. Pharmacol. 235, 338–350.

Waalkes, M.P., Harvey, M.J., Klaassen, C.D., 1984. Relative in vitro affinity of hepatic metallothionein for metals. Toxicol. Lett. 20, 33–39.

Wang, C.H., Hsiao, C.K., Chen, C.L., Hsu, L.I., Chiou, H.Y., Chen, S.Y., Hsueh, Y.M., Wu, M.M., Chen, C.J., 2007a. A review of the epidemiologic literature on the
role of environmental arsenic exposure and cardiovascular diseases. Toxicol. Appl. Pharmacol. 222, 315–326.

Wang, Z., Zhang, H., Li, X.F., Le, X.C., 2007b. Study of interactions between arsenicals and thioredoxins (human and E. coli) using mass spectrometry. Rapid
Commun. Mass Spectrom. 21, 3658–3666.

R. Garla et al. / Toxicology 366 (2016) 68–73 73