Anda di halaman 1dari 19

LAPORAN PRAKTIKUM BIOLOGI MOLEKULER

PERCOBAAN I

PENGENALAN SITUS BIOINFORMATIKA NCBI DAN


PENGGUNAANNYA DALAM MEMAHAMI PROSES EKSPRESI GEN

Oleh :

Nama : Putri Wahyu Wijayanti

NIM : M0617031

Hari, tgl praktikum : Kamis, 11 April 2019

Kelompok :6

Asisten praktikum :

LABORATORIUM FARMASI

PROGRAM STUDI S1 FARMASI

FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM

UNIVERSITAS SEBELAS MARET


SURAKARTA

2019

LAPORAN PRAKTIKUM BIOLOGI MOLEKULER

PERCOBAAN I

PENGENALAN SITUS BIOINFORMATIKA NCBI DAN


PENGGUNAANNYA DALAM MEMAHAMI PROSES EKSPRESI GEN

I. Tujuan
A. Dapat menelusuri identitas suatu gen berdasarkan sekuen
nukleotida menggunakan gene bank database
B. Dapat memahami prinsip ekspresi gen yang meliputi transkripsi
dan translasi serta regulasinya
C. Dapat mengidentifikasi bagian gen yang berperan sebagai promoter
coding sequence (CDS), intron dan ekson, start dan stop kodon,
dan regulating element
D. Dapat memhaami bagaimana satu gen yang sama dapat
menghasilkan protein yang berbeda
II. Dasar Teori
Kemajuan teknologi baru-baru ini telah membuka peluang yang
belum pernah terjadi sebelumnya untuk sekuensing skala besar dan
analisis populasi spesies patogenik dalam wabah penyakit, serta untuk
studi keragaman skala besar yang bertujuan memperluas pengetahuan
kita diseluruh domain prokariot. Untuk memenuhi tantangan
interpretasi struktur, fungsi, dan makna yang tepat waktu dari
informasi genetik yang luas ini, pendekatan komperhensif untuk
anotasi genom otomatis yang diperlukan. Bekerja sama dengan
Georgia Tech, NCBI telah mengembangkan pendekatan baru untuk
anotasi genom yang menggabungkan metode berbasis keselarasan
dengan metode memprediksi pengkodean protein dan gen RNA dan
elemen fungsional lainnya langsung dari urutan (Tatusova, 2016).
Bioinformatika merupakan ilmu terapan yang lahir dari
perkembnagan teknologi informasi dibidang molekuler. Pembahasan
dibidang bioinformatik ini tidak terlepas dari perkembangan biologi
molekuler modern, salah satunya peningkatan pemahaman manusia
dalam bidang genomik yang terdapat dalam molekul DNA.
Perkembangan jaringan internet memudahkan ilmuwan dalam
mengumpulkan hasil sekuensing kedalam pangkalan data tersebut serta
memperoleh sekuens biologi sebagai bahan analisis. Selain itu
penyebaran program-program aplikasi bioinformatika melalui internet
memudahkan ilmuwan dalam mengaksesprogram-program tersebut
dan kemudian memudahkan pengembangannya (Utama, 2003).
Bioinformatika yang merupakan aplikasi dari metode komputasi (in
silico) dan analisis untuk menangkap dan menginterpretasikan data-
data biologi. Salah satu cakupan dari bioinformatika adalah metode
molekuler docking yang mampu memperkirakan intertasksi senyawa
pada konformasi dan pose spesifik dengan suatu enzim atau reseptor
secara lebih cepat dan efisien (Nugroho dkk., 2010).
NCBI merupakan server yang memuat data base tentag informasi
kesehatan dan bioteknologi. Data base terus menerus di update sesuai
dengan penemuan-penemuan terkini yang menyangkut DNA, protein,
semyawa aktif dan taksonomi. NCBI merupakan salah satu bank data
gen, protein dan literatur khususnya dibidang kesehatan yang
terlengkap dan diacu oleh para peneliti didunia. National Center of
Biotechnology Informatic adalah bagian dari Amerika Serikat National
Library of Medicine (NLM), sebuah cabang dari National Institues of
Health. Para NCBI terletak di Bethesda, Maryland, dan didirikan pada
tahun 1988 melalui legilasi disponsori oleh Senator Claude Pepper
(Lechninger, 1982).
Dalam membaca hasil Gen Bank Databese, Query Coverage
adalah parameter yang penting karena menilai dalam persen sekuen
dalam databese menutupi query, yang memastikan apakah sampel
tertutup semuanya oleh sekuen. Persentase yang dapat diterima
minimal 95% kecuali untuk sekuen yang bacaannya lebih rendah
diberlakukan minimal 75%. Apabila nilai E-Value semakin mendekati
nol, hasilnya akan lebih terpercaya dan bila nilainya satu, maka tidak
boleh digunakan. Untuk pensejajaran sekuen-sekuen yang dihasilkan,
baiknya dibuat filogeninya. Filogeni ini diperlukan karena merupakan
salah satu cara yang penting untuk pembacaan sekuen mana yang
paling dekat dengan sampel (Narita dkk., 2013).
Informasi mengenai kode gen dalam bahasa alami didalam
literatur biomedis sangatberguna. Maka dari itu cara untuk mengakses
dan menganalisis informasi tersebut tersedia dengan mudah dan dapat
dipercyaa keakuratannya. Pengolahan bahasa alami dan alat pencari
informasi “text mining tools” sangat penting untuk mengekstraksi
informasi berharga. Pengembangan alat yang canggih, otomatis, dan
sangat efektif sangat diperlukan untuk endeteksi konsep biomedis
sentral seperti konsep NCBI (National centre for Biotechnology
Inforation) yang menyediakan segala sumber informasi biologis
(Dogann fkk., 2014).
Kemajuan teknologi sequencing gene telah menghasilkan akuisisi
set data genomik yang luas. Menerjemahkan data ini menjadi
penemuan biologis baru. Pendekatan komputasi diperlukan untuk
pemrosesan yang tepat waktu dan efisien. Aligning sequence untuk
menentukan kesamaan penting dan banyak digunakan prosedur
komputasi untuk urutan biologis dengan analisis dalam biologi
komputasional dan bioinformatika. Berbagai algoritma komputasitelah
diterapkan pada urutan keselarasan data. Penyelarasan Basic Local
Alignment Search Tool (BLAST) paling banyak digunakan prosedur
komputasi. Database biologis berdasarkan versi heuristik dan pairwise
Algoritma Smith Waterman lokal. Ini membandingkan kesamaan
refrensi protein atau urutan DNA terhadap data dasar urutan
(O’Driscoll dkk., 2015).
III. Alat dan Bahan
A. Alat
1. Laptop dengan koneksi internet 1 buah
2. Kabel olor 1 buah
3. Cahrger 1 buah
4. Buku panduan (Modul) 1 buah
5. Alat tulis 1 buah
B. Bahan
1. Sekuen Nukleotida

ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCT
TACCCCGAGTCGCTGCCCCTTACCGTCAACCACGACTTGCAGA
GGGGGAAGGTGGAGGCTGACATCCCAGGCCATGGGCAGGAAGT
CCCCCTTCCACCTCCGACTGTAGGGTCCGGTACCCGTCCTTCA
CCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAG
GGAGTAGTCCGAGAAATTCCCAGTGGGTCTCTGAGACCTCTTC
TTTGACAAGTTCAAGCACCTGAAGTCAGAGGACGAGATGAAGG
AAACTGTTCAAGTTCGTGGACTTCAGTCTCCTGCTCTACTTCC
CGTCTGAGGACTTAAAGAAGCATGGTGCCACCGTGCTCACCGC
GCAGACTCCTGAATTTCTTCGTACCACGGTGGCACGAGTGGCG
CCTGGGTGGCATCCTTAAGAAGAAGGGGCATCATGAGGCAGAG
GGACCCACCGTAGGAATTCTTCTTCCCCGTAGTACTCCGTCTC
ATTAAGCCCCTGGCACAGTCGCATGCCACCAAGCACAAGATCC
TAATTCGGGGACCGTGTCAGCGTACGGTGGTTCGTGTTCTAGG
CCGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGT
GGCACTTCATGGACCTCAAGTAGAGCCTTACGTAGTAGGTCCA
TCTGCAGAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAG
AGACGTCTCGTTCGTAGGGCCCCTGAAACCACGACTACGGGTC
GGGGCCATGAACAAGGCCCTGGAGCTGTTCCGGAAGGACATGG
CCCCGGTACTTGTTCCGGGACCTCGACAAGGCCTTCCTGTACC
CCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAGGGAGGTTG
ATGTTCCTCGACCCGAAGGTCCCGATC
2. Kode Acession
NM_005368.3
IV. Cara Kerja
1. Dibuka situs www.ncbi.nlm.nih.gov
2. Dipilih tool “BLAST” (diklik satu kali), akan muncul pilihan program
“ BLAST” untuk mencari gen suatu sekuen nukleotida dari database
nukleotida dipilih “nucleotide blast” atau blastn.

BLAST

BLASTn

3. Setelah tampilan muncul, dimasukkan sekuen nukleotida query yang


akan dicar (sekuen nukeotid dimasukkan pada kolom sekuen
nukleotid); dipilih setting pencarian dari database “others” (jika belum
diketahui spesiesnya); dipilih program “megablast”; diklik “BLAST”
untuk memulai proses pencarian
Kolom sekuen nukleotid

4. Hasil blast umumnya akan menghasilkan lebih dari satu sekuen


yang bersesuaian. Beberapa parameter untuk memilih antara lain
skor paling tinggi serta kelengkapan genetic yang dikandungnya.

5. Diklik “Accession” genterpilih (hasil blastn) untuk keterangan lebih


lanjut, mempelajari tampilan sequen viewer NCBI, nukleotide origin,
dan CDS nya
6. Diklik “G” (Enter Gene) pada gen terpilih tersebut akan didapat
deskripsi mengenai gen tersebut
7. Data sekuen viewer disimpan untuk menjadi bahan praktikum,
kemudian dilihat dan dipahami mengenai : locus, definition,
summary, features, CDS, mRNA,
locus
SUMMARY

Features

Origin
Promoter GACA

Start kodon ATG

CDS 121-481

Stop kodon TAG

V. Tabel Hasil

NM_005368.3
Locus

Definition Homo sapiens myoglobin (MB), transcript variant 1,


mRNA.

Summary Gen ini mengkodekan anggota atau bagian dari


superfamili globin dan diekspresikan di skeletal dan otot
jantung. Proteinyang dikodekan adalah hemoprotein yang
berkontribusi dalam penyimpanan oksigen intraseluler
serta difusi oksigen transeluler. Setidaknya terdapat tiga
varian alternatif potongan transkrip yang mengkode
protein yang sama, yang telah berhasil ditemukan.

Features a. Source : 1..1070


b. Gene : 1..1070
c. CDS : 73..537
d. Exon : 1..167
168..390
391..1070

Origin a. Promoter : GACA dibaris 121


b. Start kodon : ATG dibaris 121
c. Stop kodon : TAG dibaris 481

VI. Pembahasan

Pada praktikum kering yang berjudul Pengenalan Situs


Bioinformatika Ncbi Dan Penggunaannya Dalam Memahami Proses
Ekspresi Gen bertujuan untuk menelusuri identitas suatu gen
berdasrkan sekuen nukleotida menggunakan gene bank database,
memahami prinsip ekspresi gen yang meliputi transkripsi dan translasi
serta regulasinya, dapat mengidentifikasi gen yang berperan sebagai
promoter, CDS, intron dan ekson, start dan stop kodon serta regulating
element, dan yang terakhir yaitu dapat memahami bagaimana satu gen
yang sama dapat mengasilkan protein yang berbeda. Dalam
percobaanini digunakan situs bioinformatika bertaraf internasional
yang dikenal sebagai NCBI.

NCBI memiliki 2 software unggulan dengan fasilitas tertentu, salah


satunya adalah BLAST. BLAST (Basic Local Alignment Search Tool)
merupakan suatu programuntuk pencarian kemiripan sekuen dan
merupakan alat dalam identifikasi gen dan karakter genetik. BLAST
memiliki lima program utama yaitu:

1. Nucleotide Blast (blastn) : membandingkan sekuen nukleotide yang


dimiliki dengan database sekuen nukleotide
2. Protein Blast (blastp) : membandingkan sekuen asam amino yang
dimilki dengan database sekuen protein
3. Blastx : membandingkan produk translasi konsep 6 frame sekuen
nukleotida dengan database sekuen protein
4. Tblastn : membandingkan sekuen protein yang dimiliki dengan
sekuen nukleotida yang secara dinamis ditranslasi pada semua
pembacaan 6 frame
5. Tblastx : membandingkan suatu translasi 6 frame dari nukleotida

Prinsip kerja dari praktikum ini yaitu dengan membandingkan


sekuen nukleotida yang dimiliki dengan database sekuen nukleotida
untuk didapatkan identitas dari nukleotida yang diragukan baik nama
gen dan spesies penghasill dari sekuen lengkapnya. NCBI merupakan
server yang memuat databasse tentang informasi kesehatan dan
bioteknologi. Untuk mengakses NCBI dapat melalui situs
www.NCBI.nlm.nih.gov. NCBI dimanfaatkan dalam proses
identifikasi nukleotida hasil dari ekspresi gen. Ekspresi gen merupakan
proses bagaimana informasi yang ada dalam DNA dapat di copy
melalui proses transkripsi dalam organisme eukariot. Hasil proses
transkripsi adalah mRNA (transkrip primer). Didalam organisme
eukariot ada tahapan proses tertentu sebelum menghasilkan RNA,
yaitu RNA processing. Kemudian diikuti tahap translasi yang akirnya
menghasilkan polypeptida. Jika dalam proses tersebut ada tahapan
yang tidak terjadi maka dalam hal ini tidak termasuk dalam kategori
bahwa gen terebut telah terekspresi atau dengan kata lain tidak terjadi
ekspresi gen (Ermawati, 2007).

Transkripsi merupakan tahapan awal sebuah sintesis protein


dimana molekul RNA disintesi pada DNA template. Proses ini terjadi
dikromosom. Proses transkripsi memerlukan sebuah enzin yaitu enzim
DNA polimerase yang menempel pada daerah promoter. Pada proses
transkripsi dimulaia dari inisiasi. Inisiasi bekerja setelah enzim DNA
polimerase menduduki daerah promoter dimana dimulai dengan
pembentukan kompleks promoter terbuka, maka akan terjadi
penggabungan beberapa nukleotida awal dan perubahan konformasi
RNA polimerase. Setelah transkripsi dilanjutkan dengan proses
elongasi atau biasa disebut dengan perpanjangna nukleotida dimana
setelah RNA polimerase menempel pada promoter maka enzim
tersebut akan bergerak sepanjang rantai DNA dan membukan ikatan
heliks.

Apabila telah menemui stop kodon, DNA selanjutnya akan terlepas


dari DNA template menuju ribosom. Tahapan lanjutan ialah translasi
yaitu penerjemahan mRNA menjadi protein. Setelah sampai ribosom
mRNA akan menempel pada subunit kecil ribosom (30s) lewat ujung
5’. Pada saat bersamaan, tRNA menempel pada subunit besar ribosom
(50s). Pada proses tersebut akan dimulai penerjemahan daerah start
kodo AUG. Start kodon merupakan kode untuk proses rangkaian asam
amino dimulai. Tahapan ini merupakan tahap inisiasi dari proses
translasi. Setelah tahapan inisiasi selesai, dilanjutkan dengan
penerjemahan kodon triplet dan penempelan asam amino hingga
membentuk rantai. Penerjemahan kode ini diikuti pengikatan asam
amino sesuai kodon oleh tRNA yang kemudian dibawa kekompleks
ribosom dan digangungkan dengan asam amino sebelumnya. Proses ini
dinamakan elongasi, dimaa akan berlangsung sampai munculnya
kodon stop. Proses elongasi berakhir pada stop kodon yaitu UAA,
Uag, dan UGA dimana stop kodon berfungsi sebagai kode untuk
proses penghentian perangkaian asam amino. Tahap terakhir dari
ekspresi gen yaitu regulasi yang mengkode genetik. Kode genetik
terdiri 64 triplet nukleotida dimana triplet ini disebut kodon. Dengan
tiga pengecualian setiap kodon mengkode satu dari 20 asam amino
yang digunakan untuk sintesis protein.

Dalam praktikum ini, identifikasi dilakukan terhadap locus


NM_005368.3 yang memberikan data hasil yang menggambarkan
proses ekspresi gen dari nukleotida terkait. Dimana hasil identifikasi
dijabarkan dalam beberapa point fokus yang menunjukan informasi
penting terkait sampel nukleotida.
1. Locus, denition, dan organism

Locus selalu menempati baris pertama pada tampilan entry, yang


menunjukan nama sekuenpada genbank, terdiri dari nama sekuen,
panjang sekuen (pasang basa/base pairs), molekul, bentuk molekul,
dan tanggal update terakhir. Locus sendiri menunjukkan posisi gen
yang diidentifikasi. Dibawah locus terdapat definition yang
mendiskripsikan sekuen terkait. Kolom definition didukung dengan
keberadaan kolom organism dimana kolom tersebut memberikan
informasi terkait organisme pemilik sekuen nukleotida yang terkait.
Pada praktikum ini didapatkan gen Homo sapiens myoglobin (MB),
transcript variant 1, mRNA. Dari hasil input data dihasilakn banyak
acession yang dapat menunjukan bahwa satu gen yang sama dapat
menghasilakn protein yang berbeda. NM_005368.3 yang diakses
memiliki query 100% yang artinya memiliki kemiripan sekuen
nukleotida dengan database.
2. Summary

Pada bagian summary ditujukan untuk memberikan informasi


terkait sekuen nukleotida yang diidentifikasikan. Pada kolom ini
diketahui bahwa gen terkait mengkodekan mengkodekan anggota
atau bagian dari superfamili globin dan diekspresikan di skeletal
dan otot jantung. Proteinyang dikodekan adalah hemoprotein yang
berkontribusi dalam penyimpanan oksigen intraseluler serta difusi
oksigen transeluler.
3. Features

Pada kolom features ini diinformasikan mengenai catatan atau


keterangan mengenai ciri/karakter setiap sekuen. Pada feature
terdapat informasi CDS daerah locus sequnce untuk mencari
promoter, start kodon dan stoop kodon. Dari data pada kolom ini
didapatkan data CDS 1..1070 dan exon 1..167.

4. Origin
Data pada kolom ini berhubungan dengan data yang diberikan pada
kolom features, dimana dilihat dari CDS (1..1070) dapat
memperkecilluas fokus identifikasi sekuen nukleotida yang berarti
sekuen berada diantara 1 hingga 1070. Dari penelusuran terhadap
origin, diawali dari baris 121 hingga 901, didapatkan data sebagai
berikut
a. Promoter, menentukan dimana transkripsi dimulai dan juga
menentukan DNA untai heliks yang digunakan. Ditemukan
GACA di baris 1
b. Start kodon, kodon pertama yang diterkjemahkan pada saat
translasi atau disebut juga kodon inisiasi, ditemukan ATG pada
baris 121
c. Stop kodon merupakan triplet nukelotida dalam RNA yang
bertanggungjawab atas penghenyian proses penerjemahan.
Ditemukan TAG di baris 601.

Intron mrupakan bagian pada gen yang membedakan manusia dan


gen bakteri disaat eksoresi berlangsung. Oleh karena itu intron
harus dihilangkanterlebih dahulu. Intron merupakan urutan
nukleotida yang terdapat dalam gen antara ekson dan urutan ini
tidak mengkode untuk protein. Pada informasi summary
menjelaskan secara singkat mengenai gen yang didapat dimana gen
ini merupakan anggota atau bagian dari globin.

VII. Kesimpulan
A. Dapat dilakukan penelusuran identitas gen berdasarkan sekuen
nukleotida menggunkan genbank database dimana didapatkan gen
Homo sapiens myoglobin (MB), transcript variant 1, mRNA
dengan query cover 100%.
B. Pada proses ekspresi gen terjadi proses transkripsi yaitu perubahan
gen menjadi mRNA dengan bantuan enzim DNA polimerase dan
dilanjutkan dengan perubahan mRNA menjadi protein yang
disebut dengan proses translasi dimana masing-masing proses
terdiri dari tahap inisiasi dari promoter, elongasi yang dimulai
setelah menemukan start kodon dan terminasi setelah mencapai
stop kodon
C. Pada identifikasi ekspresi gen praktikum ini diperoleh daerah CDS
dimana pada CDS terdapat promoter berupa GACA pada urutan
121, start kodon ATG dibaris 121, stop kodon TAG dibaris 481.
D. Pada identifikasi ekspresi gen diperoleh acession yang begitu
banyak yang artinya dalam satu gen yang dama dapat
menghasilakn protein yang berbeda. Salah satu acessionnya adalah
Homo sapiens myoglobin (MB), transcript variant 1, mRN.
VIII. Daftar Pustaka
Dogan, R.I., Leaman, R. and Lu, Z., 2014. NCBI Disease Corpus: A Resource
For Disease Name Recognation And Concept Normaization. Journal
of Biomedical Informatics, 47, pp. 1-10.

Ermawati. 2007. Pengatur Ekspresi Gen. Jurnal Biomedis. 1(I) : 23-30.

Lechninger, A. L. 1982. Dasar-dasar Biokimia. Jakarta: Erlangga.

Narita, V., Rosyadi, I. And Ripmiatin, E., 2013. Analisa Genotype dan
Serotype Virus Hepatitis B Potensial Sebagai Kandidat Sekuens
Vaksin Hepatitis B Secara Bioinformatika Berbasis Web. Jurnal Al
Azhar Indonesia Seri Sains dan Teknologi, 2(2).

Nugroho, P.A., Sukamdi, D.P., Derma, A.P., Jenie, RI. And Meiyanto, E.,
2010. Penelusuran mekanisme flavonoid kulit jeruk keprok sebagai
agen komopreventif melalui docking molekuler pada protein target
CYP1A2. Farmasains, 1(1).

O’Driscoll, A., belogrudov, V., Carrol, j., Kropp, K., Walsh, P., Ghazal, P.
And Sleator, R.D., 2015. HBLAST : Paralellised sequence similarity
A Hadoop Map Reduceble basic local alignment search tool. Journal
of biomedical informatics, 54.

Tatusova, T., Dicuccio, M., Badretdin, A., Chetvernin, V., Nawrocki, E.P.,
Zaslavsky, L., Lomsadze, A., Pruitt, k.D., Borodovsky, M. And
Ostell., 2016. NCBI Prokaryotic Genome Annotation Pipeline.
Nucleic Acids Researech, 44(14).

Utama. 2003. Peranan Bioinformatika Dalam Dunia Kedokteran. Jakarta : UI


Press.

IX. Lampiran
A. Abstrak Jurnal
B. Laporan Sementara
Surakarta, 11 April 2019
Mengetahui,
Praktikan
Asisten Praktikum

(Putri Wahyu Wijayanti)


( )