The
mutation in the protein results in constitutive expression of a gene that is
normally regulated by that protein. Which of the following represents the
protein that has the mutation?
<C+>Repressor.
<C>Activator.
<C>Operator.
<C>Promoter.
<C>RNA polymerase.
3. -<Q>In E. coli lac operon, if the lacZ gene is mutated with a loss of
function then the following statement is TRUE:
<C>The amount of the allolactose will be increased.
<C>The expression of the lac A and lac Y will be increased.
<C>The binding of the repressor protein to the operator region of the lac operon will
be decreased.
<C+>The amount of allolactose might be decreased.
<C>The amount of allolactose should be unaffected.
-
7. <Q>In lac operon, the natural inducer that binds repressor is:
<C>Lactose
<C>Mannose.
<C+>Allolactose.
<C>Glucose.
<C>Galactose.
12. Unlike the 5' end of a prokaryotic mRNA, the 5' end of a eukaryotic
mRNA
a. retains the nucleoside 5'-triphosphate.
b. is modified by addition of a methylguanosine cap.
c. is modified by the addition of a polyadenylate cap.
d. only contains a few (three or four) bases before the AUG.
e. has a consensus sequence to specify the start of translation.
13. An E. coli strain has a mutation in the RNA Pol core enzyme that
prevents association with sigma factor. This is expected to cause an inability
of the enzyme to
a. catalyze elongation of RNA.
b. recognize operators.
c. recognize promoters.
d. recognize terminators.
a. nonsense mutation
b. read through mutation
c. silent mutation
d. frameshift mutation
e. missense mutation
19. A mutation in the lac repressor protein eliminates its binding to the lac
operator. The mutant strain displays:
a. an inability to express the lactose operon-encoded genes under any circumstances.
b. an inability to express the lactose operon-encoded genes unless lactose is present
and glucose is absent.
c. the same level of expression of the lactose operon-encoded genes under all
circumstances.
d. the highest level of expression of the lactose operon-encoded genes only when
glucose is absent whether or not lactose is present.
e. the highest level of expression of the lactose operon-encoded genes only when
glucose is absent and lactose is present
21. The indicated gene has a mutation that eliminates the 3' splice site of intron
#2. What is the most likely structure of the mature mRNA in the mutant cells?
22. The sequence of the 5`region of a bacterial gene (the non template
strand is shown) and several of its mutants which exhibit altered transcription
activity is presented below. A DNA fragment which has either the wild type
promoter region or one of its alternate forms, was transcribed in vitro, the
amount of specific transcription was measured and the data are presented in
the table below. Explain the role of each mutation in determining the level of
transcription found in the table.
5`TCTGGCGGTGTTGACATAAATACCACTGGGGTGATACTGAGACATCAG 3`
↓ ↓ ↓ ↓
T G T T
MUTANT # 1 2 3 4