BACTERIOLOGY OF LEPROSY
INTRODUCTION
Leprosy is an ancient, clinically well-
recognized disease. Though leprosy
was known to the mankind as a
contagious disease since olden times,
nothing was known about its causative
agent till mid-nineteenth century. The
coincidental development of
microscopy and the emergence of
“germ theory” favored the young
Norwegian physician GHA Hansen to
demonstrate, in 1873 by microscopy,
the presence of rod-shaped bodies in
unstained preparation of nodular lesions
from leprosy patients.1 Though
Danielssen, in 1847, came across globi,
solid and beaded rods, coccoid forms,
etc., both within and outside of the cells
in leprosy lesions, but because of his
strong faith in the hereditary nature of
the disease, he failed to associate his
findings with cause of the disease.2
Although it was one of the first
organisms demonstrated by
microscopy, it has not yet been possible
to cultivate it in vitro, in an artificial
media, till today.
In 1960, Charles C Shepard
Demonstrated a limited growth of
Mycobacterium leprae in the footpad of
mouse.3 This landmark discovery
proved to be a major contribution as it
made possible the screening of drugs,
assessment of their efficacy and
detection of drug-resistant strains.
Mouse footpad experiments paved a
way for understanding many biological
properties of M. leprae. Further, RJW
Rees showed enhanced growth of M.
leprae in the footpad of
thymectomized-irradiated (nude) mice
in the year 1966.4
BAKTERIOLOGI LEPRA
PENDAHULUAN
Lepra adalah penyakit kuno yang
mudah dikenali. Walaupun lepra
diketahui sebagai penyakit menular
sejak dulu, tidak ada yang diketahui
mengenai agen kausatifnya sampai
pertengahan abad ke-19. Perkembangan
mikroskop dan pentingnya “germ
theory” membantu dokter-dokter muda
Noerwegia untuk menunjukkan—pada
tahun 1873 dengan mikroskop—adanya
badan berbentuk batang dalam preparat
tidak berwarna dari lesi nodul pasien
lepra.1 Walaupun pada tahun 1847
Danielssen memperkenalkan batang
padat berbentuk globus dan kokus baik
di dalam dan di luar sel lesi lepra,
namun karena keyakinan kuatnya pada
sifat herediter penyakit ini, ia gagal
membuktikan hubungan temuannya
dengan penyakit ini.2 Walaupun
organisme ini merupakan yang pertama
ditunjukkan melalui mikroskop, adalah
hal yang belum mungkin untuk
mengembangkan mikroorganisme ini
secara in vitro dalam media buatan
sampai sekarang.
Tahun 1960, Charles C Shepard
menunjukkan pertumbuhan terbatas
Mycobacterium leprae pada telapak
kaki tikus.3 Hal ini membuktikan
kontribusi utama yang memungkinkan
penapisan obat, penilaian kemanjuran
dan deteksi strain resisten obat.
Eksperimen telapak kaki tikus
mendirikan jalan untuk memahami
banyak sifat biologi M.leprae.
Kemudian, RJW Rees menunjukkan
peningkatan pertumbuhan M.leprae
pada telapak kaki mencit nude pada
tahun 1966.4

In 1971, Kirchheimer and Storrs
demonstrated unlimited multiplication
of M. leprae in nine-banded armadillo
(a Southern American rodent).5
Subsequently, in 1976, Draper
developed a procedure for the
purification of M. leprae from
armadillo tissues.6 This made available
a large number of M. leprae for the
immunological and molecular
biological studies carried out in the
present era. Many attempts have been
made to cultivate M. leprae in vitro but
all of them turned futile and, as such,
no artificial medium is available as yet
for the in vitro cultivation of M. leprae.
Following the genome sequencing of
M. tuberculosis, the genome
sequencing of M. leprae was completed
in 2000, by Cole, which enabled us to
understand its biology in more detail.
M. leprae has undergone a reductive
evolutionary process through adaptation
to its intracellular parasitic lifestyle.
Comparative analysis of the genome
sequences with M. tuberculosis
established that gene deletion and decay
in M. leprae have resulted in the
formation of 1,116 nonfunctional
pseudogenes, resulting in an
elimination of many key metabolic
activities of M. leprae.7 Thus, M.
leprae barely maintains its existence
with a minimal gene set.8
MYCOBACTERIA
These are a group of bacteria, initially
thought to be a fungus (myco =
fungus), well known for their unique
character of acid-fastness. These
bacteria do not stain readily, but once
Pada tahun 1971, Kirchheimer dan
Storrs menunjukkan multiplikasi tidak
terbatas M.leprae pada armadillo
berpita sembilan (hewan pengerat
Amerika Selatan).5 Kemudian, tahun
1976, Draper mengembangkan
prosedur pemurnian M.leprae dari
jaringan armadillo.6 Hal ini
menghasilkan sejumlah besar M.leprae
untuk penelitian imunologis dan biologi
molekuler pada era tersebut. Banyak
usaha yang telah dibuat untuk
menumbuhkan bakteri ini secara in
vitro namun gagal dan belum ada media
buatan yang tersedia untuk
menumbuhkannya.
Setelah sekuens genom M.tuberculosis,
sekuens genom M.leprae dirampungkan
pada tahun 2000 oleh Cole, yang
memungkinkan kita untuk memahami
biologi bakteri ini dengan lebih rinci.
M.leprae telah menjalani proses
evolusioner melalui adaptasinya
terhadap gaya hidup parasitik intrasel.
Analisis komparatif dari sekuens
genom dengan M.tuberculosis
menegaskan bahwa delesi gen pada
M.leprae menghasilkan pembentukan
1,116 pseudogen nonfungsional, yang
menghasilkan eliminasi banyaknya
aktivitas metabolik kunci pada
M.leprae.7 Karenanya, M.leprae sulit
mempertahankan eksistensinya dengan
rangkaian gen minimal.8
MIKOBAKTERIA
Mikobakteria adalah sekelompok
bakteri yang awalnya disangka
semacam jamur, yang diketahui
memiliki sifat unik yaitu tahan asam.
Bakteri ini sulit diwarnai, namun ketika
stained, resist the decolorization with
acid/alcohol. Hence, they are called as
acid-fast bacteria (AFB). The acid-
fastness is due to the presence of a
chemical in the cell wall called
“mycolic acid”. Amongst different
species of mycobacteria some are
pathogenic, e.g. M. tuberculosis, M.
leprae, M. marinum, M. scrofulaceum,
etc.; and some are saprophytic
(nonpathogens), e.g. M. fortuitum,
Mycobacterium w (now renamed after
complete genomic sequencing as M.
Indicus pranii), etc. Some of the
mycobacteria are fast growers in vitro
and some are slow growers. M. leprae
is physiogenetically placed somewhere
in between M. tuberculosis and M.
aviumintracellular-scrofulaceum
(MAIS) complex.
Mycobacterium leprae
It is a rod-shaped bacterium, measuring
1–8 microns in length and 0.3 microns
in diameter, with parallel sides and
rounded ends. It is strongly acid-fast
when stained by Ziehl-Neelsen method.
In skin smears towards the
(immunocompromized) lepromatous
(LL) end of the disease spectrum, M.
leprae are predominantly found in
clumps or globi within the macrophages
(lepra cells). Inside these cells M.
leprae multiply unrestricted, which may
contain hundreds of bacilli arranged in
parallel arrays, placed side by side by
the presence of surface lipids (glial
substances) suggesting “bundle of
cigars”. Globi are characteristically
seen in the smears of borderline
lepromatous (BL) and LL patients.
These are spherical conglomeration of
rods, presenting in unusually
symmetrical circumference, the wet
diwarnai, ia mampu bertahan dari
dekolorisasi oleh asam/alkohol.
Karenanya, bakteri ini disebut bakteri
tahan asam (BTA). Ketahanan ini
diakibatkan adanya zat kimia di dinding
selnya yang disebut ‘asam mikolat’. Di
antara spesies mikobakteria yang
berbeda, beberapa di antaranya adalah
patogenik, yaitu M.tuberculosis,
M.leprae, M.marinum, M.scrofulaceum,
dll; dan beberapa bersifat saprofitik,
misalnya M.fortuitum, Mycobacterium
w (sekarang dinamai ulang setelah
sekuens genomik lengkap, yaitu
M.indicus pranii), dll. Beberapa
mikobakteria cepat tumbuh secara in
vitro dan beberapa dapat tumbuh
dengan lambat. M.leprae secara
fisiogenetis bertempat di antara
M.tuberculosis dan kompleks M.avium-
intracellular-scrofulaceum (MAIS).
Mycobacterium leprae
Bakteri ini berbentuk batang dan
berukuran 1-8 mikron (panjang) dan 0.3
mikron (diameter) dengan sisi paralel
dan ujung membulat. Bakteri ini tahan
asam ketika diwarnai dengan metode
Ziehl-Nielsen. Dalam apusan kulit
melalui spektrum LL, M.leprae
umumnya ditemukan dalam bentuk
gumpalan atau globi dalam makrofag
(Sel lepra). Di dalam sel ini, bakteri
tersebut bermultiplikasi tanpa
terkendali, yang mungkin mengandung
ratusan basil yang tersusun secara
paralel, sisi ke sisi dengan adanya
permukaan lipid (substansi glia) yang
disebut ‘bundle of cigars’. Globi adalah
ciri khas yang terlihat dalam apusan
pasien BL dan LL. Bentuk ini adalah
konglomerasi sferis dari batang bakteri,
tergambar dalam lingkar simetris yang
tidak biasa, dan permukaan yang basah
menandakan membran dari bakteri,
mount reveals a membrane confining membentuk gambaran sferis ke dalam
the rods, giving a spherical shape to the gerombolan bakteri. Walaupun
cluster. Though it is thought to be the dianggap sebagai ciri khas lepra,
characteristic of leprosy, such fenomena ini dilaporkan terjadi pada
phenomenon is reported to be occurring spesimen yang terinfeksi M.avium dari
in M. Avium infected specimens from pasien AIDS. Hal ini akan
severely immune compromised mengimplikasikan bahwa fenomena
acquired immunodeficiency syndrome globus bermanifestasi dalam situasi di
(AIDS) patients. This would imply that mana lingkungan diperlukan untuk
the globus phenomenon manifests in multiplikasi cepat, bebas dari
situations where the environment is mekanisme
favorable for a rapid multiplication, imunobakterisidal/bakteriostatis—
free of seperti lingkungan, dengan imunitas
immunobactericidal/bacteriostatic seluler kompromais imun seperti pada
mechanisms—such an environment, pasien LL dan AIDS.2
with deficient or immune compromised
cellular immunity as exists in LL
leprosy and AIDS patients.2

Cellular Morphology Morfologi Sel

M. leprae is a nonmotile, nonspore
forming, microaerophilic, acid-fast
staining bacterium that usually forms
slightly curved or straight rods.
Electron microscopy (EM) revealed the
details of the ultrastructure of M.
leprae, which is found to have the
following structures:
M.leprae adalah bakteri non-motil, non
spora, mikroaerofilik, dan tahan asam
yang biasanya berbentuk sedikit
melengkung atau berbentuk batang
lurus. Mikroskop elektron (ME)
memberikan detail ultrastruktur
M.leprae, yang ditemukan memiliki
struktur sebagai berikut:

Cell wall: This outer coat protects Dinding sel: Mantel luar ini melindungi
bacteria from environment and gives bakteri dari lingkungan dan
definite shape to the bacterial cell. It memberikan bentuk pasti dinding
has an inner electron-dense and an bakteri. Struktur ini memiliki bagian
outer electron-transparent layer. dalam yang kaya elektron dan bagian
luar yang merupakan lapisan
transparan.

The cell wall is a covalently linked Dinding sel secara kovalen

peptidoglycan-arabinogalacton-mycolic
acid complex; similar in composition to
all mycobacterial cell walls.8-10 The cell
wall in the core contains peptidoglycan,
composed of chains of alternating N-
acetylglucosamine and N-
menghubungkan kompleks
peptidoglikan-arabinogalakton-asam
mikolat; serupa dengan komposisi dari
semua dinding sel mikobakteri lain.8-10
Dinding sel dalam inti mengandung
peptidoglikan, terdiri dari rantai
glycolylmuramate linked by peptide
cross-bridges, which are linked to the
galactan layer by arabinogalactan.
Three branched chains of arabinan are
in turn linked to the galactan, forming
along with the peptidoglycan layer, an
electron-dense zone around M. leprae.
Mycolic acids are linked to the
terminals of arabinan chains to form the
inner leaflet of a pseudolipid bilayer.
The outer leaflet is composed of an
array of intercalating mycolic acids of
trehalose monomycolates (TMM) and
mycoserosoic acids of phthiocerol
dimycocerosates (PDIMs), as well as
phenolic glycolipids (PGLs), forming
the electron-transparent zone.
Phosphatidylinsitol mannosides and
phospholipids are released from the cell
wall after synthesis, forming a
capsulelike region. The dominant lipid
in the cell wall, which gives M. leprae
immunological specificity, is PGL-1.11
Recent studies suggest that PGL-1 is
involved in the interaction of M. leprae
with laminin of Schwann cells,
suggesting a role for PGL-1 in
peripheral nerve-bacillus interactions.12
Annotations of M. leprae genome and
comparative genomic studies with other
mycobacterial genomes have produced
insight into the putative genes needed
to direct the synthesis of this complex
cell wall biopolymer. Most of the genes
necessary to build the
peptidoglycanarabinogalactan-mycolate
polymer appear to be present in the M.
leprae genome and fit a reasonable
strategy for its construction (Fig. 6.1).13
alternatif N-asetilglukosamin dan N-
glikolimuramat yang dihubungkan oleh
jembatan silang peptida yang berkaitan
dengan lapisan galaktan oleh
arabinogalaktan. Tiga cabang rantai
arabinan berhubungan dengan galaktan,
membentuk lapisan peptidoglikan, dan
zona kaya elektron di sekitar M.leprae.
Asam mikolat berkaitan dengan ujung
rantai arabinan untuk membentuk
lapisan dalam dari dua lapisan
pseudolipid. Lembaran luar terdiri dari
asam mikolat dari trehalosa
monomikolat (TMM) dan asam
mikoserosoat dari phtioserol
dimikoserosat (PDIM) serta fenolat
glikolipid (PGL), membentuk zoka
elektron transparan. Fosfatidilinsitol
manosida dan fosfolipid dilepaskan dari
dinding sel setelah sintesis, membentuk
daerah seperti kapsul. Lipid yang
dominan dalam dindign sel, yang
memberikan spesifisitas imunologis
M.leprae, adalah PGL-1.11 Penelitian
baru menunjukkan bahwa PGL-1
terlibat dalam interaksi M.leprae
dengan laminin sel Schwann,
menandakan peran PGL-1 dalam
interaksi basil ke saraf perifer.12
Anotasi genom M. leprae dan studi
genom komparatif dengan genom
mikobakteri lainnya telah menghasilkan
wawasan ke dalam gen putatif yang
diperlukan untuk mengarahkan sintesis
biopolimer dinding sel kompleks ini.
Sebagian besar gen yang diperlukan
untuk membangun polimer
peptidoglikan-kanabinogalaktan-myolat
tampaknya ada dalam genom M. leprae
dan cocok dengan strategi yang masuk
akal untuk konstruksinya (Gbr. 6.1) .13
The plasma membrane is covered by a
cell wall core made of peptidoglycan
covalently linked to the galactan by a
linker unit of arabinogalactan. Three
branched chains of arabinan are in turn
linked to the galactan. Mycolic acids
are linked to the termini of the arabinan
chains to form the inner leaflet of a
pseudolipid bilayer. An outer leaflet is
formed by the mycolic acids of TMM
and mycocerosic acids of PDIMs and
PGLs-as shown. A capsule, presumably
composed largely of PGLs and other
molecules, such as PDIMs,
phosphatidylinositol mannosides and
phospholipids, surrounds the bacterium.
Lipoglycans, such as
phosphatidylinositol mannosides,
lipomannan (LM) and
lipoarabinomannan (LAM), known to
be anchored in the plasma membrane,
are also found in the capsular layer, as
shown in Figure 6.1.
Cell membrane: This structure seems to
contain proteins which control the
active and passive transport of
substances across, between inside and
outside of the cell. Enzymes
synthesizing the cell wall and capsular
lipids are also present. There is
evidence for the presence of
phospholipids, characteristic of
membrane of cultivable mycobacteria,
including members of
phosphatidylinositol mannosides
(PIM).14,15 Biochemical fractionation
studies identified two major
polypeptides—major membrane
protein-I (MMP-I) and major
membrane protein-II (MMP-II)—
associated with the cell membrane of
M. leprae.16 MMP-I is a 35 kDa protein
Membran plasma ditutupi oleh inti
dinding sel yang terbuat dari
peptidoglikan yang secara kovalen
dihubungkan ke galaktan oleh unit
penghubung arabinogalaktan. Tiga
rantai arabinan bercabang pada
gilirannya terkait dengan galaktan.
Asam mikolik terkait dengan termini
rantai arabinan untuk membentuk
selebaran bagian dalam bilayer
pseudolipid. Selebaran luar dibentuk
oleh asam mikolat dari TMM dan asam
mikokerosat dari PDIM dan PGL -
seperti yang ditunjukkan. Sebuah
kapsul, mungkin sebagian besar terdiri
dari PGL dan molekul lain, seperti
PDIM, fosfatidylinositol mannosida
dan fosfolipid, mengelilingi bakteri.
Lipoglikan, seperti phosphatidylinositol
mannosides, lipomannan (LM) dan
lipoarabinomannan (LAM), yang
dikenal berlabuh di membran plasma,
juga ditemukan di lapisan kapsuler,
seperti yang ditunjukkan pada Gambar
6.1.
Membran sel: Struktur ini tampaknya
mengandung protein yang mengontrol
transpor aktif dan pasif dari zat
melintasi, antara di dalam dan di luar
sel. Enzim mensintesis dinding sel dan
lipid kapsuler juga ada. Ada bukti untuk
keberadaan fosfolipid, karakteristik
membran mikobakteri yang dapat
dibudidayakan, termasuk anggota
phosphatidylinositol mannosides
(PIM).14,15 Studi fraksinasi biokimiawi
mengidentifikasi dua polipeptida utama
— protein membran utama-I (MMP-I)
dan protein membran utama. -II (MMP-
II) - terkait dengan membran sel M.
leprae.16 MMP-I adalah protein 35 kDa
yang diidentifikasi secara independen
sebagai komponen aktif serologis yang
dikenali oleh antibodi monoklonal
independently identified as a
serologically active component
recognized by murine monoclonal
antibodies specific to M. leprae.17 A
study by Triccas dkk. with r35 kDa
antigen indicated proliferative response
predominantly from paucibacillary (PB)
leprosy patients and healthy contacts of
leprosy.18 The gene encoding for M.
leprae 35 kDa has been identified,
isolated and characterized.19 It was
further shown that 35 kDa protein has
no homologue within the M.
tuberculosis complex, but it has a
homologue in M. avium. MMP-II was
originally identified from M. leprae as a
major native protein and was
recognized to be identical to
mycobacterial bacterioferritin. MMP-II
protein has a large molecular mass of
380 kDa, which has a feroxidase-center
residue and was conserved among M.
leprae, M. tuberculosis and M. avium.
The homology at the amino acid level is
about 86% among them.
Cytoplasm: Earlier studies of
fractionation by sodium dodecyl
sulphate (SDS)-polyacrylamide gel
electrophoresis revealed the presence of
three major proteins in cytoplasmic
extracts of M. leprae.16 They were
found to be a doublet at 28 kDa, a
second one with a molecular weight of
17 kDa and the third corresponded to
GroES heat shock protein found also in
cell wall fractions. Studies on the
protein composition of M. leprae based
on serological techniques resulted in
identification of another component;
with 65 kDa antigen appearing
particularly prominent.20 A 65 kDa
protein (identified as the M. leprae
homologue of the GroEL heat shock
protein)21 is generally found in an
murine khusus untuk M. leprae.17
Sebuah studi oleh Triccas dkk. dengan
antigen r35 kDa menunjukkan respons
proliferatif terutama dari pasien lepra
paucibacillary (PB) dan kontak sehat
lepra.18 Pengkodean gen untuk M.
leprae 35 kDa telah diidentifikasi,
diisolasi dan dikarakterisasi.19 Lebih
lanjut diperlihatkan bahwa protein 35
kDa tidak memiliki homolog dalam
kompleks M. tuberculosis, tetapi
memiliki homolog dalam M. avium.
MMP-II pada awalnya diidentifikasi
dari M. leprae sebagai protein asli
utama dan diakui identik dengan
bakteriobritritin mikobakteri. Protein
MMP-II memiliki massa molekul besar
380 kDa, yang memiliki residu pusat
feroxidase dan disimpan di antara M.
leprae, M. tuberculosis dan M. avium.
Homologi pada tingkat asam amino
adalah sekitar 86% di antara mereka.
Sitoplasma: Penelitian sebelumnya
tentang fraksinasi oleh natrium dodecyl
sulphate (SDS)-polyacrylamide gel
electrophoresis mengungkapkan
adanya tiga protein utama dalam
ekstrak sitoplasma M. leprae. berat
se17 kDa dan yang ketiga berhubungan
dengan protein heat shock GroES yang
juga ditemukan di fraksi dinding sel.
Studi tentang komposisi protein M.
leprae berdasarkan teknik serologis
menghasilkan identifikasi komponen
lain; dengan antigen 65 kDa yang
tampak sangat menonjol.20 Protein 65
kDa (diidentifikasi sebagai homolog M.
leprae dari protein heat shock GroEL)21
umumnya ditemukan dalam bentuk
terdegradasi secara luas dalam
preparasi M. leprae. Protein dengan
extensively degraded form in M. leprae
preparations. Proteins with a molecular
mass of 10–12 kDa from M. leprae and
M. tuberculosis were originally found
to carry separate species-specific
epitopes identified with monoclonal
antibodies. An analysis of their
sequence showed 90% identity between
M. leprae and M. tuberculosis and 44%
homology with the GroES heat shock
protein of Escherichia coli.22 The
protein induced a strong delayed-type
hypersensitivity and threonine 1 (Th1)
cytokine production. Monoclonal
antibody studies have also identified an
18 kDa protein which is structurally
related to a loosely conserved family of
low molecular weight heat shock
proteins.23
Capsule: Electron microscopy
confirmed the observation of capsule
around M. leprae in tissues by light
microscopy. It contains bacterial lipid
found to be in large amounts in infected
tissues. The two main bacterial lipids
present are (1) Phthiocerol
dimycocerosate, a highly apolar
substance, which seems to have a
purely passive protective function, (2)
Phenolic glycolipid 1, a specific
glycolipid for M. leprae found to be
active serologically.24 The PGL-1 is
found in abundance in infected tissue
(armadillo liver and skin of LL patient).
M. leprae secretes this glycolipid
locally and may constitute the
characteristic foamy appearance seen
within the macrophages of LL patients.
PGL-1 is highly immunogenic,
generating immunoglobulin M (IgM)
class of Ig, demonstrable in 60% of
tuberculoid (TT) and 90% of LL
patients. Enzyme linked
immunosorbent assay (ELISA) test to
massa molekul 10-12 kDa dari M.
leprae dan M. tuberculosis awalnya
ditemukan membawa epitop spesifik
spesies yang terpisah yang
diidentifikasi dengan antibodi
monoklonal. Analisis urutan mereka
menunjukkan 90% identitas antara M.
leprae dan M. tuberculosis dan 44%
homologi dengan protein peredam
panas GroES dari Escherichia coli.22
Protein menginduksi hipersensitivitas
tipe lambat yang kuat dan produksi
sitokin threonine 1 (Th1). Studi
antibodi monoklonal juga telah
mengidentifikasi protein 18 kDa yang
secara struktural terkait dengan
keluarga yang dilestarikan secara
longgar dari protein heat shock berat
molekul rendah.
Kapsul: Mikroskop elektron
mengkonfirmasi pengamatan kapsul di
sekitar M. leprae dalam jaringan
dengan mikroskop cahaya. Ini
mengandung lipid bakteri yang
ditemukan dalam jumlah besar di
jaringan yang terinfeksi. Dua lipid
bakteri utama yang ada adalah (1)
Phthiocerol dimycocerosate, zat yang
sangat apolar, yang tampaknya
memiliki fungsi perlindungan yang
murni pasif, (2) Glikolipid fenolik 1,
glikolipid spesifik untuk M. leprae
yang ditemukan aktif secara serologis.
PGL-1 ditemukan berlimpah di jaringan
yang terinfeksi (hati armadillo dan kulit
pasien LL). M. leprae mengeluarkan
glikolipid ini secara lokal dan dapat
membentuk penampilan berbusa khas
yang terlihat dalam makrofag pasien
LL. PGL-1 sangat imunogenik,
menghasilkan Ig kelas imunoglobulin
M (IgM), terbukti pada 60% pasien
tuberkuloid (TT) dan 90% pasien LL.
Tes Enzyme Linked Immunosorbent
detect the specific antibody (anti-PGL)
has been used as a serological test for
leprosy.
Solid Bacteria
M. leprae is a strong acid-fast
bacterium which appears bright pink on
Ziehl-Neelsen staining. In practice, in a
stained smear, M. leprae shows highly
polymorphic morphology. Few are
brightly and uniformly stained with
parallel sides, rounded ends, length
being five times the breadth, such
bacteria are called “solid bacteria”.
Mostly M. leprae in smear appears
irregularly stained and fragmented or
granular. Mouse foot pad experiments
have shown that the solid bacteria are
viable bacteria, whereas the
morphologically imperfect (fragmented
and granular) forms are usually
considered to be dead. This was even
cited by Hansen “As the bacilli at first
multiply in the cells, and the breaking
down appears most definitely and freely
when the cells are crammed full of
bacilli. It is equally possible that it is
the result of diminished nutrition, and
as they break down more rapidly in the
internal organs, it is also possible,
indeed probable, that the higher
temperature in these organs favors
disintegration. The transformation into
granules is considered as degeneration
and that the bacilli are altered dead”.25
Electron microscopic study further
confirmed that in case of irregularly
stained bacteria the contents of the
cytoplasm disappeared, were severely
distorted and the plasma membrane
incomplete. These findings are the basis
for the morphological index (MI),
which gives an idea of solid,
fragmented and granular forms in a
Assay (ELISA) untuk mendeteksi
antibodi spesifik (anti-PGL) telah
digunakan sebagai tes serologis untuk
lepra.
Bakteri Padat
M. leprae adalah bakteri tahan asam
yang kuat yang tampak merah muda
cerah pada pewarnaan Ziehl-Neelsen.
Dalam praktiknya, dengan apusan
bernoda, M. leprae menunjukkan
morfologi yang sangat polimorfik.
Beberapa diwarnai cerah dan seragam
dengan sisi paralel, ujung membulat,
panjangnya lima kali lebarnya, bakteri
seperti itu disebut "bakteri padat".
Sebagian besar M. leprae pada apusan
tampak bernoda tidak teratur dan
terfragmentasi atau granular.
Eksperimen alas kaki tikus telah
menunjukkan bahwa bakteri padat
adalah bakteri yang dapat hidup,
sedangkan bentuk morfologis yang
tidak sempurna (terfragmentasi dan
granular) biasanya dianggap mati. Ini
bahkan dikutip oleh Hansen “Sebagai
basil pada mulanya berkembang biak di
dalam sel, dan penguraiannya muncul
dengan sangat jelas dan bebas ketika
sel-sel penuh basil. Adalah mungkin
juga bahwa itu adalah hasil dari nutrisi
yang berkurang, dan karena mereka
memecah lebih cepat di organ-organ
internal, juga mungkin, memang
mungkin, bahwa suhu yang lebih tinggi
di organ-organ ini mendukung
disintegrasi. Transformasi menjadi
butiran dianggap sebagai degenerasi
dan bahwa basil diubah mati.”25 Studi
mikroskopis elektron lebih lanjut
menegaskan bahwa jika bakteri yang
tidak teratur ternoda, isi sitoplasma
menghilang, terdistorsi parah dan
membran plasma tidak lengkap.
Temuan ini adalah dasar untuk indeks
smear (Figs 6.2A1, A2 and B).
PYRIDINE EXTRACTION
M. leprae smears on treating with
pyridine, lose the ability to stain
subsequently with carbol fuchsin and
thereby appear nonacid fast. This
property of pyridine extraction is
considered unique for M. leprae.26
However, some nonleprosy
mycobacteria have been reported to
lose their acid fastness after pyridine
treatment and, also, not all the bacilli of
leprosy smears may lose the red stain.27
Nocardia recovered from LL showed
such characteristics. So this test may be
regarded as an optional confirmatory
test, provided the culture growth is
‘pure’; without any coexisting
cultivable mycobacteria.
CLINICAL SPECTRUM OF
LEPROSY
Leprosy exhibits a diverse
manifestation from a highly resistant
TT type to poorly resistant LL type.
Ridley and Jopling, in 1962, described
five overlapping groups of leprosy
based on the immunological status of
the patients. It extends from tuberculoid
type (TT) through, borderline
tuberculoid (BT), midborderline (BB),
borderline lepromatous (BL), to the
lepromatous type (LL).
The LL and TT are relatively stable and
the BL, BB and BT types are unstable.
morfologi (MI), yang memberikan
gagasan tentang bentuk padat,
terfragmentasi dan granular dalam
apusan (Gambar 6.2A1, A2 dan B).
EKSTRAKSI PIRIDIN
M. leprae dioleskan pada pengobatan
dengan piridin, kehilangan kemampuan
untuk pewarnaan selanjutnya dengan
carbol fuchsin dan dengan demikian
muncul cepat tanpa asam. Properti
ekstraksi piridin ini dianggap unik
untuk M. leprae.26
Namun, beberapa mikobakteri non-
lepra telah dilaporkan kehilangan
keasamanannya setelah pemberian
piridin dan, juga, tidak semua basil
apusan lepra dapat kehilangan noda
merah.27 Nocardia pulih dari LL
menunjukkan karakteristik seperti itu.
Jadi tes ini dapat dianggap sebagai tes
konfirmasi opsional, asalkan
pertumbuhan kultur adalah 'murni';
tanpa mikobakteri yang bisa ditanami
bersama.
SPEKTRUM KLINIS LEPRA
Lepra menunjukkan manifestasi yang
beragam dari tipe TT yang sangat
resisten ke tipe LL yang tidak tahan.
Ridley dan Jopling, pada tahun 1962,
menggambarkan lima kelompok lepra
yang tumpang tindih berdasarkan status
imunologis pasien. Ini meluas dari jenis
tuberculoid (TT) melalui, borderline
tuberculoid (BT), midborderline (BB),
borderline lepromatous (BL), ke tipe
lepromatosa (LL).
LL dan TT relatif stabil dan tipe BL,
BB dan BT tidak stabil. Dari jumlah
Of these, the BB type is more
inconsistent form and encountered less
often.28,29
The indeterminate leprosy patients do
not fall in the Ridley-Jopling spectrum
because of the unpredictable behavior
and lack of specific clinicohistological
features necessary for inclusion in the
spectrum.
IMMUNOLOGICAL PROPERTIES
OF M.LEPRAE
M. leprae induces both humoral and
cell-mediated immune responses. The
immunogenic components of M. leprae
include polysaccharides and proteins.
Polysaccharide components induce
mainly humoral immune response.
Proteins induce both humoral and cell-
mediated immune response. The
immunogens in M. leprae form two
distinct groups; cytoplasmic antigens
and antigens actively secreted from the
mycobacterial cell. A species specific
phenolic glycolipid PGL-1 has been
identified in M. leprae, which has
immunogenic properties.
The variety of M. leprae antigens
identified using monoclonal antibodies
include 18 kDa, 28 kDa, 7 kDa, 14
kDa, 36 kDa, 65 kDa and 70 kDa
antigens which could possibly express
immune response. The 65 kDa antigen
was the first M. leprae antigen to be
cloned and characterized.30
PATHOGENESIS OF M.LEPRAE
M. leprae is an obligate intracellular
parasite. It grows very slowly in vivo
and in vitro in macrophage cultures. In
tersebut, tipe BB adalah bentuk yang
lebih tidak konsisten dan jarang
ditemui.28,29
Pasien kusta yang tidak pasti tidak
termasuk dalam spektrum Ridley-
Jopling karena perilaku yang tidak
dapat diprediksi dan kurangnya fitur
klinis yang diperlukan untuk
dimasukkan dalam spektrum.
SIFAT IMUNOLOGIS M.LEPRAE
M. leprae menginduksi respons imun
yang diperantarai humoral dan yang
dimediasi sel. Komponen imunogenik
dari M. leprae termasuk polisakarida
dan protein. Komponen polisakarida
menginduksi terutama respon imun
humoral. Protein menginduksi respons
imun yang diperantarai humoral dan
yang dimediasi sel. Imunogen pada M.
leprae membentuk dua kelompok
berbeda; antigen sitoplasma dan antigen
aktif disekresikan dari sel mikobakteri.
Spesies spesifik glikolipid fenolik PGL-
1 telah diidentifikasi dalam M. leprae,
yang memiliki sifat imunogenik.
Variasi antigen M. leprae yang
diidentifikasi menggunakan antibodi
monoklonal meliputi 18 kDa, 28 kDa, 7
kDa, 14 kDa, 36 kDa, 36 kDa, 65 kDa,
dan 70 kDa yang dapat
mengekspresikan respons imun.
Antigen 65 kDa adalah antigen M.
leprae pertama yang dikloning dan
dikarakterisasi.30
PATOGENESIS M.LEPRAE
M. leprae adalah parasit intraseluler
obligat. Tumbuh sangat lambat in vivo
dan in vitro dalam kultur makrofag.
immunocompetent individuals, the
growth of M. leprae is arrested due to
effective cellular immunity. After
uptake of M. leprae in the macrophages
follows the intracellular multiplication,
some antigens of M. leprae are
processed and presented as peptides in
the groove of human leukocyte antigen
(HLA) class-II molecules on the
macrophage surface to induce T-cell
activation. The accumulation of an
increased number of T-lymphocytes
and simultaneous release of interleukins
from activated T-cells results in
macrophage activation. Thus, the
macrophages limit the further
multiplication or kill the intracellular
M. leprae.
In some individuals, M. leprae infection
leads to LL leprosy due to inefficient
cell-mediated immunity (CMI)
response. This immunodeficiency is
due to predisposing genetic factors and
extent of exposure to M. leprae; and is
highly specific. This specific
immunodeficiency persists even after
prolonged chemotherapy and it is,
therefore, considered to be responsible
for the increased risk of relapse or
reinfection in these patients.
METABOLISM OF M.LEPRAE
The microbiological interest of
understanding the metabolism of M.
leprae has been to formulate a special
medium that could support in vitro
growth of the bacilli; to learn more
about the intrinsic metabolic pathways
and to utilize them for developing
newer antileprosy drugs. Earlier works
of Rees and Young have portrayed
some information on the anabolic and
Pada individu yang imunokompeten,
pertumbuhan M. leprae ditahan karena
imunitas seluler yang efektif. Setelah
penyerapan M. leprae dalam makrofag
mengikuti perkalian intraseluler,
beberapa antigen M. leprae diproses
dan disajikan sebagai peptida dalam
alur molekul kelas-II antigen leukosit
manusia (HLA) pada permukaan
makrofag untuk menginduksi aktivasi
sel-T. Akumulasi peningkatan jumlah
limfosit T dan pelepasan interleukin
secara simultan dari sel-T teraktivasi
menghasilkan aktivasi makrofag.
Dengan demikian, makrofag membatasi
multiplikasi lebih lanjut atau
membunuh M. leprae intraseluler.
Pada beberapa individu, infeksi M.
leprae mengarah ke kusta LL karena
respon imunitas yang dimediasi sel
(CMI) yang tidak efisien. Defisiensi
imun ini disebabkan oleh faktor genetik
predisposisi dan tingkat paparan
terhadap M. leprae; dan sangat spesifik.
Defisiensi imun spesifik ini bertahan
bahkan setelah kemoterapi yang
berkepanjangan dan oleh karena itu,
dianggap bertanggung jawab atas
peningkatan risiko kekambuhan atau
infeksi ulang pada pasien ini.
METABOLISME M.LEPRAE
Minat mikrobiologis untuk memahami
metabolisme M. leprae adalah
merumuskan media khusus yang dapat
mendukung pertumbuhan basil secara
in vitro; untuk mempelajari lebih lanjut
tentang jalur metabolisme intrinsik dan
menggunakannya untuk
mengembangkan obat-obatan anti-
leprosy yang lebih baru. Karya-karya
Rees and Young sebelumnya telah
catabolic pathways needed for the
survival of the bacterium.31 However,
with the complete sequencing and
annotation of M. leprae genome, an
improved understanding of metabolic
capabilities of M. leprae now exists
(Box 6.1).32-34
Inspection of the 3.27 MB genome
sequence of M. leprae (of an armadillo-
derived Indian isolate of the leprosy
bacillus) identified 1,605 genes
encoding for proteins; and 50 genes for
stable ribonucleic acid (RNA) species.
Comparison with the genome sequence
of M. tuberculosis revealed an extreme
case of reductive evolution, since less
than half of the M. leprae genome
contains functional genes while
inactivated or pseudogenes are highly
abundant. The level of gene uplication
was approximately 34% and on
classification of the proteins into
families, the largest functional groups
were found to be involved in the
metabolism and modification of fatty
acids and polyketides, transport of
metabolites, cell envelope synthesis and
gene regulation.33
Annotation of the genome identified
genes showed that M. leprae has the
capacity to generate energy by
oxidizing glucose to pyruvate through
the Embden-Meyerhof-Parnas (EMP)
pathway. Acetyl-coenzyme A from
glycolysis enters the Krebs cycle
producing energy in the form of ATP.
In addition to using glycolysis for
energy production, these organisms rely
heavily upon lipid degradation and the
glyoxylate shunt for energy production.
menggambarkan beberapa informasi
tentang jalur anabolik dan katabolik
yang diperlukan untuk kelangsungan
hidup bakteri.31 Namun, dengan
pengurutan lengkap dan anotasi genom
M. leprae, pemahaman yang
ditingkatkan tentang kemampuan
metabolisme M. leprae sekarang ada
(Kotak 6.1).
Pemeriksaan sekuens genom 3,27 MB
M. leprae (dari isolat India yang
diturunkan armadillo dari basil kusta)
mengidentifikasi 1,605 gen yang
mengkode protein; dan 50 gen untuk
spesies asam ribonukleat (RNA) yang
stabil. Perbandingan dengan urutan
genom M. tuberculosis mengungkapkan
kasus ekstrem evolusi reduktif, karena
kurang dari setengah genom M. leprae
mengandung gen fungsional sementara
inaktivasi atau pseudogen sangat
berlimpah. Tingkat peningkatan gen
sekitar 34% dan pada klasifikasi protein
ke dalam keluarga, kelompok
fungsional terbesar ditemukan terlibat
dalam metabolisme dan modifikasi
asam lemak dan polyketide,
pengangkutan metabolit, sintesis
amplop sel dan regulasi gen.33
Penjelasan gen yang teridentifikasi
menunjukkan bahwa gen M. leprae
memiliki kapasitas untuk menghasilkan
energi dengan mengoksidasi glukosa
menjadi piruvat melalui jalur Embden-
Meyerhof-Parnas (EMP). Asetil-
koenzim A dari glikolisis memasuki
siklus produksi energi Krebs dalam
bentuk ATP. Selain menggunakan
glikolisis untuk produksi energi,
organisme ini sangat bergantung pada
degradasi lipid dan piringan glikoksilat
In this regard, M. leprae contains a full
complement of genes for beta oxidation
but compared to M. tuberculosis, very
few genes capable of lipolysis. Acetate
has been lost to M. leprae as a carbon
source, since only pseudogenes are
present for acetate kinase, phosphate
acetyltransferase and acetyl-coenzyme
A synthase.34
Overall, M. leprae has much fewer
enzymes involved in degradative
pathways for carbon and nitrogenous
compounds than M. tuberculosis. This
is reflected in the paucity of
oxidoreductases, oxygenases, and short-
chain alcohol dehydrogenases and their
probable regulatory genes. In addition,
other major problems associated with
metabolism of M. leprae are that the
bacilli have lost anaerobic and
microaerophilic electron transfer
systems; and that the aerobic
respiratory chain is severely curtailed,
making it impossible for M. leprae to
generate adenosine triphosphate (ATP)
from the oxidation of nicotinamide
adenine dinucleotide phosphate
(NADH). In contrast to the reduction in
catabolic pathways, the anabolic
capabilities of M. leprae appear
relatively unharmed. For example,
complete pathways are predicted for
synthesis of purines, pyrimidines, most
amino acids, nucleosides, nucleotides,
and most vitamins and cofactors. The
maintenance of these anabolic systems
suggests that the intracellular niche that
M. leprae has found for itself may not
contain these compounds or transport
systems.11
untuk produksi energi. Dalam hal ini,
M. leprae mengandung gen lengkap
untuk oksidasi beta tetapi dibandingkan
dengan M. tuberculosis, sangat sedikit
gen yang mampu melakukan lipolisis.
Asetat telah hilang dari M. leprae
sebagai sumber karbon, karena hanya
pseudogen yang ada untuk asetat
kinase, asetat pentransferase asetat dan
asetil-koenzim A sintase.34
Secara keseluruhan, M. leprae memiliki
lebih sedikit enzim yang terlibat dalam
jalur degradatif untuk karbon dan
senyawa nitrogen daripada M.
tuberculosis. Ini tercermin dalam
kekurangan oksidoreduktase,
oksigenase, dan alkohol dehidrogenase
rantai pendek dan kemungkinan gen
pengaturnya. Selain itu, masalah utama
lainnya yang terkait dengan
metabolisme M. leprae adalah bahwa
basil ini telah kehilangan sistem
transfer elektron anaerob dan
mikroaerofilik; dan bahwa rantai
pernapasan aerobik sangat dibatasi,
sehingga mustahil bagi M. leprae untuk
menghasilkan adenosin trifosfat (ATP)
dari oksidasi nikotinamid adenin
dinukleotida fosfat (NADH). Berbeda
dengan pengurangan jalur katabolik,
kemampuan anabolik M. leprae tampak
relatif normal. Misalnya, jalur lengkap
diperkirakan untuk sintesis purin,
pirimidin, sebagian besar asam amino,
nukleosida, nukleotida, dan sebagian
besar vitamin dan kofaktor.
Pemeliharaan sistem anabolik ini
menunjukkan bahwa ceruk intraseluler
yang ditemukan M. leprae untuk
dirinya sendiri mungkin tidak
mengandung senyawa ini atau sistem
transportasi.11
BIOLOGICAL PROPERTIES OF
M.LEPRAE
The understandings about the biological
properties of M.leprae have come from
the mouse footpad experiments.
Bacterial Growth and Cell Division
Growth
Despite repeated failures in achieving
in vitro cultivation of M. leprae by
various scientists over the last 125
years35 many investigators have
continued their attempts in growing M.
leprae in vitro.36 Many of such attempts
have been reported from India. Some of
them have reported the isolation of
coccoids and L-phase like forms36 and
repeated isolation of Nocardia like
organisms from leprosy lesions.37
Interestingly, in many of these in vitro
attempts, organisms belonging to MAIS
complex have also been isolated. It was
suggested that it could be due to the
fact that skin of leprosy patients is
colonized by the members of this
complex.38 However, M. leprae has
never been grown on artificial media
but maintained in axenic cultures in
what appears to be a stable metabolic
state for a few weeks.39
As a result, propagation of M. leprae
has been restricted to animal models,
including the armadillo40 and normal,
athymic and gene knockout mice.41
These systems have provided the basic
resources for genetic, metabolic and
antigenic studies of the bacillus.
Growth of M. leprae in mouse foot
pads also provides a tool for assessing
the viability of a preparation of bacteria
and testing the drug susceptibility of
SIFAT BIOLOGIS M.LEPRAE
Pemahaman mengenai sifat-sifat
biologis dari M.leprae diperoleh dari
berbagai penelitian dengan
menggunakan telapak kaki tikus.
Pertumbuhan Bakteri dan
Pembelahan Sel
Pertumbuhan
Meskipun berkali-kali gagal dalam
mencapai kultur in vitro M. leprae oleh
berbagai ilmuwan selama 125 tahun
terakhir35 banyak peneliti melanjutkan
upaya mereka dalam menumbuhkan M.
leprae in vitro.36 Banyak upaya
semacam itu telah dilaporkan dari
India. Beberapa dari mereka telah
melaporkan isolasi coccoid dan bentuk
seperti fase-L36 dan isolasi berulang
dari organisme seperti Nocardia dari
lesi kusta.37 Menariknya, dalam banyak
dari upaya in vitro ini, organisme yang
termasuk dalam kompleks MAIS juga
telah diisolasi. Disarankan bahwa itu
bisa disebabkan oleh fakta bahwa kulit
pasien kusta dijajah oleh anggota
kompleks ini.38 Namun, M. leprae tidak
pernah tumbuh pada media buatan
tetapi dipelihara dalam kultur axenic
dalam apa yang tampaknya stabil.
keadaan metabolisme selama beberapa
minggu.39
Akibatnya, perbanyakan M. leprae
telah dibatasi pada model hewan,
termasuk armadillo40 dan tikus knockout
gen normal, athymic dan gen.41 Sistem
ini telah menyediakan sumber daya
dasar untuk studi genetik, metabolisme,
dan antigenik basil. Pertumbuhan M.
leprae pada tapak kaki tikus juga
menyediakan alat untuk menilai
kelayakan persiapan bakteri dan
menguji kerentanan obat dari isolat
clinical isolates.39,42
Generation Time
It is the time taken by a bacterium to
divide into two cells. In case of M.
leprae the generation time during the
logarithmic multiplication is calculated
to be 11–13 days. Thus, M. leprae has a
slow rate of multiplication, in contrast
to M. tuberculosis, and other slow
growing cultivable mycobacteria which
have a generation time of 20 hours.
This may be the reason for the long
incubation period of leprosy. Reductive
evolution, gene decay and genome
downsizing all may explain the
unusually long generation time and
account for our inability to culture the
leprosy bacillus.33
Temperature for Optimum Growth
M. leprae has a preference for
temperature less than 37oC for its
optimal growth. Many studies showed
the optimum growth of M. leprae in
footpad at 27°–30oC.43 Clinical
evidence also shows that leprosy
predominantly involves skin, nasal
mucosa, peripheral nerves, where the
temperature is lesser than core body
temperature.
M. leprae causes a natural, systemic
infection in ninebanded armadillos
(Dasypus novemcinctus), whose core
body temperature is 33°–34°C. This
obligate pathogen has been shown to
maintain its metabolic activity in axenic
medium, cultured murine and human
macrophages and primary rat Schwann
cells for several weeks at 33°C, but
rapidly loses this activity at 37°C. A
possible explanation for the inability of
klinis.39,42
Waktu Generasi
Ini adalah waktu yang diambil oleh
bakteri untuk membelah menjadi dua
sel. Dalam kasus M. leprae, waktu
pembuatan selama penggandaan
logaritmik dihitung menjadi 11-13 hari.
Dengan demikian, M. leprae memiliki
tingkat multiplikasi yang lambat,
berbeda dengan M. tuberculosis, dan
mikobakteri lain yang tumbuh lambat
yang memiliki waktu pembuatan 20
jam. Ini mungkin menjadi alasan lama
inkubasi kusta. Evolusi reduktif,
pembusukan gen, dan perampingan gen
dapat menjelaskan waktu generasi yang
lama dan menjelaskan ketidakmampuan
kita untuk menumbuhkan basil kusta.33
Suhu Pertumbuhan Optimal
M. leprae memiliki preferensi untuk
suhu kurang dari 37oC untuk
pertumbuhan optimal. Banyak
penelitian menunjukkan pertumbuhan
optimal M. leprae di kaki tikus pada 27
° -30oC.43 Bukti klinis juga
menunjukkan bahwa kusta terutama
melibatkan kulit, mukosa hidung, saraf
perifer, di mana suhunya lebih rendah
daripada suhu tubuh inti.
M. leprae menyebabkan infeksi
sistemik alami pada armadillo
ninebanded (Dasypus novemcinctus),
yang suhu tubuh intinya adalah 33°-34
°C. Patogen obligat ini telah terbukti
mempertahankan aktivitas
metaboliknya dalam medium aksenic,
murine yang dikultur, dan makrofag
manusia serta sel Schwann tikus primer
selama beberapa minggu pada suhu
33°C, tetapi dengan cepat kehilangan
M. leprae to survive at elevated
temperatures is that it is unable to
mount a protective heat stress
response.44
Minimum Infective Dose
Mouse foot pad experiments show that
the minimum infective dose ranges
from 1–10 solidly staining (viable)
bacteria.45
Viability and Stability
M. leprae retains its viability at 4oC in
biopsies or tissue suspensions for 7–10
days. In dried nasal discharges viability
is maintained for 7 days at 20.6oC and
43.7% humidity.46 They can remain
dormant in the host tissues. M. leprae in
skin of dead armadillo was observed to
live up to 3 weeks and in soils of their
dwellings up to 5 weeks.47 M. leprae
remains viable for up to 5 months,
particularly under humid atmospheric
conditions; even 3 hours a day exposure
to sunlight for 7 days could not kill the
bacteria and at 26.7oC and 77.6%
humidity, they could survive for 14
days.48 So, it is clear that large numbers
of viable bacteria are being
continuously discharged from active LL
patients and with the stability in the
outside environment, act as a potential
source of infection. M. leprae can be
preserved in laboratories by
cryopreservation in liquid nitrogen (at –
190°C) for indefinite period of time.
Even on passage from one mouse foot
pad to another over a period of many
years, the pathogenicity of M. leprae is
unaltered. Also M. leprae, isolated from
disseminated infection of armadillo or
immunodeficient mice; and inoculated
aktivitas ini pada suhu 37°C. Penjelasan
yang mungkin untuk ketidakmampuan
M. leprae untuk bertahan hidup pada
suhu tinggi adalah bahwa ia tidak dapat
memasang respons tekanan panas
pelindung.
Dosis Infektif Minimal
Eksperimen telapak kaki tikus
menunjukkan bahwa dosis infektif
minimal berkisar dari 1-10 bakteri
pewarnaan yang solid.45
Viabilitas dan Stabilitas
M. leprae mempertahankan
viabilitasnya pada suhu 4oC dalam
biopsi atau suspensi jaringan selama 7-
10 hari. Pada pengeringan hidung,
viabilitas dipertahankan selama 7 hari
pada 20,6oC dan 43,7% kelembaban.46
Mereka dapat tetap aktif di jaringan
inang. M. leprae di kulit armadillo mati
diamati hidup hingga 3 minggu dan di
tanah tempat tinggal mereka hingga 5
minggu.47 M. leprae tetap dapat hidup
hingga 5 bulan, terutama di bawah
kondisi atmosfer yang lembab; bahkan
paparan sinar matahari selama 3 jam
sehari selama 7 hari tidak dapat
membunuh bakteri dan pada suhu
26,7oC dan kelembaban 77,6%, mereka
dapat bertahan selama 14 hari.48 Jadi,
jelaslah bahwa sejumlah besar bakteri
yang hidup terus menerus dikeluarkan
dari aktif Pasien LL dan dengan
stabilitas di lingkungan luar, bertindak
sebagai sumber infeksi potensial. M.
leprae dapat disimpan di laboratorium
dengan kriopreservasi dalam nitrogen
cair (pada -190°C) untuk periode waktu
yang tidak terbatas. Bahkan pada
perjalanan dari satu kaki tikus ke kaki
lainnya selama bertahun-tahun,
patogenisitas M. leprae tidak berubah.
into the immunocompetent adult
mouse, have shown the usual
characteristics of limited growth in
footpad.
Strain Variations in M.leprae
Advances in molecular typing will
make it feasible not only to study the
global and geographical distribution of
distinct clones of M. leprae, but also to
explore correlation between the M.
leprae and the type of disease
manifested, and provide insight into
historical and phylogenetic evolution of
the bacillus.49
Whole genome sequencing of M. leprae
revealed tandem repeats scattered
through the genome either in intragenic,
intergenic regions within pseudogenes
that could be potential markers for
genotyping M. leprae. Short tandem
repeats (STR) are patterns of two or
more nucleotides, which are repeated in
the genome and are placed adjacent to
each other. STR based polymorphisms
have been used as a powerful typing
tool for differentiating several
organisms.50-52 These STR vary in copy
number creating polymorphism of
variable length.
Variable numbers of tandem repeats
(VNTR) are tandem repeats sequence
repeated multiple times, which vary in
copy number in different strains
creating variable length
polymorphisms. Primers flanking the
Juga M. leprae yang terisolasi dari
infeksi armadillo atau tikus; dan
diinokulasi ke tikus dewasa yang
imunokompeten, telah menunjukkan
karakteristik umum pertumbuhan
terbatas pada tapak kaki.
Variasi Strain M.leprae
Kemajuan dalam molekuler akan
memungkinkan untuk mempelajari
tidak hanya distribusi global dan
geografis dari klon M. leprae yang
berbeda, tetapi juga untuk
mengeksplorasi korelasi antara M.
leprae dan jenis penyakit yang
dimanifestasikan, dan memberikan
wawasan tentang evolusi historis dan
filogenetik dari bacillus.49
Sekuensing genom lengkap dari M.
leprae mengungkapkan pengulangan
tandem yang tersebar melalui genom
baik intragenik, intergenik dalam
pseudogen yang bisa menjadi penanda
potensial untuk genotipe M. leprae.
Pengulangan tandem pendek (STR)
adalah pola dua atau lebih nukleotida,
yang diulang dalam genom dan
ditempatkan berdekatan satu sama lain.
Polimorfisme berbasis STR telah
digunakan sebagai alat pengetikan yang
kuat untuk membedakan beberapa
organisme.50-52 STR ini bervariasi
dalam jumlah salinan yang
menghasilkan polimorfisme dengan
panjang variabel.
Jumlah variabel pengulangan tandem
(VNTR) adalah urutan pengulangan
tandem yang diulang beberapa kali,
yang bervariasi dalam jumlah salinan
dalam strain yang berbeda yang
menghasilkan polimorfisme panjang
variable region can be designed for
amplification and sequencing.
A single nucleotide polymorphism
(SNP) is a change or variation in a
single nucleotide (A, T, G, C) of the
deoxyribonucleic acid (DNA). This
change occurs during DNA replication
and is used as evolutionary marker.
SNPs, which have revealed a global
pattern of distinct types of M. leprae
strains (SNP types 1–4), have been
identified. Monot dkk.,49 in their study
observed the SNP frequency of M.
leprae to be as 1 per 28 kb indicating
the well conserved and highly clonal
nature of the bacteria. SNP typing may
assist in understanding important
factors, such as disease susceptibility,
location of real loci in the bacteria and
the epidemiology of the disease.
To determine suitability of VNTRs for
differentiating M. leprae, Truman
dkk.53 examined PCR systems to
amplify five distinct VNTR loci and
elucidated their applicability for
molecular typing using 12 M. leprae
strains derived from patients, as well as
from armadillos and mangabey
monkey. They found reproducible
diversity at four VNTR loci. Namely,
alleles for the GAA VNTR varied in
copy number from 10–16, those for AT
varied in copy number from 10–16,
those for GTA varied in copy number
from 9–12 and those for TA varied
from copy number 13–20. In contrast,
no variation was observed for CG
VNTR.
yang bervariasi. Primer yang mengapit
wilayah variabel dapat dirancang untuk
amplifikasi dan pengurutan.
Polimorfisme nukleotida tunggal (SNP)
adalah perubahan atau variasi dalam
nukleotida tunggal (A, T, G, C) dari
asam deoksiribonukleat (DNA).
Perubahan ini terjadi selama replikasi
DNA dan digunakan sebagai penanda
evolusi. SNP, yang telah mengungkap
pola global dari tipe strain M. leprae
(SNP tipe 1-4), telah diidentifikasi.
Monot dkk.,49 dalam penelitian mereka
mengamati frekuensi SNP M. leprae
adalah 1 per 28 kb yang
mengindikasikan sifat bakteri yang
sangat terkonservasi dan sangat klonal.
Pengetikan SNP dapat membantu
dalam memahami faktor-faktor penting,
seperti kerentanan penyakit, lokasi
lokus nyata dalam bakteri dan
epidemiologi penyakit.
Untuk menentukan kesesuaian VNTR
untuk membedakan M. leprae, Truman
dkk.53 memeriksa sistem PCR untuk
memperkuat lima lokus VNTR yang
berbeda dan menjelaskan penerapannya
untuk pengetikan molekuler
menggunakan 12 galur M. leprae yang
berasal dari pasien, serta dari armadillo
dan monyet mangabey . Mereka
menemukan keragaman yang dapat
direproduksi di empat lokus VNTR.
Yaitu, alel untuk GAA VNTR
bervariasi dalam jumlah salinan dari
10-16, yang untuk AT bervariasi dalam
jumlah salinan dari 10-16, yang untuk
GTA bervariasi dalam jumlah salinan
dari 9-12 dan yang untuk TA bervariasi
dari jumlah salinan 13-20 . Sebaliknya,
tidak ada variasi yang diamati untuk
CG VNTR.
 Baru-baru ini, metode yang dapat
Recently, the method that can be used digunakan untuk mengetik isolat M.
to type M. leprae isolates by the use of leprae dengan menggunakan 16 lokus
16 VNTR loci, and as few as 10 cells as VNTR, dan sedikitnya 10 sel sebagai
the starting material, has been bahan awal, telah dikembangkan dan
developed and validated, which largely divalidasi, yang sebagian besar
meets the need for an inexpensive memenuhi kebutuhan akan metode
54
typing method. There are several pengetikan yang murah.54 Ada beberapa
reasons why VNTR typing is superior alasan mengapa pengetikan VNTR
to SNP typing for investigating the lebih unggul dari pengetikan SNP untuk
epidemiology of M. leprae. First, menyelidiki epidemiologi M. leprae.
VNTR loci evolve much faster than Pertama, lokus VNTR berkembang jauh
SNPs, with the consequence being that lebih cepat daripada SNP, dengan
VNTR typing reveals considerably konsekuensinya adalah mengetik
more genetic heterogeneity than VNTR mengungkapkan heterogenitas
examination of an equivalent number of genetik yang jauh lebih banyak
SNPs. For instance, in their survey of daripada pemeriksaan SNP dalam
400 M. leprae strains using 84 jumlah yang setara. Misalnya, dalam
55
informative SNP sites, Monot dkk., survei mereka terhadap 400 strain M.
identified only 16 unique SNP types, leprae menggunakan 84 situs SNP
whereas Hall56 identified 465 strains, informatif, Monot dkk., 55 hanya
which included 417 unique VNTR mengidentifikasi 16 tipe SNP yang
types. The availability of complete M. unik, sedangkan Hall56
leprae genome sequences has permitted mengidentifikasi 465 strain, yang
the identification of over 50 potentially mencakup 417 tipe VNTR unik.
useful VNTR loci, from which a panel Ketersediaan sekuens genom M. leprae
of 16 was characterized in great yang lengkap telah memungkinkan
54
detail. identifikasi lebih dari 50 lokus VNTR
yang bermanfaat, yang darinya panel 16
ditandai dengan sangat detail.54

Sampai saat ini, 16 lokus VNTR telah

To date, those 16 VNTR loci have been
used in six independent survey studies
in Brazil, China, Colombia, India, the
Philippines and Thailand.57-62 However,
because the data were reported
independently, there has been no
analysis of the results taken as a whole.
To take it forward, Barry dkk.56
attempted to provide a comprehensive
analysis of the relationships among the
strains in order to investigate the
digunakan dalam enam studi survei
independen di Brasil, Cina, Kolombia,
India, Filipina, dan Thailand.57-62
Namun, karena data dilaporkan secara
independen, belum ada analisis hasil
yang diambil secara keseluruhan. Untuk
meneruskannya, Barry dkk.56 berusaha
memberikan analisis komprehensif
tentang hubungan antar strain untuk
menyelidiki pola penularan dan migrasi
M. leprae. Karena analisis filogenetik
patterns of transmission and migration
of M. leprae. Since phylogenetic
analysis found to be inadequate, Barry
dkk.56 have developed an alternative
method, i.e., structure-neighbor
clustering, which assigns isolates with
the most similar genotypes to the same
groups and, subsequently, subgroups,
without inferring how the strains
descended from a common ancestor, by
using simulated data and detecting
expected epidemiological relationships
from experimental data.
Their results suggest that most M.
leprae strains from a given country
cluster together and that the occasional
isolates assigned to different clusters
are a consequence of migration.
Further, they reported three genetically
distinguishable populations among
isolates from the Philippines, as well as
evidence for the significant influx of
strains to that nation from India. It is
suggested that the reference strain TN
originated from the Philippines and not
from India, as was previously believed.
Further evidences are required to
qualify their findings.
Recent studies on strain typing of M.
leprae based on VNTR and SNP typing
from different countries reported
distinct genotypes. In China, a study
conducted in Guangdong province of
China, by Li dkk.,63 on M. leprae
isolates collected from both local cases
and emigrant cases, showed that most
isolates from local patients belong to
SNP type 1, and SNP type 3 isolates
were found in a small part of local
isolates. However, all the emigrants
ditemukan tidak memadai, Barry dkk.56
telah mengembangkan metode
alternatif, yaitu pengelompokan
struktur-tetangga, yang menetapkan
isolat dengan genotipe yang paling
mirip dengan kelompok yang sama dan,
kemudian, subkelompok, tanpa
menyimpulkan bagaimana turunan
turun. dari nenek moyang yang sama,
dengan menggunakan data simulasi dan
mendeteksi hubungan epidemiologis
yang diharapkan dari data eksperimen.
Hasil mereka menunjukkan bahwa
sebagian besar strain M.leprae dari
kelompok negara tertentu bersama-
sama dan bahwa isolat sesekali
ditugaskan ke kelompok berbeda adalah
konsekuensi dari migrasi. Selanjutnya,
mereka melaporkan tiga populasi yang
dapat dibedakan secara genetik di
antara isolat dari Filipina, serta bukti
untuk masuknya strain yang signifikan
ke negara tersebut dari India.
Disarankan bahwa referensi strain TN
berasal dari Filipina dan bukan dari
India, seperti yang diyakini
sebelumnya. Bukti lebih lanjut
diperlukan untuk memenuhi syarat
temuan mereka.
Studi terbaru tentang mengetik strain
M. leprae berdasarkan VNTR dan SNP
dari negara yang berbeda melaporkan
genotipe yang berbeda. Di Cina, sebuah
penelitian yang dilakukan di provinsi
Guangdong Cina, oleh Li dkk.,63
tentang isolat M. leprae yang
dikumpulkan dari kedua kasus lokal
dan kasus emigran, menunjukkan
bahwa sebagian besar isolat dari pasien
lokal termasuk SNP tipe 1, dan SNP
tipe 3 isolat ditemukan di sebagian
kecil isolat lokal. Namun, semua
belong to SNP type 3—whether it was
SNP type 1 or SNP type 3 from
Guangdong local isolates, their VNTR
profiles are close and the main
differences are in the alleles at ML-1,
(TA)10 and (GGT)5. They
hypothesized that the transmission of
strain with SNP type 1 is associated
with Silk Road on the Sea and required
to confirm whether the transmission of
patients with SNP type 3 in Guangdong
are from the second transmission of the
emigrant patients.
In a similar study carried out in China
by Weng dkk.,64 it was observed that
VNTR linked strains are of type 1 in
Guangdong, Fujian and Guangxi in
Southern China. Second, a subset of
VNTR distinguishable strains of type 3
coexists in these provinces. Although
majority of the Guangdong strains are
of SNP type 1 or a version of SNP type
3 seen in neighboring Jiangxi and
Guangxi, six out of 22 strains diverged.
Third, type 3 strains with rpoT VNTR
allele of four, detected in Japan and
Korea were discovered in Jiangsu and
Anhui in the East and in Western
Sichuan bordering Tibet. Fourth,
considering the overall genetic
diversity, strains of endemic countries
of Qiubei, Yunnan; Xing Yi, Guizhou
and across Sichuan in Southwest were
related. However, closer inspection
showed distinct local strains and
clusters. The authors concluded that
altogether, these insights, primarily
derived from VNTR typing reveal
multiple and rather overlooked paths
for spread of leprosy into, within and
out of China, and invoke attention to
historic maritime routes in the South
and East China Sea.
emigran milik SNP tipe 3 — apakah itu
SNP tipe 1 atau SNP tipe 3 dari isolat
lokal Guangdong, profil VNTR mereka
dekat dan perbedaan utama ada pada
alel pada ML-1, (TA) 10 dan ( GGT) 5.
Mereka berhipotesis bahwa penularan
strain dengan SNP tipe 1 dikaitkan
dengan Silk Road on the Sea dan
diperlukan untuk mengkonfirmasi
apakah penularan pasien dengan SNP
tipe 3 di Guangdong berasal dari
transmisi kedua pasien emigran.
Dalam studi serupa yang dilakukan di
Cina oleh Weng dkk.,64 diamati bahwa
strain yang terhubung VNTR adalah
tipe 1 di Guangdong, Fujian dan
Guangxi di Cina Selatan. Kedua, subset
dari strain VNTR yang dapat dibedakan
dari tipe 3 yang hidup berdampingan di
provinsi-provinsi ini. Meskipun
sebagian besar strain Guangdong
adalah SNP tipe 1 atau versi SNP tipe 3
terlihat di tetangga Jiangxi dan
Guangxi, enam dari 22 strain berbeda.
Ketiga, galur tipe 3 dengan alel VNTR
dari empat rpoT, terdeteksi di Jepang
dan Korea ditemukan di Jiangsu dan
Anhui di Timur dan di Sichuan Barat
yang berbatasan dengan Tibet.
Keempat, mempertimbangkan
keragaman genetik secara keseluruhan,
jenis negara endemis Qiubei, Yunnan;
Xing Yi, Guizhou dan lintas Sichuan di
Barat Daya saling berhubungan.
Namun, inspeksi lebih dekat
menunjukkan strain lokal dan cluster.
Para penulis menyimpulkan bahwa
secara keseluruhan, wawasan ini,
terutama yang berasal dari pengetikan
VNTR mengungkapkan banyak jalur
yang agak diabaikan untuk penyebaran
kusta ke, di dalam dan di luar Cina, dan
menarik perhatian pada rute bersejarah
maritim di Laut Cina Selatan dan
 Timur.

Di India, Turankar dkk.65 melakukan

65
In India, Turankar dkk. conducted pengetikan molekuler berbasis
SNP based molecular typing of M. M.leprae dari keluarga multicase dan
leprae from multicase families and their sekitarnya untuk memahami penularan
surroundings to understand kusta, menggunakan slit-smear dan
transmission of leprosy, using slit- sampel tanah, yang dikumpulkan dari
smear and soil samples, collected from daerah endemik tinggi di Purulia,
a high endemic area in Purulia, West Bengal Barat, India . Pengetikan SNP
Bengal, India. SNP typing of M. leprae dari M. leprae dari semua subyek
from all rlep PCR positive subjects positif PCR rlep menunjukkan SNP tipe
showed SNP type 1 genotype, from the 1, dari sampel slit-smear dan tanah
studied slit-smear and soil samples. yang diteliti. Subtipe sampel
Subtyping of the samples showed menunjukkan subtipe D. Penelitian ini
subtype D. This study put forward that mengemukakan bahwa kontak yang
either the contacts were infected by the terinfeksi oleh pasien atau kedua pasien
patients or both patients and contacts dan kontak memiliki sumber infeksi
had the same source of infection. It also yang sama. Ini juga mengungkapkan
revealed that the M. leprae type in the bahwa jenis M. leprae di tanah di
soil in the inhabitant areas where daerah tempat tinggal pasien tempat
patients resided were of the same type tinggalnya memiliki jenis yang sama
as found in the patients. seperti yang ditemukan pada pasien.

Di Afrika Barat, Busso dkk., 66

In West Africa, Busso dkk.,66
performed SNP genotyping in samples
as part of the sentinel surveillance for
drug resistance network, carried out in
Mali and Benin. All the strains studied
were classified as SNP type 4, the most
common in West Africa, 33 of these
type 4 strains were subtyped N (78%),
five (12%) were O and four (10%)
belong to the P subtype.
melakukan SNP genotyping dalam
sampel sebagai bagian dari pengawasan
sentinel untuk jaringan resistensi obat,
yang dilakukan di Mali dan Benin.
Semua strain yang diteliti
diklasifikasikan sebagai SNP tipe 4,
yang paling umum di Afrika Barat, 33
dari tipe ini 4 subtipe N (78%), lima
(12%) adalah O dan empat (10%) milik
subtipe P.

Di Nepal, Thapa dkk.,67 telah

67
In Nepal, Thapa dkk., have done
molecular epidemiology investigation
on 220 patients diagnosed at
Anandaban Leprosy Hospital, Nepal. A
total of 22 VNTR loci including loci
with short (TA) arrays were added
melakukan penyelidikan epidemiologi
molekuler pada 220 pasien yang
didiagnosis di Rumah Sakit Kusta
Anandaban, Nepal. Sebanyak 22 lokus
VNTR termasuk lokus dengan susunan
pendek (TA) ditambahkan bersama
along with few novel minisatellites. A
recently developed non-DNA sequence
based, real-time PCR high resolution
melt analysis technique was used for
rapid SNP typing (as 1, 2, 3 or 4). In
Nepal, the major SNP types were 1 and
2. VNTR strain types with novel allele
combinations, not seen elsewhere, were
identified. The VNTR strain types were
highly resolved, although three major
subgroups could be detected. Several
loci, in particular (GGT) 5 and 21-3,
had characteristic alleles associated
with the SNP type 1 or 2. There was no
apparent association between the
proportion of SNP type 1 or 2 with
caste or location or gender or clinical
type.
EXPERIMENTAL ANIMAL
MODELS FOR M.LEPRAE
With the nonavailability of an artificial
media for in vitro growth of M . leprae,
cultivation of M. leprae in mouse foot-
pad and the inoculation of armadillos
with M. leprae still plays an important
role in understanding the biological
properties of M. leprae.5,68 Extensive
utilization of these two animal models
has made possible many of the
remarkable advances in recent years in
leprosy research.
Mouse
Immunocompetent Rodents
In 1960, Arthur C Shepard
demonstrated that M. leprae multiply to
a limited extent in the hind foot pads of
immunologically intact mice. The
observation on the manner of
multiplication of M. leprae in mouse
dengan beberapa minisatellit baru.
Teknik analisis lelehan PCR resolusi
tinggi berbasis non-DNA yang
dikembangkan baru-baru ini digunakan
untuk pengetikan SNP cepat (seperti 1,
2, 3 atau 4). Di Nepal, jenis SNP utama
adalah 1 dan 2. Jenis strain VNTR
dengan kombinasi alel baru, tidak
terlihat di tempat lain, diidentifikasi.
Jenis regangan VNTR sangat
terselesaikan, meskipun tiga
subkelompok utama dapat dideteksi.
Beberapa lokus, khususnya (GGT) 5
dan 21-3, memiliki alel karakteristik
yang terkait dengan SNP tipe 1 atau 2.
Tidak ada hubungan yang jelas antara
proporsi SNP tipe 1 atau 2 dengan kasta
atau lokasi atau jenis kelamin atau tipe
klinis.
MODEL HEWAN
EKSPERIMENTAL UNTUK
M.LEPRAE
Dengan tidak tersedianya media buatan
untuk pertumbuhan in vitro dari M.
leprae, budidaya M. leprae pada alas
kaki tikus dan inokulasi armadillo
dengan M. leprae masih memainkan
peran penting dalam memahami sifat
biologis M. leprae.5,68 Pemanfaatan
ekstensif kedua model hewan ini telah
memungkinkan banyak dari kemajuan
luar biasa dalam beberapa tahun
terakhir dalam penelitian kusta.
Tikus
Pengerat Imunokompeten
Pada tahun 1960, Arthur C Shepard
menunjukkan bahwa M. leprae
berkembang biak secara terbatas pada
bantalan kaki belakang tikus yang
secara imunologis utuh. Pengamatan
tentang cara multiplikasi M. leprae
pada alas kaki tikus menunjukkan pola
foot pads shows a characteristic pattern,
as elaborated below:
Lag phase: Lasting for 3–6 months after
inoculation, showing no multiplication
of M. leprae.
Logarithmic phase: Usually starts 6
months after inoculation, showing
active multiplication of M. leprae up to
105 per footpad.
Stationary phase: Usually after 12
months, showing no further
multiplication.
Experiments concluded that in an adult
immunocompetent mouse, an inoculum
size of less than 104 can be inoculated,
and once the multiplication reaches
more than 106, it starts acting as an
immunogen in the mouse, preventing
further multiplication of lepra bacilli.
Immunodeficient Mouse
In artificially immunosuppressed or
naturally immunodeficient
mice, after the inoculation of the size of multiplikasi M. leprae mencapai lebih
more than 105, the multiplication of M. dari 106 dan mereka juga menunjukkan
leprae reaches beyond 106 and they
also show prolonged survival and
grossly evident clinical lesion at the site inokulasi. Banyak model hewan yang
of inoculation.69 Many
immunosuppressed/immunodeficient
animal models have been studied. They dewasa iradiasi yang ditimektomi, tikus
are: Adult thymectomized-irradiated
mice, Nude mice, Other rodents
(Neonatally thymectomized rat,
Congenitally athymic rat).
OTHER EXPERIMENTAL
ANIMALS
Armadillo
Nine-banded armadillo (Dasypus
novemcinctus Linn.) found in Southern
United States was shown to develop LL
karakteristik, seperti diuraikan di bawah
ini:
Fase jeda: Berlangsung selama 3-6
bulan setelah inokulasi, tidak
menunjukkan multiplikasi M. leprae.
Fase logaritmik: Biasanya dimulai 6
bulan setelah inokulasi, menunjukkan
multiplikasi aktif M. leprae hingga 105
per kaki.
Fase diam: Biasanya setelah 12 bulan,
tidak menunjukkan multiplikasi lebih
lanjut.
Eksperimen menyimpulkan bahwa pada
tikus imunokompeten dewasa, ukuran
inokulum kurang dari 104 dapat
diinokulasi, dan begitu
penggandaannya mencapai lebih dari
106, ia mulai bertindak sebagai
imunogen pada tikus, mencegah
penggandaan basil lepra lebih lanjut.
Tikus Imunodefisiensi
Secara imunosupresi artifisial atau
defisiensi imun alami tikus, setelah
inokulasi dengan ukuran lebih dari 105,
kelangsungan hidup yang lama dan lesi
klinis yang sangat jelas di lokasi
mengalami imunosupresi /
imunodefisiensi telah dipelajari: tikus
telanjang, dan pengerat lainnya (tikus
timiektomi neonatal dan tikus atimik
kongenital).
HEWAN EKSPERIMENTAL
LAINNYA
Armadillo
Armadillo ninebanded (Dasypus
novemcinctus Linn.) yang ditemukan di
Amerika Serikat Selatan terbukti
mengalami kusta LL ketika terinfeksi
leprosy when experimentally infected
by Kirchheimer and Storrs in 1971.5 On
inoculation of 108 M. leprae
intravenously into armadillo, it
develops generalized progressive
disease with up to 1010 lepra bacilli/g of
tissue in liver, spleen and lymph nodes.
Non-Human Primates
Experimental inoculation was shown to
result in disseminated leprosy in
chimpanzees,70 white handed
gibbons,71 and rhesus monkeys.72
Sooty mangabey monkeys developed
extensive infiltration with clawing of
toes during the course of disease;73 and
African green monkeys developed
lesions of multibacillary (MB) leprosy
and polyneuritic leprosy within 4–6
months.72,74
DRUG RESISTANCE
Bacteriological proof of the emergence
of drug resistance strain of M. leprae as
a cause of relapse in treated patients
was dependent on the application of
mouse foot pad techniques. This
involves identifying multiplication of
bacteria in treated mice receiving diets
containing doses of the drug in excess
of the minimum effective dose (MED)
for the respective drug. The first
bacteriological proof of drug resistance
to diamino diphenyl sulphone (DDS)
was demonstrated when M. leprae from
three relapsed LL patients receiving
DDS were not inhibited from
multiplying in DDS treated mice at a
dose 1,000-fold above the MED for
DDS.75 The emergence of drug
resistance per se during treatment
(referred to as secondary drug
secara eksperimental oleh Kirchheimer
dan Storrs pada tahun 1971.5 Pada
inokulasi 108 M. leprae secara
intravena ke dalam armadillo, ia
mengembangkan penyakit progresif
umum hingga 1010 basil lepra/g
jaringan di hati, limpa dan kelenjar
getah bening.
Primata Non-Manusia
Inokulasi eksperimental terbukti
menghasilkan kusta disebarluaskan
pada simpanse, 70 owa bertangan putih,
71 dan monyet rhesus.72 Monyet kaktus
mangrove mengembangkan infiltrasi
luas dengan mencakar jari kaki selama
perjalanan penyakit;73 dan monyet hijau
Afrika mengembangkan lesi
multibasiler (MB) dan kusta
polineuritik dalam 4-6 bulan.72,74
RESISTENSI OBAT
Bukti bakteriologis tentang munculnya
jenis M. leprae yang resisten obat
sebagai penyebab kekambuhan pada
pasien yang diobati tergantung pada
penerapan teknik pada kaki tikus. Ini
melibatkan identifikasi multiplikasi
bakteri pada tikus yang menerima diet
yang mengandung dosis obat melebihi
dosis efektif minimum (MED) untuk
masing-masing obat. Bukti
bakteriologis pertama dari resistensi
obat terhadap diamino difenil sulfon
(DDS) ditunjukkan ketika M. leprae
dari tiga pasien LL yang kambuh yang
menerima DDS tidak mengalami
hambatan tumbuh pada tikus yang
diobati dengan DDS dengan dosis
1.000 kali lipat di atas MED untuk
DDS.75 Munculnya resistensi obat per
se selama pengobatan (disebut
resistensi obat sekunder) terbatas pada
resistance) is confined to MB leprosy.
This is due to the fact that the
frequency of drug-resistant mutants in a
bacterial population is never greater
than one per million bacteria; and the
bacterial population of this size is only
present in patients with MB leprosy.
Primary DDS resistance refers to the
patients who have never received DDS
but present with a DDS-resistant strain
of M. leprae. The first case of primary
DDS resistance was reported from
Ethiopia76 and has, since, been reported
from many countries around the world,
where secondary DDS resistance is
common.
Rifampicin, although a highly
bactericidal drug and being used in
leprosy since 1970, two Rifampicin-
resistant mutants had been reported by
1976.77 Later, Rifampicin resistance
was reported among 39 cases of relapse
by Grosset dkk. in 1989.78 Rifampicin-
resistant M. leprae appear to be single-
step mutants. All these earlier patients
had received monotherapy with
Rifampicin. Although DDS resistance,
along with Rifampicin resistance; has
been reported elsewhere, Rifampicin
resistance among patients receiving
multidrug therapy (MDT) has been
recently reported from India.79
However, a report from Southern India
demonstrated 19% of 265 M. leprae
isolates from biopsied samples of
leprosy patients resistant to Dapsone,
Rifampicin, or Clofazimine. All the
resistant strains reported in this study
had low rifampicin resistance (against
0.003% of rifampicin in diet).80
Resistance against clofazimine has been
reported in few studies.81-84 Resistance
against Ofloxacin has also been
kusta MB. Hal ini disebabkan oleh
fakta bahwa frekuensi mutan yang
resistan terhadap obat dalam populasi
bakteri tidak pernah lebih besar dari
satu per juta bakteri; dan populasi
bakteri dengan ukuran ini hanya ada
pada pasien dengan kusta MB.
Resistensi DDS primer mengacu pada
pasien yang tidak pernah menerima
DDS tetapi hadir dengan strain M.
leprae yang resisten terhadap DDS.
Kasus pertama resistensi DDS primer
dilaporkan dari Ethiopia76 dan, sejak
itu, telah dilaporkan dari banyak negara
di dunia, di mana resistensi DDS
sekunder adalah hal yang umum.
Rifampisin, meskipun obat yang sangat
bakterisidal dan digunakan dalam kusta
sejak tahun 1970, dua mutan yang
resistan terhadap rifampisin telah
dilaporkan pada tahun 1976.77
Kemudian, resistensi rifampisin
dilaporkan di antara 39 kasus kambuh
oleh Grosset dkk. pada tahun 1989.78
M. leprae yang resistan terhadap
rifampisin tampaknya merupakan
mutan satu langkah. Semua pasien
sebelumnya telah menerima monoterapi
dengan Rifampicin. Meskipun
resistensi DDS, bersama dengan
resistensi Rifampicin telah dilaporkan
di tempat lain, resistensi Rifampicin di
antara pasien yang menerima terapi
multidrug (MDT) baru-baru ini
dilaporkan dari India.79 Namun, sebuah
laporan dari India Selatan menunjukkan
19% dari 265 isolat M. leprae dari
sampel biopsi pasien kusta yang
resisten terhadap Dapsone, Rifampicin ,
atau Clofazimine. Semua strain resisten
yang dilaporkan dalam penelitian ini
memiliki resistansi rifampisin yang
rendah (terhadap 0,003% rifampisin
dalam makanan).80 Resistensi terhadap
reported in 1996.85
Molecular Mechanism of Drug
Resistance
Dapsone is a synthetic sulfone,
structurally and functionally related to dengan obat Sulfonamid dan
Sulfonamide drugs and targets
dihydropteroate synthase, a key enzyme enzim kunci dalam jalur biosintesis
in the folate biosynthesis pathway in
bacteria, by acting as a competitive
inhibitor of p-aminobenzoic acid.86,87
Dapsone has also been shown to target terbukti menargetkan jalur biosintesis
the folate biosynthetic pathway of M.
leprae.88
Specific mutations within the highly
conserved p-aminobenzoic acid binding
sites of Escherichia coli
dihydropteroate synthase, encoded by
folP gene, result in the development of
dapsone resistance.89 The new evidence
from the M. leprae genome sequencing
project has indicated that M. leprae
possesses two folP homologues (folP1
and folP2). Through surrogate genetic
studies with M. smegmatis, the
relationship between dapsone resistance
and the dihydropteroate synthase of M.
leprae has been established.90 Mis-
sense mutations within codons 53 and
55 of the sulfone resistance determining
region of folP1, result in the
development of high-level dapsone
resistance in M. leprae. Similar
observation has also been reported from
India.91
Rifampicin is the key bactericidal
component of all recommended
clofazimine telah dilaporkan dalam
beberapa penelitian.81-84 Resistansi
terhadap Ofloxacin juga telah
dilaporkan pada tahun 1996.85
Mekanisme Molekuler Resistensi
Obat
Dapson adalah sulfon sintetis, yang
terkait secara struktural dan fungsional
menargetkan dihidropteroat sintase,
folat pada bakteri, dengan bertindak
sebagai inhibitor kompetitif asam p-
aminobenzoat.86,87 Dapsone juga telah
folat dari M. leprae.88
Mutasi spesifik dalam situs pengikatan
asam p-aminobenzoat dari Escherichia
coli dihydropteroate synthase, yang
dikodekan oleh gen folP, menghasilkan
pengembangan resistensi dapson.89
Bukti baru dari proyek sekuensing
genom M. leprae telah
mengindikasikan bahwa M. leprae
memiliki dua homolog folP (folP1 dan
folP2). Melalui studi genetika
pengganti dengan M. smegmatis,
hubungan antara resistansi dapson dan
sintase dihidropteroat dari M. leprae
telah dibentuk.90 Mutasi yang tidak
masuk akal dalam kodon 53 dan 55 dari
resistansi sulfon menentukan daerah
folP1, menghasilkan pengembangan
resistensi dapson tingkat tinggi pada M.
leprae. Pengamatan serupa juga telah
dilaporkan dari India.91
Rifampisin adalah komponen
bakterisidal utama dari semua rejimen
kemoterapi yang direkomendasikan.
antileprosy chemotherapeutic regimens.
The target for Rifampicin in
mycobacteria and E. coli is the β-
subunit of the RNA polymerase,
encoded by rpoB.92-94 Comparison of
the deduced primary structure of β-
subunit proteins from several
mycobacteria to that of M. leprae
demonstrated that M. leprae shares six
highly conserved functional regions
common to this enzyme in
mycobacteria.
Mycobacterial resistance to Rifampicin
correlates with the changes in the
structure of the β-subunit of the DNA-
dependent RNA polymerase, primarily
due to mis-sense mutations within
codons of a highly conserved region of
the rpoB gene, referred to as the
Rifampicin resistance-determining
region.93-95 Rifampicin resistance in M.
leprae also correlates with mis-sense
mutations within this region of
rpoB.92,96 Substitutions within codon
Ser425 have been shown to be the most
frequent mutations associated with the
development of the rifampicin-resistant
phenotype in M. leprae.
Clofazimine is a substituted
iminophenazine with antimycobacterial
activity for which the mechanism has
not been fully elucidated.85 Clofazimine
attains high intracellular levels in
mononuclear phagocytic cells, its
metabolic elimination is slow, it has an
anti-inflammatory effect and the
incidence of resistance to it in M.
leprae is low. It is highly lipophilic and
appears to bind preferentially to
mycobacterial DNA. Binding of the
drug to DNA appears to occur
Target untuk Rifampicin dalam
mikobakteri dan E. coli adalah β-
subunit dari RNA polimerase,
disandikan oleh rpoB.92-94
Perbandingan struktur primer yang
disimpulkan dari protein-subunit β dari
beberapa mikobakteri dengan yang dari
M. leprae menunjukkan bahwa M
Leprae berbagi enam daerah fungsional
yang sangat kekal yang umum untuk
enzim ini pada mikobakteri.
Resistensi mikobakteri terhadap
Rifampicin berkorelasi dengan
perubahan struktur β-subunit RNA
polimerase yang bergantung pada
DNA, terutama karena mutasi yang
tidak masuk akal di dalam kodon dari
wilayah yang sangat lestari dari gen
rpoB, yang disebut sebagai resistensi
Rifampicin - menentukan daerah.93-95
Resistensi rifampisin pada M. leprae
juga berkorelasi dengan mutasi yang
tidak masuk akal dalam wilayah
rpoB.92,96 ini. Pergantian dalam kodon
Ser425 telah terbukti merupakan mutasi
yang paling sering dikaitkan dengan
pengembangan resistan terhadap
rifampisin. fenotip pada M. leprae.
Clofazimine adalah iminophenazine
yang tersubstitusi dengan aktivitas
antimikobakterial yang mekanismenya
belum sepenuhnya dijelaskan.85
Clofazimine mencapai level intraseluler
yang tinggi dalam sel fagositik
mononuklear, eliminasi metaboliknya
lambat, memiliki efek antiinflamasi dan
timbulnya resistensi terhadapnya dalam
M. leprae rendah. Ini sangat lipofilik
dan tampaknya mengikat istimewa
untuk DNA mikobakteri. Pengikatan
obat dengan DNA tampaknya terjadi
terutama pada sekuens dasar yang
principally at the base sequences
containing guanine, thus explaining the
preference of Clofazimine for the G+C-
rich genomes of mycobacteria over
human DNA. Lysophospholipids
appear to mediate the activity of
Clofazimine in some Gram-positive
bacteria.97 However, it is unclear
whether this mechanism of action is
operational in M. leprae. Since
Clofazimine may act through several
different mechanisms, it is not difficult
to understand why only a few cases of
Clofazimine-resistant leprosy have been
reported over the years.82-84
mengandung guanin, sehingga
menjelaskan preferensi Clofazimine
untuk genom mikobakteri G+C yang
kaya atas DNA manusia. Lisofosfolipid
tampaknya memediasi aktivitas
Clofazimine pada beberapa bakteri
Gram-positif.97 Namun, tidak jelas
apakah mekanisme aksi ini beroperasi
pada M. leprae. Karena Clofazimine
dapat bertindak melalui beberapa
mekanisme yang berbeda, tidak sulit
untuk memahami mengapa hanya
beberapa kasus kusta yang resisten
terhadap Clofazimine telah dilaporkan
selama bertahun-tahun.82-84

DIAGNOSIS LABORATORIUM
LABORATORY DIAGNOSIS OF LEPRA
LEPROSY Karena sebagian besar kasus kusta
Since majority of the cases of leprosy adalah PB di alam dan juga M. leprae
are PB in nature and also M. leprae is tidak dapat ditanami, diagnosis
not cultivable, the laboratory diagnosis laboratorium kusta dan penentuan
of leprosy and determination of the viabilitas M. leprae selalu menjadi
viability of M. leprae have always been tantangan. Selama bertahun-tahun,
a challenge. Over the years, with the dengan perkembangan teknologi,
developments in technology, many banyak upaya telah dilakukan untuk
attempts have been made to improvise mengimprovisasi satu teknik
one laboratory technique over the other. laboratorium dari yang lainnya. Ini
These include microscopic staining termasuk metode pewarnaan
methods, metabolic assays, radiolabeled mikroskopis, pengujian metabolik,
techniques, molecular methods, etc. teknik radiolabel, metode molekuler,
dll.

Slit-skin Smear
Laboratory investigations of leprosy
patients for diagnosis, classification and dan pemantauan kemoterapi secara
monitoring of chemotherapy have
traditionally been depending on slit-
skin smear examinations. Skin smear
examinations is carried out by slit-
scrape technique. The chosen skin site
is cleaned with cotton soaked in spirit
and allowed to dry. Next, the skin is
Apusat Kulit
Investigasi laboratorium terhadap
pasien kusta untuk diagnosis, klasifikasi
tradisional bergantung pada
pemeriksaan apusan kulit. Pemeriksaan
skin smear dilakukan dengan teknik
slit-scrape. Tempat kulit yang dipilih
dibersihkan dengan kapas yang
direndam dalam larutan dan dibiarkan
kering. Selanjutnya, kulit dicubit
pinched up into a fold between the
index finger and thumb, exerting
enough pressure to stop or minimize
bleeding. A clean cut, about 5 mm long
and deep enough (3 mm), to get into the
infiltrated layer of the dermis, is made
with a sterile scalpel. Then the blade of
the scalpel is turned through 90° and
using the blunt edge of the blade the
side of the cut is scraped two or three
times sufficiently, to obtain tissue pulp
from below the epidermis. This
material is then transferred from the tip
of the scalpel blade to a glass
microscopic slide, where it is spread in
a circular motion by the flat of the
blade to produce a uniform and
moderately thick smear over an area of
5–7 mm in diameter. Two to four
smears may be placed on a single slide
and carefully labeled. Then the smear is
stained by acidfast staining, preferably
undertaken at room temperature. The
smears are microscopically examined to
measure the bacterial load in the form
of bacteriological index (BI). This
method helps in the estimation of total
number of M. leprae, both viable and
dead, present in the sampled tissue. MI
is a method done for the estimation of
the proportion of viable M. leprae
amongst the bacterial population in a
patient.98 This investigation is less
sensitive as it requires a minimum 1 ×
104 to 3 × 104 AFB/mL.
Fluorescein Diacetate–Ethidium
Bromide Staining
Live cells can split fluorescein diacetate
(FDA) to fluoresce green, while dead
cells take the red ethidium bromide
menjadi lipatan antara jari telunjuk dan
ibu jari, memberikan tekanan yang
cukup untuk menghentikan atau
meminimalkan perdarahan. Potongan
bersih, panjang sekitar 5 mm dan cukup
dalam (3 mm), untuk masuk ke lapisan
dermis, dibuat dengan pisau bedah
steril. Kemudian bilah pisau bedah
diputar hingga 90° dan menggunakan
ujung pisau yang tumpul, sisi
potongannya dikerok dua atau tiga kali
secukupnya, untuk mendapatkan pulp
jaringan dari bawah epidermis. Bahan
ini kemudian dipindahkan dari ujung
bilah pisau bedah ke slide mikroskopis
kaca, di mana ia tersebar dalam gerakan
melingkar oleh rata bilah pisau untuk
menghasilkan corengan yang seragam
dan agak tebal di atas area dengan
diameter 5-7 mm. Dua hingga empat
noda dapat ditempatkan pada satu slide
dan diberi label dengan hati-hati.
Kemudian apusan diwarnai dengan
pewarnaan tahan asam yang dilakukan
pada suhu kamar. Apusan diperiksa
secara mikroskopis untuk mengukur
beban bakteri dalam bentuk indeks
bakteriologis (BI). Metode ini
membantu dalam estimasi jumlah total
M. leprae, baik yang hidup maupun
yang mati, yang ada dalam jaringan
sampel. MI adalah metode yang
dilakukan untuk memperkirakan
proporsi M. leprae yang layak di antara
populasi bakteri pada pasien.98
Investigasi ini kurang sensitif karena
memerlukan minimal 1×104 hingga
3×104 AFB / mL.
Pewarnaan Fluorescein Diacetate –
Ethidium Bromide
Sel-sel hidup dapat memecah
fluorescein diacetate (FDA) menjadi
hijau fluoresce, sementara sel-sel mati
mengambil pewarna ethidium bromide
(EB) stain. The proportion of stained
green cells by this staining method has
been observed to correlate with viable
populations in several eukaryotic and
prokaryotic cells. These techniques
have been standardized for
mycobacteria, including M . leprae, for
use in direct clinical specimens, as well
as for assessing the growth/viability in
macrophages. Their application to LL
leprosy patients shows that this
parameter is good for monitoring the
trends of chemotherapy responses. This
technique can, therefore, be used to
confirm relapse, provided sequential
samples are studied and statistical limits
defined. The persistence of green
staining signals for some time after
death, and lack of its applicability to
patients with PB leprosy are the main
limitations of this method.99
Determination of Bacillary
Adenosine Triphosphate Biomass
Estimation of ATP content has been
established as an important parameter
for determination of viable biomass of
different mammalian, other eukaryotic
and bacterial species. Techniques for
ATP assays for mycobacteria, including
M. leprae, have been developed. By
optimizing the techniques for extraction
and assay conditions, ATP assay has
been observed to detect even as low as
100 viable mycobacterial cells. This
technique has been successfully applied
to monitor the trends of responses to
chemotherapy, as well as to
demonstrate persisters.99
(EB) merah. Proporsi sel hijau yang
diwarnai dengan metode pewarnaan ini
telah diamati berkorelasi dengan
populasi yang layak di beberapa sel
eukariotik dan prokariotik. Teknik-
teknik ini telah distandarisasi untuk
mikobakteri, termasuk M. leprae, untuk
digunakan dalam spesimen klinis
langsung, serta untuk menilai
pertumbuhan / kelayakan dalam
makrofag. Aplikasi mereka untuk
pasien kusta LL menunjukkan bahwa
parameter ini baik untuk memantau tren
respons kemoterapi. Teknik ini, oleh
karena itu, dapat digunakan untuk
mengkonfirmasi kekambuhan, asalkan
sampel berurutan dipelajari dan batas
statistik ditentukan. Kegigihan sinyal
pewarnaan hijau untuk beberapa waktu
setelah kematian, dan kurangnya
penerapannya pada pasien dengan kusta
PB adalah keterbatasan utama dari
metode ini.99
Penentuan Biomassa Adenosine
Trifosfat Basiler
Estimasi konten ATP telah ditetapkan
sebagai parameter penting untuk
penentuan biomassa yang layak dari
berbagai mamalia, spesies eukariotik
dan bakteri lainnya. Teknik untuk
pemeriksaan ATP untuk mikobakteri,
termasuk M. leprae, telah
dikembangkan. Dengan
mengoptimalkan teknik untuk ekstraksi
dan kondisi pengujian, pengujian ATP
telah diamati untuk mendeteksi bahkan
hingga 100 sel mikobakteri yang layak.
Teknik ini telah berhasil diterapkan
untuk memantau tren tanggapan
terhadap kemoterapi.99

Assays Using Radiolabeled Substrate
Several in vitro methods based on
incorporation/utilization of various
substrates in cell free media conditions
have been published. These assays are
based on uptake of labeled dopamine
(DOPA), thymidine or incorporation of
14C palmitic acid into phenolic
glycolipid of M. leprae. The
measurement of oxidation of 14C-
palmitic acid to 14CO2 by M. leprae is
done using Buddemeyer type counting
system or BACTEC 400 system. These
assays have been reported to be useful
for drug sensitivity screening using
bacilli harvested from patients and
experimental animals.99
Molecular Identification by
Polymerase Chain Reaction
Rapid molecular assays for detection of
M. leprae directly from patient
specimen using available M. leprae
genetic data have been developed.
These assays have been based on the
amplification of M. leprae specific
DNA fragment. Many M. leprae genes
and sequences like hsp18, ag36, groEL,
16S ribonucleic RNA (rRNA), RLEP,
etc., have been targeted in the
development of polymerase chain
reaction (PCR). These techniques have
been applied not only in skin biopsy
samples but also to several different
specimen, like skin smear, nasal smear,
paraffin-embedded skin biopsy
samples, blood, nerve lesions, ocular
lesions, etc. RNA analysis using 16S
rRNA and reverse transcription PCR
has the added benefit of measuring
viability of M. leprae also. These PCR-
based and reverse transcription PCR-
Pengujian Menggunakan Media
Radiolabel
Beberapa metode in vitro berdasarkan
penggabungan/pemanfaatan berbagai
substrat dalam kondisi media bebas sel
telah dipublikasikan. Pengujian ini
didasarkan pada penggunaan berlabel
dopamin (DOPA), timidin atau
penggabungan asam palmitat 14C ke
dalam glikolipid fenolik dari M. leprae.
Pengukuran oksidasi asam 14C-
palmitat menjadi 14CO2 oleh M. leprae
dilakukan dengan menggunakan sistem
penghitungan tipe Buddemeyer atau
sistem BACTEC 400. Tes ini telah
dilaporkan bermanfaat untuk skrining
sensitivitas obat menggunakan basil
yang dipanen dari pasien dan hewan
percobaan.99
Identifikasi Molekul oleh Reaksi
Rantai Polimerase
Tes molekuler cepat untuk mendeteksi
M. leprae langsung dari spesimen
pasien menggunakan data genetik M.
leprae yang tersedia telah
dikembangkan. Pengujian ini
didasarkan pada amplifikasi fragmen
DNA spesifik M. leprae. Banyak gen
dan sekuens M. leprae seperti hsp18,
ag36, groEL, 16S ribonucleic RNA
(rRNA), RLEP, dll., Telah ditargetkan
dalam pengembangan reaksi rantai
polimerase (PCR). Teknik-teknik ini
telah diterapkan tidak hanya dalam
sampel biopsi kulit tetapi juga pada
beberapa spesimen yang berbeda,
seperti apusan kulit, apusan hidung,
sampel biopsi kulit yang disematkan
parafin, darah, lesi saraf, lesi okular,
dll. Analisis RNA menggunakan 16S
rRNA dan reverse transkripsi PCR juga
memiliki manfaat tambahan untuk
mengukur viabilitas M. leprae. Teknik-
teknik PCR berbasis dan reverse
based techniques have shown a
specificity of 100% and a sensitivity
ranging from 34–80% in PB form of
leprosy and greater than 90% in MB
form of leprosy.11
Newer Methods for Testing Viability
Recently, using the commercial kit
LIVE/DEAD Bact LightTM
combined with flow cytometry,
Guerrero dkk.,100 in Colombia have
attempted to assess the viability of M.
leprae in samples from MB patients
treated with MDT to obtain the cut-
point to distinguish nonviable versus
viable populations. The viable bacterial
population was observed to be different
between those treated with 12 doses
and 24 doses, favoring treatment of 24
months. Further, 56.7% patients after
24 months of treatment with WHO-
MDT had viable bacilli.
Based on the principle that real-time
PCR (RT-PCR) has the potential to
detect RNA, which indirectly indicates tidak langsung mengindikasikan status
the viability status of the organism,
Turankar dkk.,101 attempted to detect
viable bacilli from environmental
samples in the inhabitants area of active sampel lingkungan di daerah penghuni
leprosy cases, in endemic pockets of
Purulia, West Bengal, India. RT-PCR
for 16S rRNA gene was performed to
detect viable M. leprae, from samples
positive for rlep region of M. leprae
DNA. 48.6% of soil samples and 46.5% DNA M. leprae. 48,6% sampel tanah
water positive for M. leprae DNA
showed presence of viable bacilli.
Moist environment had higher presence layak. Lingkungan lembab memiliki
of viable bacilli, in comparison to dry
transkripsi ini telah menunjukkan
spesifisitas 100% dan sensitivitas
berkisar antara 34-80% dalam bentuk
kusta PB dan lebih besar dari 90%
dalam bentuk kusta MB.11
Metode Baru untuk Pengujian
Viabilitas
Baru-baru ini, dengan menggunakan kit
komersial LIVE / DEAD Bact
LightTM yang dikombinasikan dengan
flow cytometry, Guerrero dkk., 100 di
Kolombia telah berupaya menilai
kelayakan M. leprae dalam sampel dari
pasien MB yang dirawat dengan MDT
untuk mendapatkan titik potong untuk
membedakan populasi yang tidak dapat
hidup versus yang layak. Populasi
bakteri yang layak diamati berbeda
antara mereka yang diobati dengan 12
dosis dan 24 dosis, mendukung
pengobatan 24 bulan. Lebih lanjut,
56,7% pasien setelah 24 bulan
pengobatan dengan WHO-MDT
memiliki basil yang layak.
Berdasarkan prinsip bahwa PCR waktu
nyata (RT-PCR) memiliki potensi
untuk mendeteksi RNA, yang secara
kelangsungan hidup organisme,
Turankar dkk.,101 berusaha untuk
mendeteksi basil yang layak dari
kasus kusta aktif, di kantong endemis
Purulia, Benggala Barat, India. RT-
PCR untuk gen 16S rRNA dilakukan
untuk mendeteksi M. leprae yang layak,
dari sampel positif untuk daerah rlep
dan 46,5% air positif untuk DNA M.
leprae menunjukkan adanya basil yang
kehadiran basil yang lebih tinggi,
environment, indicating that M. leprae
survive better in moist places. Further,
samples collected from the control area,
where no active leprosy case resided,
showed no viable bacilli. Authors
conclude that leprosy patients discharge
or shed viable M. leprae into their
surrounding environment (soil and
water), which may act as potential
reservoir for M. leprae that may play a
role in the focal transmission of the
disease.
Mycobacterium lepromatosis
In 2008, Han dkk.,102 reported isolation
of a new Mycobacterium species from
two Mexican patients, who died in
Phoenix, Arizona, the United States of
America (USA) with diffuse
lepromatous leprosy (DLL) and
extensive necrotizing skin lesions.
Biopsies from both lesions showed
vasculitis with acid fast bacilli in
macrophages. The diagnosis in both
cases was compatible with Lucio
reactions. Han dkk. proposed the name
M. lepromatosis for the disease-causing
agent because of the close genetic
relationship to M. leprae and the
apparent association with DLL. The
AFB (strain FJ924) from case 1 was
identified by the amplification of 16S
rRNA gene by PCR, cloned and
sequenced. Three other genes were
amplified and sequenced directly
without cloning: housekeeping genes
hsp65 (65 kDa heat shock protein),
rpoB (for RNA polymerase β-subunit)
for further phylogenetic analysis and
the rpoT gene (for RNA polymerase σ
factor) for analysis of tandem repeats.
dibandingkan dengan lingkungan
kering, menunjukkan bahwa M. leprae
bertahan lebih baik di tempat-tempat
lembab. Selanjutnya, sampel yang
dikumpulkan dari daerah kontrol, di
mana tidak ada kasus kusta aktif
berada, tidak menunjukkan basil yang
layak. Penulis menyimpulkan bahwa
pasien kusta mengeluarkan atau
melepaskan M. leprae yang layak ke
lingkungan sekitar mereka (tanah dan
air), yang dapat bertindak sebagai
reservoir potensial untuk M. leprae
yang mungkin berperan dalam
transmisi fokus penyakit.
Mycobacterium lepromatosis
Pada tahun 2008, Han dkk.,102
melaporkan isolasi spesies
Mycobacterium baru dari dua pasien
Meksiko, yang meninggal di Phoenix,
Arizona, Amerika Serikat (AS) dengan
kusta lepromatous difus (DLL) dan lesi
kulit yang luas. Biopsi dari kedua lesi
menunjukkan vasculitis dengan asam
basil cepat di makrofag. Diagnosis pada
kedua kasus sesuai dengan reaksi
Lucio. Han dkk. mengusulkan nama M.
lepromatosis untuk agen penyebab
penyakit karena hubungan genetik yang
dekat dengan M. leprae dan hubungan
nyata dengan DLL. AFB (strain FJ924)
dari kasus 1 diidentifikasi dengan
amplifikasi gen 16S rRNA oleh PCR,
dikloning dan diurutkan. Tiga gen lain
diamplifikasi dan diurutkan secara
langsung tanpa kloning: gen rumah
tangga hsp65 (65 kDa heat shock
protein), rpoB (untuk RNA polimerase
β-subunit) untuk analisis filogenetik
lebih lanjut dan gen rpoT (untuk RNA
polimerase σ faktor) untuk analisis
tandem mengulangi. Dalam kasus 2,
blok jaringan yang tertanam parafin,
dikirim ke laboratorium untuk analisis
In case 2, the paraffin-embedded tissue genetik.
blocks, were sent to laboratories for
genetic analysis.

Setiap spesies memiliki gen 16S rRNA

Each species has a signatory 16S rRNA penandatangan dan bahwa sekitar 3%
gene and that an approximately 3% urutan divergensi antara spesies
sequence divergence between closest terdekat membentuk kriteria utama
species forms the main criterion for untuk definisi spesies. Analisis BLAST
species definition. BLAST analysis of dari gen rRNA 1,504-bp 16S rRNA
the 1,504-bp 16S rRNA gene of strain FJ924 menunjukkan bahwa organisme
FJ924 showed that the organism was itu paling dekat hubungannya dengan,
most closely related to, but distinct tetapi berbeda dari, M leprae
from, M leprae [matching 1,475 of [pencocokan 1,475 dari 1,506 bp
1,506 bp (97.9%)]. A phylogenetic tree (97,9%)]. Sebuah pohon filogenetik
showed that it descended along with M. menunjukkan bahwa ia turun bersama
leprae from a common ancestor that dengan M. leprae dari nenek moyang
had branched from other mycobacteria. yang telah bercabang dari mikobakteri
Based on their comparative genetic lainnya. Berdasarkan analisis genetik
analysis, the authors concluded that the komparatif mereka, penulis
genetic differences were significant menyimpulkan bahwa perbedaan
enough to propose a novel species. genetik cukup signifikan untuk
Further analysis of other genes among mengusulkan spesies baru. Analisis
M. leprae strains, rpoT has been shown lebih lanjut dari gen lain di antara strain
to contain three or four tandem repeats M. leprae, rpoT telah terbukti
of the sequence GACATC. The rpoT mengandung tiga atau empat
from FJ924, while matching 88% pengulangan tandem dari urutan
(449/510) overall with M. leprae, also GACATC. RpoT dari FJ924, sementara
contained four such repeats. In addition, mencocokkan 88% (449/510) secara
FJ924 rpoT also contained three repeats keseluruhan dengan M. leprae, juga
of the sequence mengandung empat pengulangan
CGAGCCACCAATACAGCATCT, seperti itu. Selain itu, FJ924 rpoT juga
which appears unique and absent in the mengandung tiga pengulangan dari
M. leprae genome. urutan
CGAGCCACCAATACAGCATCT,
yang tampak unik dan tidak ada dalam
genom M. leprae.

Han dkk.103 lebih lanjut menganalisis

103
Han dkk. further analyzed the
sequences of 20 genes and pseudogenes
(22,814). Overall, the level of matching
of these sequences with M. leprae
sequences was 90.9%, which
substantiated the species-level
urutan 20 gen dan pseudogen (22.814).
Secara keseluruhan, tingkat pencocokan
urutan ini dengan urutan M. leprae
adalah 90,9%, yang mendukung
perbedaan tingkat spesies; tingkat
pencocokan untuk gen 16S rRNA dan
difference; the levels of matching for
the 16S rRNA genes and 14
proteinencoding genes were 98% and
93.1%, respectively, but the level of
matching for five pseudogenes was
only 79.1%. Robust phylogenetic trees
constructed using concatenated
alignment of five conserved protein-
encoding genes placed M. lepromatosis
and M. leprae in a tight cluster with
long terminal branches, implying that
the divergence occurred long ago.
These results thus indicate that M.
lepromatosis and M. leprae diverged 10
million years ago.
104
Further, Cabrera dkk. reported that
during the drug resistance surveillance
study of archived leprosy biopsy
specimens from Monterrey, Mexico, it
was observed that the specimen (Mx1-
22A) from the case of DLL gave
negative test results for PCR targeting
the M. leprae folP1 and gyrA loci and
also for M. leprae specific RLEP
repetitive sequence, confirming the
absence of M. leprae DNA, although
the sample yielded a product when
rpoB primers were used. Upon analysis
of the sequences of the rpoB gene there
were multiple mismatches with the M.
leprae sequence but there was 100%
identity with the corresponding
sequences of M. lepromatosis FJ924.
Further, genetic analysis using the
primers described by Han dkk., together oleh Han dkk., Bersama dengan set
with additional sets of primers that
could amplify the sigA sequences from memperkuat sekuens sigA dari spesies
both the M. leprae and M. lepromatosis M. leprae dan M. lepromatosis FJ924,
species FJ924, led to the unambiguous
identification of sample Mx1-22 as M.
lepromatosis. Like M. leprae, M.
14 gen proteinencoding masing-masing
adalah 98% dan 93,1%, tetapi tingkat
pencocokan untuk lima pseudogen
hanya 79,1%. Pohon-pohon filogenetik
yang kuat dibangun menggunakan
penyelarasan gabungan dari lima gen
pengkode protein yang dilestarikan
menempatkan M. lepromatosis dan M.
leprae dalam sebuah kelompok ketat
dengan cabang-cabang terminal yang
panjang, yang menyiratkan bahwa
divergensi terjadi sejak lama. Hasil ini
dengan demikian menunjukkan bahwa
M. lepromatosis dan M. leprae berbeda
10 juta tahun yang lalu.
Lebih lanjut, Cabrera dkk. 104
melaporkan bahwa selama studi
pengawasan resistansi obat dari
spesimen biopsi kusta yang diarsipkan
dari Monterrey, Meksiko, diamati
bahwa spesimen (Mx1-22A) dari kasus
DLL memberikan hasil tes negatif
untuk PCR yang menargetkan M leprae
folP1 dan gyrA loci dan juga untuk
urutan berulang RLEP spesifik M.
leprae, yang menegaskan tidak adanya
DNA M. leprae, meskipun sampel
menghasilkan produk ketika primer
rpoB digunakan. Setelah analisis urutan
gen rpoB ada beberapa ketidakcocokan
dengan urutan M. leprae tetapi ada
identitas 100% dengan urutan yang
sesuai dari M. lepromatosis FJ924.
Selanjutnya, analisis genetik
menggunakan primer yang dijelaskan
primer tambahan yang dapat
mengarah pada identifikasi sampel
Mx1-22 yang tidak ambigu. M.
lepromatosis. Seperti M. leprae, M.
lepromatosis cannot be cultured on
artificial media; it also shares other
features, such as an unusually low GC
content for a Mycobacterium (57.8%),
the presence of pseudogenes, unique
AT-rich insertions in the 16S rRNA
gene, and identical six-base tandem
repeats in sigA. Cases of M.
lepromatosis infection have exhibited
much higher morbidity and even
mortality rates than cases of M. leprae
infection. However, with the exception
of direct DNA sequencing of the
Rifampin resistance determining region
(RRDR), none of the current PCR tests
for M. leprae can detect M.
lepromatosis, which means that cases
of infection by this newly described
leprosy bacillus may go undetected,
thus jeopardizing patient recovery.104
CONCLUSION AND FUTURE
PROSPECTS
M. leprae, even though being one of the
oldest microorganisms identified, has
been bundled with many unanswered
puzzles. Now, the bacteriology of
leprosy is becoming clearer after the
sequencing of the genome of M. leprae
was completed. Molecular
microbiology has begun to explain
some intrinsic factors like the fastidious
nature of M. leprae and its predilection
for an intracellular life. Still there are
many gray areas in the comprehension
of biology of M. leprae to be unraveled.
The challenges in the laboratory
diagnosis can be addressed with the
development of highly sensitive and
specific molecular tools. The inherent
problems of time consuming and
laborious nature of the conventional
Mouse foot pad technique in
determining the viability and screening
lepromatosis tidak dapat dikultur pada
media buatan; itu juga berbagi fitur
lain, seperti konten GC rendah yang
luar biasa untuk Mycobacterium
(57,8%), keberadaan pseudogen, insersi
kaya AT yang unik dalam gen 16S
rRNA, dan pengulangan tandem enam-
basis identik dalam sigA. Kasus infeksi
M. lepromatosis telah menunjukkan
angka morbiditas dan mortalitas yang
jauh lebih tinggi daripada kasus infeksi
M. leprae. Namun, dengan
pengecualian sekuensing DNA
langsung dari daerah penentu resistensi
Rifampin (RRDR), tidak ada tes PCR
saat ini untuk M. leprae yang dapat
mendeteksi M. lepromatosis, yang
berarti bahwa kasus-kasus infeksi oleh
basil kusta yang baru dideskripsikan ini
mungkin tidak terdeteksi. , sehingga
membahayakan pemulihan pasien.104
KESIMPULAN DAN PROSPEK
MASA DEPAN
M. leprae, meskipun merupakan salah
satu mikroorganisme tertua yang
diidentifikasi, telah dibundel dengan
banyak teka-teki yang tidak terjawab.
Sekarang, bakteriologi kusta menjadi
lebih jelas setelah sekuensing genom
M. leprae selesai. Mikrobiologi
molekuler telah mulai menjelaskan
beberapa faktor intrinsik seperti sifat
rewel M. leprae dan kecenderungannya
untuk kehidupan intraseluler. Masih ada
banyak daerah abu-abu dalam
pemahaman biologi M. leprae yang
harus diurai. Tantangan dalam
diagnosis laboratorium dapat diatasi
dengan pengembangan alat molekuler
yang sangat sensitif dan spesifik.
Masalah yang melekat pada sifat
memakan waktu dan melelahkan dari
teknik alas kaki Mouse konvensional
dalam menentukan kelayakan dan
of the drug susceptibility may be
overcome by further refinement of the
PCR-based molecular assays in near
future. However, the inability to grow
M. leprae in vitro would still continue
to be an enigma for the bacteriologists.
It is hoped that after the successful
genome mapping of M. leprae, the
knowledge gained in M. leprae
genomics, proteomics and
bioinformatics may be integrated for
better understanding of the puzzles
around M. leprae.
penyaringan kerentanan obat dapat
diatasi dengan penyempurnaan lebih
lanjut dari pengujian molekuler
berbasis PCR dalam waktu dekat.
Namun, ketidakmampuan untuk
menumbuhkan M. leprae secara in vitro
masih akan terus menjadi teka-teki bagi
para ahli bakteriologi. Diharapkan
bahwa setelah pemetaan genom yang
sukses dari M. leprae, pengetahuan
yang diperoleh dalam genomik,
proteomik dan bioinformatika M. lepra
dapat diintegrasikan untuk pemahaman
yang lebih baik tentang teka-teki di
sekitar M. leprae.