Anda di halaman 1dari 40

LAPORAN PRAKTIKUM

MATA KULIAH BIOTEKNOLOGI TANAMAN

TEKNIK ISOLASI DNA GENOM, PCR (POLYMERASE CHAIN REACTION),


ELEKTROFORESIS, DAN VISUALISASI DNA PADA BERBAGAI GENOTIPE
TANAMAN PADI

KELAS D
KELOMPOK 3

Almas Putri Ghassani


150510170023

PROGRAM STUDI AGROTEKNOLOGI


FAKULTAS PERTANIAN
SEPTEMBER, 2019
KATA PENGANTAR

Puji syukur kehadirat Tuhan Yang Maha Esa, atas segala rahmat dan karunia-
Nya sehingga penulis dapat menyelesaikan laporan praktikum yang berjudul “Teknik
Isolasi DNA Genom, PCR (Polymerase Chain Reaction), Elektroforesis, dan
Visualisasi DNA pada Berbagai Genotipe Tanaman Padi”. Laporan praktikum ini
disusun untuk memenuhi salah satu tugas Mata Kuliah Bioteknologi Tanaman.
Penulis mengucapkan terimakasih kepada pihak-pihak yang telah membantu
dalam penulisan makalah ini, baik secara materil maupun motivasi. Penulis berharap
makalah ini dapat bermanfaat bagi para pembacanya.
Penulis menyadari bahwa dalam penyusunannya makalah ini masih jauh dari
kesempurnaan, maka dari itu kritik dan saran yang membangun penulis harapkan, demi
perbaikan selanjutnya.

Jatinangor, 28 September 2019

Penulis

i
DAFTAR ISI

KATA PENGANTAR i
DAFTAR ISI ii

BAB I PENDAHULUAN 1

1.1 Latar Belakang 1

1.2 Tujuan 2

BAB II BAHAN DAN METODE 3

2.1 Isolasi DNA 3

2.2 Elektroforesis 7

2.3 PCR (Polymerase Chain Reaction) 9

BAB III HASIL 14

3.1 Isolasi DNA 14

3.2 Uji Kuaiitas DNA dengan Elektroforesis 16

3.3 Seleksi Aromatik 19

BAB IV PEMBAHASAN 23

4.1 Isolasi DNA 23

4.2 Uji Kuaiitas DNA dengan Elektroforesis 26

4.3 Seleksi Aromatik 27

BAB V DAFTAR PUSTAKA 31

ii
BAB I
PENDAHULUAN

2.1 Latar Belakang/Pendahuluan

DNA atau Deoxyribonucleic acid merupakan makromolekul berupa


benang yang memiliki struktur sangat panjang yang terbentuk dari sejumlah
besar deoksiribonukleotida, yang masing-masing tersusun dari satu basa, satu
gula dan satu gugus fosfat secara sistematis dan merupakan pembawa informasi
genetic yang diturunkan kepada keturunannya. Kualitas DNA yang baik dapat
dilihat secara kualitatif dan kuantitatif. Pengukuran secara kuantitatif dilakukan
dengan mengukur konsentrasi DNA menggunakan spectrophotometer dengan
Panjang gelombang 260 nm. Jumlah radiasi UV yang diserap (absorbance=A))
oleh larutan DNA akan sebanding dengan jumlah DNA dalam sampel yang
diukur. Selanjutnya untuk pengukuran secara kualitatif dilakukan dengan
mengukur kemurnian DNA melalui perbandingan nilai A pada Panjang
gelombang 260 nm dengan nilai A 280 nm. Kemudian, didapatkan rasio antar
A260/A280 yang menunjukkan batas kemurnian DNA. Batas nilai kemurnian
yang dipakai dalam analisis molekuler adalah 1,8 - 2,0 (Sambrook and Russel,
1989). Apabila nilai rasio kurang dari 1,8 maka dikatakan bahwa sampel DNA
terkontaminasi oleh protein dan dapat dihilangkan dengan menambahkan
proteinase, sedangkan jika nilai rasio lebih dari 2,0 maka dikatakan bahwa
sampel DNA terkontaminasi oleh RNA dan dapat dihilangkan dengan
menambahkan ribonuclease.

Betain aldehid dehydrogenase (BADH) merupakan gen pengendali sifat


aroma padi yang terekspresi pada seluruh bagian padi kecuali akar. Gen ini
memiliki dua homolog yaitu BADH1 dan BADH2. Gen BADH1 terletak pada
kromosom 4 sedangkan BADH2 pada kromosom 8. Kedua gen tersebut memiliki
15 ekson dan menunjukkan 75% homolog urutan pada tingkat asam amino. Gen
BADH1 memiliki fungsi biokimia yang serupa dengan BADH2 sehingga gen

1
BADH1 dikaitkan dengan aroma padi. Gen BADH2 menghasilkan aroma karena
adanya delesi urutan nukleotida. Kemudian, primer yang dapat digunakan
menurut Bradbury et al yaitu :

Primer Sequence (5’ to 3’) Penanda Karakter


External Sense TTGTTTGGAGCTTGCTGATG Aromatik
Primer (ESP)

Internal Fragrant CATAGGAGCAGCTGAAATATATACC


Antisense Primer
(IFAP)
Internal Nonfragrant CTGGTAAAAAGATTATGGCTTCA Non aromatik
Sense Primer
(INSP)
External Antisense AGTGCTTTACAAAGTCCCGC
Primer (EAP)

Seleksi penting dilakukan untuk mengetahui keberadaan gen aromatic


BADH1 dan BADH2 pada tanaman padi. Kegiatan seleksi yang dilakukan
dengan tepat dapat mencegah terjadinya penurunan generasi keturunannya,
selain itu seleksi berfungsi dalam menghilangkan segmen DNA yang tidak
diinginkan menggunakan marka molekuler yang dapat mempengaruhi ekspresi
gen.

2.2 Tujuan
Menidentifikasi dan menyeleksi sampel genotip hasil persilangan piramidisasi
generasi F2 menggunakan marka yang bertautan dengan karakter aromatik

BAB II

2
BAHAN DAN METODE

2.1 Bahan dan Metode


2.1.1 Isolasi DNA
Alat :
1. Mikropipet dan tip mikropipet

- Mikropipet adalah suatu alat yang digunakan untuk memindahkan


cairan dalam jumlah kecil secara akurat.
- Tip mikropipet adalah pelengkap tambahan yang berada di ujung
mikropipet dan bersentuhan langsung dengan cairan yang akan
dipindahkan atau sering dikenal sebagai mulut pipet. Fungsi tip
mikropipet adalah sebagai tempat menampung cairan sementara yang
akan dipindahkan ke alat lab lainnya. Dalam penggunaan tip
mikropipet ada yang sekali pakai lalu dibuang dan ada juga dapat
digunakan berulang kali karena dapat disterilkan di dalam autoklaf.
2. Mortar dan pestle (lesung dan alu)
- Mortar dan pestle merupakan alat yang digunakan untuk
menghancurkan atau menghaluskan suatu bahan atau zat yang masih
bersifat padat atau kristal. Mortar dan pestle pada praktikum ini
digunakan sebagai alat penghancur dan perusak dinding sel pada
sampel daun tanaman padi secara mekanik dengan cara digerus, yang
mana mortar berfungsi sebagai bagian wadahnya sedangkan pestle
sebagai bagian batang yang dipegang. Lama penggerusan sangat
tergantung kepada jenis bahan, kekuatan penggerus, serta keahlian
dalam menggunakan alat tersebut.
3. Spatula
- Spatula merupakan alat pengaduk yang berfungsi untuk mencampur
cairan dengan bahan kimia yang mana pada umumnya terbuat dari kaca
pejal, borosilikat (pyrex). Selain itu spatula juga berfungsi sebagai alat
untuk mengambil objek atau bahan kimia padat untuk dipindahkan ke
suatu tempat.

3
4. Gunting
- Dalam kegiatan praktikum ini, gunting digunakan sebagai alat untuk
memotong sampel daun tanaman padi A-396 menjadi potongan-
potongan yang kecil
5. Tube kecil dan besar
- Tube kecil dan besar berfungsi sebagai alat untuk meletakkan bahan
yang sudah dihaluskan dan juga digunakan untuk mereaksikan bahan
6. Water bath
- Water bath merupakan wadah yang berisi air yang bisa
mempertahkan suhu air pada kondisi tertentu selama selang waktu
yang ditentukan atau disebut juga sebagai penangas air yang fungsi
utamanya untuk menciptakan suhu yang konstan.
-  Selain itu, fungsi lain dari water bath yakni sebagai media untuk
menyeragamkan larutan. Penyeragaman larutan dilakukan dengan
suhu rendah yang berkisar antara 300 hingga 1000 celcius.
7. Sentrifus/Centrifuge
- Centrifuge atau sentrifus adalah alat yang digunakan untuk
memisahkan sampel berdasarkan berat jenis pada kecepatan tinggi.
Fungsi dari centrifuge adalah untuk memisahkan partikel padat dan
partikel cair dalam suatu larutan yang mana partikel zat cair yang
memiliki massa lebih berat akan bergerak ke bagian bawah tabung,
sedangkan partikel yang memiliki partikel zat yang lebih cair dan
ringan akan berada di bagian atas tabung.
8. Kertas tissue
- Pada kegiatan praktikum ini, kertas tissue digunakan sebagai alat
untuk mengeringkan alat-alat laboratorium lainnya setelah disterilkan
dengan alcohol.

Bahan :
1. Sampel daun tanaman padi genotype A-396
- Sampel daun tanaman padi A-396 digunakan sebagai bahan tanaman
yang akan diisolasi dan diidentifikasi DNA nya.

4
2. Larutan CTAB 2% (Cetyl trimetil ammonium bromide), 100 mM Tris-Cl pH
8.00, 20 mM EDTA pH 8.00, 1.4 mol NaCl
- Larutan-larutan di atas digunakan sebagai buffer pengekstrak yang
mana larutan EDTA (Ethylene Diamine Tetra Acid) merupakan agen
pengkelat yang berfungsi sebagai pengikat ion-ion logam atau ion-ion
bermuatan positif seperti Ca2+ dan Mg2+ sehingga komponen-
komponen yang berada di bagian terluar membran sel akan terurai
dengan terikatnya molekul tersebut. Selanjutnya, larutan CTAB (cetyl
trimetil ammonium bromide) mempunyai fungsi untuk melisiskan
membran sel dan membran fosfolipid bilayer atau suatu larutan yang
dapat merusak membran sel menjadi suatu larutan kompleks yang
mengandung DNA. Sedangkan, larutan Tris-Cl berperan sebagai
buffer untuk menjaga pH DNA berada dalam keadaan optimum agar
dapat mengekstraksi asam nukleat.
3. Isopropanol
- Senyawa isopropanol berfungsi untuk mempresipitasikan DNA pada
fase aquoeus sehingga DNA akan menggumpal lalu membentuk
struktur fiber dan terbentuklah pellet setelah dilakukan sentrifugasi
(Switzer, 1999). Selain itu, menurut Hoelzel (1992) menyebutkan
bahwa presipitasi juga berfungsi untuk menghilangkan residu-residu
kloroform yang berasal dari tahapan ekstraksi. 
4. Etanol 70%
- Sama hal nya dengan isopropanol, pemberian etanol 70% dilakukan
agar terjadi dehidrasi DNA sehingga akan terbentuk presipitasi.
5. Kloroform
- Kloroform atau yang dikenal dengan triklorometana (CHCl 3)
merupakan senyawa dalam bentuk cairan tak berwarna, memiliki
aroma yang khas, dan mudah menguap (volatile). Kloroform berfungsi
sebagai pengekstraksi komponen yang tidak larut dalam air atau
mengekstrak dan mengendapkan komponen polisakarida di dalam
buffer ekstraksi yang mengkontaminasi larutan DNA. Misalnya dalam

5
proses isolasi DNA, dimana lipid tidak larut dalam air (hidrofobik).
Kloroform selain sebagai refrigerant juga berperan sebagai bahan
baku pada pembuatan polytetraflouroetilene (PTFE) dan flourinated
etilene propylene (FEP).
6. SDS 10% (Sodium dodesyl sulfat)
- Larutan SDS berfungsi untuk memecah dinding atau membran sel.
Dinding sel yang telah pecah menyebabkan organel-organel didalam
sel keluar termasuk protein-protein yang terdapat didalamsitoplasma,
sehingga DNA perlu dibersihkan dari pengotor-pengotor tersebut
(Sambrooket al. 1989)
7. Buffer TE
- Buffer TE (tris electrophoresis) berfungsi untuk melarutkan DNA yang
telah dihasilkan dan menjaga DNA agar tidak mudah rusak. Di dalam
buffer TE mengandung EDTA atau Ethylene Diamine Tetra Acid yang
berfungsi sebagai senyawa pengkelat pengikat ion Mg2+.

Metode :

1. Mensterilisasi alat-alat isolasi (mortal, pestel, spatula, dan gunting)


dengan menggunakan alkohol 70%, keringkan dengan menggunakan
tissue.

2. Memotong sampel kecil-kecil sebanyak kurang lebih 0,5 gram dalam


mortal,

3. Menggerus sampel dalam mortar steril yang diberi buffer ekstraksi


sebanyak 1000 μL, yang terdiri dari larutan CTAB 900 μL, lalu digerus
sampai halus

4. Menambahkan larutan SDS 100 μL pada sampel yang sudah halus, lalu
dicampur hingga merata secara perlahan-lahan.

6
5. Memasukkan hasil gerusan ke dalam tabung mikro 2 mL, lalu
menginkubasikan di dalam waterbath pada suhu 65 ̊C selama 15 menit
sambil dikocok secara perlahan setiap lima menit.

6. Melakukan pemurnian DNA melalui penambahan CIA (cloroform : isoamil


alkohol = 24 : 1) sebanyak 700 μL ke dalam tabung, lalu mengocok
tabung hingga merata.

7. Mensentrifugasi suspensi dengan kecepatan 10000 rpm selama 10 menit.

8. Selanjutnya, mengambil dan memindahkan supernatan ke dalam tabung


mikro 1,5 ml.

9. Melakukan pemekatan DNA dengan menambahkan isopropanol sebanyak


700 μL ke dalam supernatan dan mencampurnya secara perlahan.

10. Mensentrifugasi pada kecepatan 10000 rpm selama 10 menit.

11. Mencuci pelet yang telah diperoleh dengan 100 μL etanol 70%, kemudian
didiamkan selama 30 menit dalam suhu ruang.

12. Mensentrifugasi kembali campuran selama 5 menit pada kecepatan

10000 rpm suhu 4oC.

13. Mengering anginkan pelet pada suhu ruangan selama 24 jam hingga
alkohol mengering.

2.1.2 Elektroforesis
Alat :
1. Alumunium foil
- Dalam kegiatan praktikum ini, alumunium foil digunakan sebagai alas
ataupun wadah untuk meletakkan sampel loading dye
2. Pipet mikro dan pipet tip

7
- Pipet mikro (mikropipet) adalah suatu alat yang digunakan untuk
memindahkan cairan dalam jumlah kecil secara akurat.
- Pipet tip (tip mikropipet) adalah pelengkap tambahan yang berada di
ujung mikropipet dan bersentuhan langsung dengan cairan yang akan
dipindahkan atau sering dikenal sebagai mulut pipet. Fungsi tip
mikropipet adalah sebagai tempat menampung cairan sementara yang
akan dipindahkan ke alat lab lainnya.

3. Tangki elektroforesis
- Tangki elektroforesis digunakan untuk menjalankan proses
elektroforesis yang mana di dalamnya terdapat larutan buffer untuk
menjaga kondisi pH agar tetap stabil.

Bahan :
1. Gel agarose
- Gel agarose berfungsi untuk memisahkan DNA yang memiliki ukuran
lebih dari 100 bp (base pair), sedangkan dalam pemisahan DNA
dengan ukuran yang lebih pendek dapat digunakan gel poliakrilamid
(Wilson dan John, 1994). Gel agarose merupakan fase diam dalam
pemisahan fragmen DNA.
2. Loading buffer (dye)
- Loading buffer (dye) memiliki fungsi, diantaranya adalah (1)
menambah densitas, sehingga DNA berada di bagian bawah dari
sumur (well), (2) sebagai perwarna untuk memudahkan dalam
meletakkan contoh DNA ke dalam sumur, (3) penanda laju migrasi
DNA karena dapat bergerak ke arah anoda dengan laju yang dapat
diperkirakan
3. Buffer 0,5x TBE
- Tris/Borat EDTA adalah buffer yang secara umum digunakan sebagai
buffer elektroforesis karena memiliki kapasitas buffering yang tinggi
pada titik isoelektriknya (Ausubel, et al., 2003). Borat berperan dalam

8
mempertahankan kesetimbangan ion H + dan OH- yang dihasilkan
elektroda (berperan sebagai conducting ion), hal ini berhubungan
dengan fungsi buffer dalam menjaga kesetimbangan pH saat proses
migrasi fragmen DNA berlangsung.
4. Alkohol 70%
5. DNA sampel yang telah dimurnikan

Metode :

1. Menyiapkan gel agarose kemudian memindahkan gel agarose tersebut ke


dalam tangki elektroforesis.

2. Mengisi tangki elektoforesis dengan buffer 0,5x TBE sampai gel agarose
terendam.

3. Kemudian menyiapkan alumunium foil yang sudah disterilkan


menggunakan alkohol. Meneteskan 1 μL loading dye sebanyak sampel
yang dikerjakan.

4. Mengambil sampel DNA stok sebanyak 4 μL, kemudian meneteskan


sampel tersebut di atas loading dye dan mencampurkan secara merata
dengan teknik pippeting.

5. Memasukkan sampel DNA ke dalam sumur setelah tercampur dengan


loading dye DNA pada gel agarose. Setiap sampel yang berbeda
menempati sumur yang berbeda.

6. Setelah seluruh sampel DNA selesai dimasukkan ke dalam sumur-sumur


gel agarose, langkah selanjutnya adalah menutup tangki elektroforesis
dan memasang rangkaian kabel tangki elektroforesis. Kabel bermuatan
listrik negatif berada di bagian atas sumur gel agarose, sedangkan kabel
bermuatan listrik positif berada di bagian bawah sumur gel agarose. Atur
listrik sebesar 100 V dan waktu selama 30 menit.

9
7. Menjalankan mesin elektroforesis.

8. Setelah elektroforesis selesai, memasukkan gel agarose ke dalam Gel


doc untuk melihat hasil uji kualitas DNA mengunakan elektroforesis. Hasil
visualisasi gel agarose disimpan dan siap untuk dianalisis.

2.1.3 PCR (Polymerase Chain Reaction)


Alat :
1. Tube mikro
- Tube kecil (mikro tube) berfungsi sebagai alat untuk meletakkan
bahan yang sudah dihaluskan dan juga digunakan untuk mereaksikan
bahan
2. Pipet mikro dan pipet tip
- Pipet mikro (mikropipet) adalah suatu alat yang digunakan untuk
memindahkan cairan dalam jumlah kecil secara akurat.
- Pipet tip (tip mikropipet) adalah pelengkap tambahan yang berada di
ujung mikropipet dan bersentuhan langsung dengan cairan yang akan
dipindahkan atau sering dikenal sebagai mulut pipet. Fungsi tip
mikropipet adalah sebagai tempat menampung cairan sementara yang
akan dipindahkan ke alat lab lainnya.
3. Sentrifus/Centrifuge
- Centrifuge atau sentrifus adalah alat yang digunakan untuk
memisahkan sampel berdasarkan berat jenis pada kecepatan tinggi.
Fungsi dari centrifuge adalah untuk memisahkan partikel padat dan
partikel cair dalam suatu larutan yang mana partikel zat cair yang
memiliki massa lebih berat akan bergerak ke bagian bawah tabung,
sedangkan partikel yang memiliki partikel zat yang lebih cair dan
ringan akan berada di bagian atas tabung.

Bahan :
1. Nuclease free water 9,5 mikroliter
2. DNA template 1 mikroliter

10
- Fungsi DNA templat dalam proses PCR adalah sebagai cetakan
dalam pembentukan molekul DNA baru yang sama. Templat DNA
dapat berupa DNA kromosom, DNA plasmid, ataupun fragmen DNA
apapun asalkan di dalam DNA templat tersebut mengandung fragmen
DNA target yang dituju.
3. Primer F 1 mikroliter dan primer R 1 mikroliter
- Dalam proses PCR, primer berfungsi sebagai pembatas fragmen DNA
target yang akan diamplifikasi serta menyediakan gugus hidroksi (OH-)
pada ujung 3’ yang diperlukan untuk proses eksistensi DNA.
4. MyTaqTM Red mix 12,5 liter
- Enzim polimerase DNA (Taq polymerase) berfungsi sebagai
katalisis dalam reaksi polimerisasi DNA. Enzim ini diperlukan untuk
tahap ekstensi DNA pada proses PCR. Enzim polimerase DNA yang
digunakan dalam proses PCR diisolasi dari bakteri termofilik atau
hipertermofilik sehingga enzim ini bersifat termostabil sampai
temperatur 950C
5. Buffer PCR
- Fungsi buffer PCR adalah untuk mempertahankan dan menjamin pH
medium. Secara umum, ketersediaan buffer PCR tergantung pada
jenis polimerase DNA nya. Penggunaan jenis buffer PCR dipengaruhi
oleh DNA target yang akan diamplifikasi

Metode :
- Menyiapkan alat dan bahan (komponen) yang diperlukan untuk kegiatan
PCR
- Mencampurkan semua komponen yang sudah dibuat ke dalam tabung
(menjadi cocktail).
- Setelah semuanya tercampur, melakukan sentrifugasi mikrotabung dalam
waktu singkat sekitar satu menit.
- Lalu, memasukkan sampel dalam mesin PCR serta mengatur program
PCR yang akan digunakan, sebagai berikut :

11
a. Program Siklus Running PCR

Tahap Primer
Bradbury
Suhu Waktu Siklus
Pre-denaturasi 950 5’
Denaturasi 950 1’ 350C
Annealing 580 30”
Extension/Elongation 720 1’
Final 720 5’
extension/Elongation
Hold 40 ~

12
b. Primer yang digunakan

Primer Sequence (5’ to 3’) Penanda Karakter


External Sense TTGTTTGGAGCTTGCTGATG Aromatik
Primer (ESP)

Internal Fragrant CATAGGAGCAGCTGAAATATATACC


Antisense Primer
(IFAP)
Internal Nonfragrant CTGGTAAAAAGATTATGGCTTCA Non aromatik
Sense Primer
(INSP)
External Antisense AGTGCTTTACAAAGTCCCGC
Primer (EAP)

13
BAB III
HASIL

.1 Isolasi
Dalam kegiatan isolasi DNA terbagi menjadi tiga tahap, diantaranya adalah :
1. Ekstraksi DNA
Berikut merupakan hasil ekstraksi DNA tanaman padi genotipe A396

Proses
Tabung yang berisi
penggerusan
sampel DNA yang telah
Proses penggerusan sampel daun
diekstraksi dengan
sampel daun tanaman tanaman padi A-
penambahan larutan SDS
padi A-396 396 yang telah
diberi larutan
CTAB dan larutan
SDS

14
2. Purifikasi DNA

Supernatan yang telah diperoleh Supernatan yang telah dipisahkan ke


dari proses purifikasi menggunakan dalam tabung mikro dari tabung
chloroform yang sudah sebelumnya
disentrifugasi

3. Presipitasi DNA

15
Pellet yang telah diperoleh dari proses presipitasi menggunakan larutan
isopropanol berupa ethanol

.2 Uji kualitas DNA dengan elekroforesis


Kualitas DNA dengan elektroforesis diukur menggunakan mesin
spectrophotometer dengan panjang gelombang A260 dan A280. Jumlah radiasi
UV yang diserap (absorbance=A) oleh larutan DNA akan sebanding dengan
jumlah DNA dalam sampel yang diukur. Berikut merupakan tabel hasil
pengukuran kuantitas dan kualitas DNA dengan elektroforesis :

1. Sampel A 2. Sampel B

Diketahui : Diketahui :
- Nilai A260 = 0,395 - Nilai A260 = 0,550
- Nilai A280 = 0,200 - Nilai A280 = 0,284

Ditanya : Ditanya :
- Kualitas DNA - Kualitas DNA
- Kuantitas DNA - Kuantitas DNA
- Dilusi DNA stock - Dilusi DNA stock
- Dilusi TE buffer - Dilusi TE buffer

Jawab : Jawab :
0,395 0,550
a. Kualitas = = 1,975 a. Kualitas = = 1,936
0,200 0,284

16
Kemurnian DNA bagus Kemurnian DNA bagus
b. Kuantitas = 0,395x50x100 = 1.975 b. Kuantitas = 0,550x50x100 = 2.750
ng/μ ng/μ
c. Dilusi DNA stock = c. Dilusi DNA stock =
V1 x M1 = V2 x M2 V1 x M1 = V2 x M2
V1 x 1,975 = 100x20 V1 x 2,750 = 100x20
2000 2000
V1 = = 1,012 μ V1 = = 0,74 μ
1,975 2,750

3. Sampel C 4. Sampel D
Diketahui : Diketahui :
- Nilai A260 = 0,024 - Nilai A260 = 0,023
- Nilai A280 = 0,015 - Nilai A280 = 0,015

Ditanya : Ditanya :
- Kualitas DNA - Kualitas DNA
- Kuantitas DNA - Kuantitas DNA
- Dilusi DNA stock - Dilusi DNA stock
- Dilusi TE buffer - Dilusi TE buffer

Jawab : Jawab :
0,024 0,023
a. Kualitas = = 1,6 a. Kualitas = = 1,533
0,015 0,015
DNA kurang murni, terdapat DNA kurang murni, terdapat
kontaminasi protein kontaminasi protein
b. Kuantitas = 0,024x50x100 = 120 b. Kuantitas = 1,533x50x100 = 7.665
ng/μ ng/μ
c. Dilusi DNA stock = c. Dilusi DNA stock =
V1 x M1 = V2 x M2 V1 x M1 = V2 x M2
V1 x 120 = 100x20 V1 x 7.665 = 100x20

17
2000 2000
V1 = = 16,67 μ V1 = = 0,260 μ
120 7.665

Berdasarkan hasil pengukuran pada tabel di atas diperoleh nilai kuantitas


dan kualitas DNA pada masing-masing sampel, yaitu :
 Sampel A memiliki nilai kualitas sebesar 1,975 yang menunjukan bahwa
kemurnian DNA bagus dan nilai kuantitas sebesar 1.975 ng/μ
 Sampel B memiliki nilai kualitas sebesar 1,936 yang menunjukan bahwa
kemurnian DNA bagus dan nilai kuantitas sebesar 2.750 ng/μ
 Sampel C memiliki nilai kualitas sebesar 1,6 yang mana menunjukan
bahwa kemurnian DNA kurang bagus karena terdapat kontaminasi
protein dan nilai kuantitas sebesar 120 ng/μ
 Sampel D memiliki nilai kualitas sebesar 1,533 yang mana menunjukan
bahwa kemurnian DNA kurang bagus karena terdapat kontaminasi
protein dan nilai kuantitas sebesar 7.665 ng/μ

Nilai kemurnian DNA yang diperoleh disesuaikan dengan literatur, yakni


antara 1,8-2,0. Apabila nilainya kurang dari 1,8 maka sampel DNA masih
mengandung kontaminan. protein dan untuk menghilangkannya dapat
ditambahkan protease. Apabila nilai kemurniannya lebih dari 2,0 maka sampel
DNA masih mengandung kontaminan RNA, dan dapat ditambahkan
ribonuklease untuk menghilangkannya (Sambrook et al. 1989).

Kualitas DNA Kelas D

Hasil Visualisasi Seleksi


Aromatik Kelas D

18
1 2 3 4 5 6 7 8 9 10 11

12 13 14 15 16 17 18 19 20 21 22 23

Hasil analisis uji kualitas DNA kelas D menunjukan bahwa sampel nomor
3,4,6,8,10,11,13,14,15,16,17,18,19,20,21 dan 22 memiliki kualitas DNA yang
lebih bagus dibadingkan dengan sampel lainnya. Hal ini ditunjukkan oleh
fragmen yang terbentuk terlihat tebal dan dapat dibedakan walaupun masih
terdapat smear. Sementara itu, sampel DNA dengan nomor 1,2,5,7,9 dan 12
memiliki fragmen DNA yang tipis dan terdapat smear sehingga sampel DNA
yang terbentuk kurang jelas.
Berdasarkan gambar di atas ditunjukkan bahwa hasil visualisasi kualitas
DNA dengan elektroforesis yang dimiliki oleh kelompok 3 sampel ke-2 memiliki
kualitas DNA yang baik. Hal ini disebabkan karena kemurnian DNA yang
diperoleh berada pada range antara 1,8-2,0. Kualitas DNA yang baik
ditunjukkan oleh terbentuknya pola pita DNA yang jelas dan tebal.

.3 Seleksi Aromatik

19
Hasil Visualisasi Seleksi Aromatik Tanaman Padi

Berdasarkan gambar hasil visualisasi PCR seleksi aromatic pada


tanaman padi di atas didapatkan bahwa terdapat sembilan buah pasang pola
pita DNA yang memiliki pola gen heterozigot sebagai hasil kombinasi dari
kedua tetua tanaman padi yang mengindikasikan bahwa varietas/genotype
tanaman padi positif mengandung gen aromatic. Namun, jika pola pita yang
terbentuk hanya satu pita maka genotype/varietas tanaman padi tersebut tidak
mengandung gen aromatic.

Hasil Analisis Seleksi Aromatik Seluruh Kelas

Kelas A Kelas D
1 2 3 4 5 6 7 8 9 10 11

12 13 14 15 16 17 18 19 20 21 22 23

20
1 2 3 4 5 6 7 8 9 10 11 12 13

14 15 16 17 18 19 20 21 22 23 24 25 26

Berdasarkan gambar hasil seleksi


didapatkan bahwa terdapat gen
pengendali aromatik pada sampel nomor Berdasarkan gambar hasil seleksi di atas,
13 dan 14. Hal ini disebabkan karena didapatkan gen pengendali aromatik
posisi fragmen DNA yang sama dengan pada sampel nomor
hasil analisis padi pandan wangi atau 7,8,9,11,14,15,16,17,18,19,20,21,22,23
memiliki pola gen heterozigot dengan dua karena memiliki posisi fragmen yang
buah pita. sama dengan hasil analisis padi pandan
wangi atau memiliki pola gen heterozigot
dengan dua buah pita.

Kelas B Kelas E
1 2 3 4 5 6 7 8 9 10 11 12
13

21
1 2 3 4 5 6 7 8 9 10 11 12
13

14 15 16 17 18 19 20 21 14 15 16 17 18 19 20 21 22 23 24 25 26

Berdasarkan gambar di atas, tidak Berdasarkan gambar seleksi di atas,


terdapat sampel tanaman padi yang didapatkan gen pengendali aromatik
mengandung gen pengendali aromatic. pada sampel tanaman padi nomor
Hal ini disebabkan tidak adanya sampel 5,7,8,9,24,25,26 karena memiliki posisi
DNA yang memiliki posisi fragmen yang fragmen yang sama dengan hasil analisis
sama dengan hasil analisis padi pandan padi pandan wangi atau memiliki pola
wangi atau memiliki pola gen heterozigot gen heterozigot dengan dua buah pita.
dengan dua buah pita.
Kelas C Kelas F

1 2 3 4 5 6 7 8 9 10 11 12
13 1 2 3 4 5 6 7 8 9 10 11 12
13

14 15 16 17 18 19 20 21 22 23 24 25 26
14 15 16 17 18 19 20 21 22 23 24 25 26

Berdasarkan gambar seleksi di atas, Berdasarkan gambar seleksi di atas,


didapatkan gen pengendali aromatik didapatkan gen pengendali aromatik yang
pada sampel nomor 1,4,5,6,7,8,9,10,14 ditunjukkan pada sampel nomor 19 dan
karena memiliki posisi fragmen yang 20 karena memiliki posisi fragmen yang
sama dengan hasil analisis padi pandan sama dengan hasil analisis padi pandan
wangi atau memiliki pola gen heterozigot wangi atau memiliki pola gen heterozigot

22
dengan dua buah pita. dengan dua buah pita.

Kelas G

1 2 3 4 5 6 7 8 9 10 11 12
13

14 15 16 17 18 19 20 21 22 23 24 25 26

Berdasarkan gambar seleksi di atas, didapatkan gen pengendali aromatik yang


ditunjukkan hanya pada sampel nomor 18 karena memiliki posisi fragmen yang sama
dengan hasil analisis padi pandan wangi atau memiliki pola gen heterozigot dengan
dua buah pita.

BAB IV
PEMBAHASAN

23
4.1 Diskusi/Pembahasan
A. Isolasi

- Ekstraksi DNA
Ekstraksi DNA merupakan tahap merusak dinding sel secara
mekanik dengan cara ditumbuk menggunakan mortar dan pestle yang
mana selanjutnya akan diekstraksi secara kimiawi menggunakan larutan
SDS dan CTAB. Tujuan dari ekstraksi DNA ini yaitu untuk membantu
dalam proses perusakan/lisis dinding sel dengan cara menghilangkan
molekul lipid yang dapat menyebabkan kerusakan pada membrane
sehingga molekul-molekul (protein, DNA, dan RNA) yang berada di dalam
sel dapat keluar. Larutan SDS dan CTAB menyebabkan rusaknya
membrane sel, melalu ikatan yang dibentuk pada sisi hidrofobik deterjen
dengan protein dan lemak pada membrane membentuk senyawa lipid
protein deterjen kompleks. Senyawa pada kedua larutan tersebut dapat
terbentuk karena protein dan lipid memiliki ujung hidrofilik dan hidrofobik
(Syafaruddin dan Santoso, 2011).

Tabung yang berisi


sampel DNA yang telah
Proses penggerusan diekstraksi dengan
Proses penambahan larutan SDS
sampel daun tanaman
penggerusan
padi A-396
sampel daun
tanaman padi A-

24
396 yang telah
diberi larutan
CTAB dan larutan
SDS

- Purifikasi DNA
Purifikasi DNA merupakan tahap pemurnian DNA yang dilakukan
dengan penambahan CIA (chloroform isoamyl alcohol). Chloroform
merupakan suatu pelarut organik yang dapat melarutkan protein, lipid, dan
molekul lain seperti polisakarida, sehingga diharapkan dapat diperoleh
supernatan yang mengandung DNA yang bebas kontaminan (Syafaruddin
dan Santoso, 2011). Selanjutnya, dilakukan sentrifugasi yang bertujuan
untuk memisahkan molekul berdasarkan berat jenisnya atau memisahkan
molekul DNA total dari komponen sel lainnya (Sulandari & Zein, 2003).

Supernatan yang telah diperoleh Supernatan yang telah dipisahkan ke


dari proses purifikasi menggunakan dalam tabung mikro dari tabung
chloroform yang sudah sebelumnya
disentrifugasi

25
- Presipitasi DNA
Presipitasi DNA merupakan tahap pemekatan DNA dengan
penambahan larutan isopropanol. Penambahan larutan isopropanol akan
menurunkan ativitas molekul air dan menghilangkan molekul air dalam
larutan DNA sehingga DNA akan terpresipitasi. Pada tahapan presipitasi
ini, DNA yang terpresipitasi akan terpisah dari residu-residu RNA dan
protein yang masih tersisa. Residu tersebut juga mengalami koagulasi
akan tetapi tidak membentuk struktur fiber dan berada dalam bentuk
presipitat granular. Pada saat etanol atau isopropanol dibuang dan pellet
dikering anginkan dalam tabung, maka pellet yang tersisa dalam tabung
adalah DNA pekat. Kemudian dilakukan proses presipitasi kembali
dengan etanol atau isopropanol sebelum pellet dikeringanginkan yang
berfungsi dalam peningkatan derajat kemurnian DNA yang diisolasi
(Bettelheim dan Landesberg, 2007). Keller dan Mark (1989) menerangkan
bahwa pencucian kembali pellet yang dipresipitasi oleh isopropanol
dengan menggunakan etanol bertujuan untuk menghilangkan residu-
residu garam yang masih tersisa atau tertinggal. Garam-garam yang
terlibat dalam proses ekstraksi bersifat kurang larut dalam isopropanol
sehingga dapat terpresipitasi bersama DNA. Oleh karena itu menurut
Ausubel et al (2003) dibutuhkan presipitasi kembali dengan etanol setelah
presipitasi dengan isopropanol untuk menghilangkan residu garam.

26
Pellet yang telah diperoleh dari proses presipitasi menggunakan larutan
isopropanol berupa ethanol

B. Uji Kualitas DNA dengan Elektroforesis

1 2 3 4 5 6 7 8 9 10 11

Hasil Visualisasi Seleksi


Aromatik Kelas D

12 13 14 15 16 17 18 19 20 21 22 23

Berdasarkan hasil uji kualitas DNA dengan elektroforesis pada kelompok


3 diperoleh bahwa dari sampel DNA ke-2 memiliki kualitas DNA yang baik. Hal
ini ditunjukkan dengan terbentuknya pola pita DNA yang terlihat jelas dan tebal.
Kemurnian DNA juga dapat ditentukan oleh kualitas suatu DNA. DNA yang tidak
mengandung kontaminan akan memiliki kualitas yang baik sebab DNA akan
terpotong oleh enzim restriksi secara sempurna. Kontaminan yang terkandung

27
di dalam DNA dapat mengganggu kinerja enzim restriksi dalam memotong
DNA.
Kualitas dan kuantitas DNA hasil isolasi tanaman padi diuji menggunakan
spektrofotometer yang mana uji kuantitatif dilakukan untuk mengukur
konsentrasi DNA dan uji kualitatif dilakukan untuk mengetahui kemurnian suatu
DNA atau ada tidaknya kontaminan protein dan RNA pada DNA hasil isolasi. Uji
kualitatif kemurnian suatu DNA diperoleh dari nilai perbandingan absorban
A260/280 yang mana menurut Sambrook dan Rusell (1989) nilai kemurnian
DNA berkisar antara 1,8-2,0.
Pada dasarnya, kualitas fragmen hasil amplifikasi yang terbentuk
merupakan dampak dari suatu konsentrasi DNA (Haris et al. 2003). Fragmen
yang sangat tipis pada gel atau bahkan tidak terlihat secara visual disebabkan
oleh konsentrasi DNA yang terlalu rendah, sebaliknya fragmen yang terlihat tebal
disebabkan karena konsentrasi DNA yang terlalu tinggi sehingga sulit dibedakan
antara satu fragmen dengan fragmen lainnya.
Adapun dua faktor yang mempengaruhi konsentrasi hasil ekstraksi DNA
diantaranya adalah kecepatan ekstraksi pada waktu ekstraksi dan komposisi
penambahan lisis buffer. Faktor yang paling berpengaruh terhadap konsentrasi
hasil ekstraksi DNA adalah kecepatan ekstraksi. Hal ini disebabkan karena pada
tahap lisis sel dan presipitasi pengambilan supernatant yang telah diperoleh
harus dilakukan per sampel, sehingga beberapa sampel terjadi pengendapan
DNA (Komalasari, 2009).
Sehingga dapat disimpulkan bahwa, berdasarkan hasil interpretasi kualitas
DNA kelas D didapatkan jumlah sampel kualitas DNA yang baik sebanyak 16
sampel.

C. Seleksi Aromatik
Berdasarkan hasil visualisasi padi aromatic dan non aromatic melalui
proses PC dapat dilihat pola gen heterozigotnya melalui pola pita hasil
amplifikasi yang diperoleh melalui elektroforesis gel agarose. Pola gen
heterozigot memiliki dua buah pita yang merupakan gabungan dari kedua tetua

28
tanaman padi yang mana pola gen heterozigot tersebut mengindikasikan hasil
elektroforesis tanaman padi yang positif memiliki gen aromatic yakni gen badh2.
Jika dilihat gambar hasil visualisasi PCR di bawah ditunjukkan bahwa terdapat
sembilan pasang pola pita yang menunjukkan gabungan dari kedua tetua
tanaman padi yang berarti pola gen heterozigot tersebut positif memiliki gen
aromatic. Sedangkan, tanaman yang tidak mengandung gen aromatic hanya
memiliki satu buah pita. Seleksi PCR tanaman padi aromatic dan non aromatic
dilakukan menggunakan pasangan primer yang dikembangkan oleh Bradbury et
al. (2005) yang mempengaruhi bentuk dari pola pita hasil PCR yang mana
pasangan primer yang digunakan antara lain External Sense Primer (ESP) dan
External Antisense Primer (EAP) yang merupakan primer eksternal, serta
Internal Fragrant Antisense Primer (IFAP) dan Internal Non-fragrant Sense
Primer (INSP) sebagai internal primer. Empat buah primer tersebut akan
menempel secara spesifik pada sekuen DNA padi.
Dua primer yakni EAP dan ESP akan menempel pada varietas padi
aromatic dan non aromatic yang mana keduanya berperan sebagai positif
control dan menghasilkan ukuran pita kurang lebih sebesar 580 bp (Bradbury et
al. 2005). Sedangkan, dua primer lainnya yakni IFAP dan INSP akan menempel
secara spesifik pada salah satu varietas padi apabila dipasangkan dengan dua
primer lainnya. Pasangan primer IFAP dan ESP akan menempel pada sekuen
padi aromatic dan menghasilkan ukuran pita DNA sepanjang 257 bp,
sedangkan untuk pasangan primer INSP dan EAP akan menempel pada
sekuen padi non aromatic dan menghasilkan ukuran pita DNA sepanjang 355
bp (Bradbury et al. 2005).

29
1 2 3 4 5 6

27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52

Gambar Hasil Visualisasi PCR Seleksi Tanaman Padi Aromatik dan


Nonaromatik
Keterangan gambar :

1 = ladder; 2 = kitake; 3 = pandan wangi; 4 = ptb; 5 = ciapus;


6 sampai 52 = F2

Jika dilihat dari gambar di atas bahwa sampel tanaman padi F2 yang
memiliki gen pengendali aromatik yaitu terdapat pada sampel tanaman padi
nomor 33-40. Hal tersebut diindikasikan karena sampel-sampel padi tersebut
memiliki ladder yang sama dengan sampel padi nomor 3 yaitu pandan wangi
atau terbentuknya pola gen heterozigot yang mengindikasikan bahwa tanaman
padi tersebut positif memiliki gen aromatik. Padi pandan wangi memiliki gen
pengendali aromatic. Berdasarkan hasil analisis visualisasi elektroforesis,
sampel padi yang memiliki gen pengendali aromatic yaitu sejumlah 35 dari 136
keseluruhan sampel.

Aroma khas yang terdapat pada tanaman padi disebabkan oleh suatu
senyawa yang dikenal dengan senyawa volatil 2 acetyl-1pyrroline (2AP), yang

30
mana senyawa tersebut juga ditemukan pada bagian kalus dan organ vegetatif
tanaman padi (Yoshihashi et al. 2002). Banyak penelitian yang menunjukkan
bahwa aroma pandan beras aromatik dipengaruhi oleh gen pada kromosom 8,
seperti yang terdapat pada varietas Surjarmkhi (Bangladesh), Della (Amerika),
dan Azucena (Filipina). Adapun beberapa penelitian yang telah menyebutkan
dan menjelaskan bahwa sifat aromatik dikendalikan oleh gen yang bersifat
single ressesive gene (Berner dan Hoff 1986; Vivekenandan dan Gridharan,
1994 dalam Patil et al., 2012).

31
DAFTAR PUSTAKA

Ahda, Yuni., I.R. Muharni, dan D.H. Putri. 2012. Kualitas DNA Hasil Isolasi dari
Beberapa Bagian Batang Rambut untuk Bahan Analisis DNA Forensik.
Eksakta, Vol. 1.

Ausubel, F. M. et al. 2003. Current Protocols in Molecular Biology. USA: John Wiley &
Sons, Inc.

Bettelheim, F. A. & Landesberg, J. M. 2007. Laboratory Experiments for General,


Organic, and Biochemistry, 6th edition. Chaput, J.C. ISBN-13:
9780495015048.

Bradbury, L.M.T., Fitzgerald, T.L., Henry, R.J., Jin, O., and Waters, D.L.E. 2005a. The
gene for fragrance in rice. The Plant Biotechnology Journal,Vol.(3): 363-370.

Carsono, Nono., I.N. Indrayani, G.I.Prayoga, dan Santika Sari. 2019. Modul Penuntun
Praktikum Bioteknologi Tanaman. Fakultas Pertanian Universitas
Padjadjaran.

Haris, N., Hajrial. A, Nurita. T.M, dan Agus. P. 2003. Kemiripan genetik klon karet
(Hevea brasiliensis Muell Arg.) berdasarkan metode amplified fragment
length polymorphisms (AFLP). Menara Perkebunan 71(1): 1-15.

Keller, G. H & Mark M. M. (1989). DNA Probe. Macmilan: University Michgan.

Nasodikin, M. 2013. Identifikasi Gen Aroma pada Padi BC5F1 Ciherang Pandan Wangi
dan BC2F1 Ciherang Mentik Wangi. Bogor : Institut Pertanian Bogor.

32
Sambrook J, Russell DW. 1989. Molecular Cloning: A Laboratory Manual. Ed ke-2. New
York: Cold-Spring Harbor Laboratory Pr.

Sugihartati. 2010. Aplikasi Marka Aromatik Bradbury dan RM 223 untuk Identifikasi
Hasil Persilangan Ciherang-Mentik Wangi dan Ciherang-Pandang Wangi.
Skripsi. Bogor : Institut Pertanian Bogor.

Sulandari S, M. Zein. 2003. Panduan Praktis Laboratorium DNA. Bidang Zoologi Pusat
Penelitian Biologi. Lembaga Ilmu Pengetahuan Indonesia.

Syafaruddin, dan T. J. Santoso. 2011. Optimasi teknik isolasi dan purifikasi DNA yang
efisien dan efektif pada kemiri sunan (Reutalis trisperma (Blanco) Airy Shaw).
Jurnal Litri, 17(1): 11-17.

Yusuf, Zuhriana K. 2010. Polymerase Chain reaction (PCR). Saintek, Vol. 5 No. 6.

33
DOKUMENTASI
-

1. ALAT DAN BAHAN ISOLASI DNA

Spatula, gunting, dan


Mortar dan pestle Centrifuge
sampel daun tanaman padi

Water bath
Mikro pipet Botol spray

34
Pipet tip

Pipet tip Wadah mikro tube

Mikro tube
Larutan SDS Larutan CIA

35
Larutan alcohol 70%
Gelas ukur Larutan isopropanol

2. ALAT DAN BAHAN PCR (POLYMERASE CHAIN REACTION) SERTA


ELEKTROFORESIS

Loading dye pada


Gel agarose Mikro tube
alumunium foil

36
Tangki elektroforesis Elektroforensis power My Taq Polymerase
supply

Centrifuge
Nucleus free water

37