Cancer Investigation, 27:901–908, 2009

ISSN: 0735-7907 print / 1532-4192 online

Copyright

c Informa Healthcare USA, Inc.
DOI: 10.3109/07357900801946679

ORIGINAL ARTICLE
Cellular and Molecular Biology

Enhanced MDR1 Expression and Chemoresistance of

Cancer Stem Cells Derived from Glioblastoma
Eiichi Nakai, MD, Kaechang Park, MD, Toshio Yawata, PhD, Takahiro Chihara, MR, Ayano Kumazawa, MS, Hiromichi
Nakabayashi, MD, and Keiji Shimizu, MD
Department of Neurosurgery, Medical School, Kochi University, Kochi, Japan

ABSTRACT
We established a cancer stem (CS) cell line, U87CS, by means of spheroid culture of U87MG
cells derived from glioblastoma (GBM) in neuronal stem cell medium. U87CS cells presented
positive immunohistochemical staining for multidrug resistance (MDR)1 and CD133, a marker
for a subset of leukemia and GBM CS cells. The gene expression of MDR1 and CD133 on
U87CS cells increased by an average of 8.51 and 47.18 times, respectively, compared to the
levels on U87MG cells by real-time quantitative RT-PCR. U87CS cells possessed stronger
drug-resistance to conventional anti-cancer drugs, such as doxorubicin (Dox), etoposide
(VP-16), carboplastin, and BCNU than U87MG cells. Double immunofluoresence staining
showed co-expression of MDR1 and CD133 on U87CS cells transplanted into nude mice
brains. In addition, we identified the crossreactivity of CD133 and MDR1 in a surgical specimen
of GBM. Our results suggest that CS cells may be resistant to current chemotherapy and
represent a novel target for GBM therapeutics.

INTRODUCTION cells and sometimes express neuronal markers, as well as glial

markers. The evidence provides an attractive hypothesis that
Glioblastomas (GBMs) remain the most malignant primary GBMs possess multipotent neuronal stem cell-like characteris-
brain tumors because the median survival time is almost 12 tics. Recently, several groups identified cancer stem (CS) cells
months, and the prognosis has not changed during the past 20 in malignant brain tumors including GBMs (4–6). These groups
years, regardless of surgical removal, radiation and chemother- used CD133, a marker of a subset of neuronal stem cells, to
apy (1–3). This situation warrants the need for a new therapeutic isolate CS cells from surgical specimens and GBM cell lines,
strategy. including U87MG cells, and subsequently demonstrated their
GBMs frequently recur or progress as focal masses after capacity for unlimited self-renewal, as well as their ability to
multimodality therapy, suggesting that a subpopulation of tu- initiate and drive tumor progression in animal models. Galli
mor cells may be responsible for regrowth. On the other hand, et al. reported the isolation of tumorigenic and stem-like neu-
GBMs often contain both undifferentiated and differentiated ronal precursors from the GBM cell line U87MG cells (7).
Another characteristic of CS cells is the significant expression
of ATP-binding cassette (ABC) transporter genes (8–10). ABC
transporter proteins function to pump drugs and toxins into
Keywords: Cancer stem cell, glioblastoma,
MDR1, chemoresistance
the extracellular space and are known as multidrug resistant
Correspondence to: proteins. We also established a CS cell line, U87CS, positive
Kaechang Park, MD for CD133 by spheroid culture of U87MG cells in neuronal
Department of Neurosurgery, stem cell medium. We hypothesized that CS cells are causative
Medical School, Kochi University of clinical resistance to chemotherapeutic agents in malignant
Kohasu, Okohcho, Nankokushi,
Kochi 783–8505,
brain tumors such as GBM. In the present study, we examined
Japan the expression of multidrug resistant proteins in CS cells and
tel: +81-88-880-2397, drug resistance to conventional chemotherapeutic agents. Fur-
fax: +81-88-880-2400 thermore, we elucidated co-expression of CD133 and multidrug
e-mail: park@kochi-u.ac.jp resistant proteins in surgical specimens of GBM.

901
 MATERIALS AND METHODS
Cells, animals, and tumor specimens
U87MG, a cell line of GBM, was obtained from Ameri-
can Type Culture Collection (ATCC, Manassas, Massachusetts,
USA) and cultured in DMEM containing 10% heat-inactivated
fetal bovine serum (FBS). U87MG cells were cultured in neu-
ronal stem cell (NSC) medium, serum-free DMEM contain-
ing 10 ng/mL EGF, 10 ng/mL bFGF and 10 ng/mL LIF.
U87MG cells became spheroids U87CS cells through long
term culture in NSC medium. Xenograft brain tumors were
produced by transplantation of U87CS cells into nude mice
brains. The brain tumors were removed 3 weeks after the
transplantation and were sliced for immunochemical study.
All animals were obtained from CLEA Japan, Inc., (Tokyo,
Japan) and maintained in standard conditions according to
the Institutional guidelines. Written informed consent was ob-
tained from patients prior to tumor specimen collection. The
Ethics Committee of Kochi Medical School approved this
study.
Immunohistochemistry
Formalin-fixed, paraffin-embedded sections were deparaf-
finized in xylene and dehydrated through ethanol baths. The
slides were pretreated with citrate buffer (10 mM citric acid,
pH 6.0) for 10 min at 100◦ C in a microwave. The endogenous
peroxidase activity was blocked by incubating the sections for
10 min with 3% H2 O2 in methanol. The sections were pretreated
with a blocking serum for 20 min and then incubated with anti-
CD133 antibody (rabbit polyclonal IgG; 1: 100; Abcam Inc,
Cambridge, Massachusetts, USA) or goat anti-human MDR1
antibody, JSB-1(Monosan, the Netherlands) for 60 min. After
washing, the slides were incubated for 30 min with biotinylated
goat anti-mouse IgG (Cedarlane, Canada) and then with avidin–
biotin–peroxidase complex (Vector Laboratories, Burlingame,
CA, USA). Finally, the peroxidase activity was visualized with
0.02% 3,30-diaminobenzidine and 0.005% H2 O2 . After CD133
or MDR1staining, the preparations were counterstained with
hematoxylin.
Immunofluorescence staining
To examine CD133 protein expression, a marker of can-
cer stem cells, immunofluorescence staining was performed as
previously described (4). Briefly, cells growing in pre-coated
chamber slides were fixed with 4% paraformaldehyde for 15
min at room temperature, treated with 10% normal goat serum,
and then stained with anti-CD133 antibody. In addition, JSB-1
was used for immunofluoresence staining of human MDR1 pro-
teins. The primary antibodies were detected with Alexa fluor 568
goat anti-rabbit IgG for CD133, and with Alexa fluor 488 goat
anti-mouse IgG for MDR1 (1: 250; Molecular Probes, Eugene,
Oregon, USA).
902 E. Nakai et al.
RT-PCR
The expression of mRNA of CD133, multidrug resistance
(MDR)1, multidrug resistance-associated protein (MRP)1, and
MRP2 were determined by RT-PCR. The primers for RT-PCR
were chosen as follows: ATGACAAGCCCATCACAACA (F)
and AGCACTACCCAGAGACCAATG (R) of CD133, CCCAT-
CATTGCAATAGCAGG (F) and TGTTCAAACTTCTGCTC-
CTGA (R) of MDR1, ATGTCACGTGGAATACCAGC (F)
and GAAGACTGAACTCCCTTCCT (R) of MRP1, ACAGAG-
GCTGGTGGCAACC (F) and ACCATTACCTTGTCACT-
GTCCATGA (R) of MRP2, and AACTCCATCATGAAGTG-
TACG (F) and GATCCACATCTGCTGGAAGG (R) of β-actin
gene. RNAs were isolated from the cultured cells using an RNA
isolation kit (QIAGEN, Santa Clarita, California, USA) and
were reverse-transcribed with oligo dT primer using the super-
script II first strand cDNA synthesis kit (Invitrogen, Carlsbad,
California, USA). cDNAs were amplified using AmpliTaq Gold
(Applied Biosystems, Foster City, California, USA), according
to the manufacturer’s instructions, and the products were visu-
alized by agarose electrophoresis. For quantification of CD133
mRNA, real-time PCR was performed with initial denaturation
at 94◦ C for 10 min, followed by 45 cycles of 20 sec at 94◦ C,
20 sec at 57◦ C, 20 sec at 72◦ C and 84◦ C at 20 sec by using the
LightCycler system (Roche, Switzerland) and Quantitect SYBR
Green PCR Kit (QIAGEN).
Drug sensitivity of U87MG and U87CS cells
Doxorubicin (Dox), etoposide (VP-16), 1,3 bis-(2-
chloroethyl)-1-nitrosourea (BCNU), and carboplastin were ob-
tained from Sigma (Sigma Chemical Co., St Louis, Missouri,
USA). The sensitivity of U87MG and U87CS cells to ADM,
VP-16, BCNU and carboplastin was tested using 3-(4,5-
dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
assay (11). Briefly, cells in the logarithmic growth phase were
seeded in a volume of 100 µL at 2 ×103 cells/well in 96-well
plates, and drugs were added to another 10 µL of medium. After
incubation at 37◦ C for 72 h the medium was removed from each
well, 15 µL MTT solution (2 mg/mL) were added, and the plates
were incubated at 37◦ C for 4 h. The reaction was stopped by the
addition of 100 µL of Isopropanol/HCl, and the absorbance at
540 nm was quantified using a microtiter plate spectrophotome-
ter. Drug sensitivity was expressed as the cell survival rate; ratio
of the absorbance of a given drug concentration to that of no
drug. All drug concentrations were tested in triplicate wells
in each experiment, and five independent experiments were
performed.
Statistical analysis
The data are expressed as mean ±standard deviation (SD).
Statistical analysis was performed using the unpaired t-test.
Statistical significance was considered when p < 0.05.
 RESULTS
Production of CD133 positive cancer stem
cells from U87MG cells
U87MG cells were originally spindle-shaped and attached
to culture dishes in 10% FBS/DMEM medium (Fig. 1a) and in
turn became floating spheroids after they were switched to NSC
medium and culture was maintained for more than one month
(Fig. 1b). CD133 has been identified as a useful marker of a
subset of glioblastoma stem cells and was enviously positive on
U87CS cells (Fig. 1c) (4, 5).
Expression of CD133 and ABC transporter
genes on U87CS cells
We qualitatively examined the expression of CD133 and
ABC transporter genes, MDR1, MRP1, and MRP2 on U87MG
and U87CS cells by RT-PCR (Fig. 2a). The expression of
CD133 and MDR1 was significantly greater on U87CS cells
than on U87MG cells. There was no significant difference
between U87MG cells and U87CS cells in the expression
Figure 1. Morphology and immunohistochemical study of U87MG and U87CS cells. a) Optical microscopic view of U87MG cells. Magnitude: ×
100; b) optical microscopic views of U87CS cells. Magnitude: ×100; Immunofluorescence staining of U87CS cells with c) CD133 and d) DAPI.
Magnitude: ×100.
MDR1 Expression and Chemoresistance of Glioma Stem Cells
of MRP1. In addition, the expression of MRP2 was not de-
tected in either U87MG or U87CS cells. We then quantita-
tively examined the differences between U87MG and U87CS
cells in the expressions of CD133 and MDR1 with real-
time RT-PCR (Fig. 2b, 2c). CD133 and MDR1 expression
increased by an average of 47.18 and 8.51 times, respec-
tively, on U87CS cells, compared with U87MG cells. In par-
ticular, the expression of MDR1 expression gradually de-
creased on U87CS cells according to the duration in days af-
ter the replacement of NSC medium with 10% FBS/DMEM
medium.
Drug sensitivity of U87MG and U87CS cells
The analysis of real-time RT-PCR showed U87CS cells sig-
nificantly increased in MDR1 gene expression in comparison
with U87MG cells (Fig. 2). We examined whether up-regulation
of MDR1 expression affected the drug sensitivities of U87CS
cells compared with U87MG cells after exposure to conven-
tional chemotherapeutic agents, Dox, VP-16, carboplastin, and
BCNU. As shown in Fig. 3, U87CS cells possessed stronger
drug-resistance to all chemotherapeutic agents than U87MG
cells.
903
 Figure 2. CD133 and MDR1 expression on U87MG and U87CS cells. a) RT-PCR showing CD133, MDR1, MRP1, and MRP2 as a positive
control of β-actin. b) Real-time quantitative RT-PCR showing the difference in CD133 expression between U87MG and U87CS cells. c) Real-time
quantitative RT-PCR showing MDR1/β actin expression ratios of testis (as positive control), U87CS, differentiated U87CS for 1 day, 3 days, and
5 days, and U87MG cells.

Figure 3. Drug sensitivity of U87CS and U87MG cells by MTT assay. The perpendicular axis indicates the cell survival rate and the horizontal
axis the drug concentration. The solid lines show U87CS cells and dotted lines show U87MG cells. a) Dox, b) VP-16, c) carboplastin and d)
BCNU were administered for measurement of the cell survival rate (%). * indicates p < 0.05 compared to U87MG cells. Data are representative
of two independent experiments.

904 E. Nakai et al.

Figure 4. Immunohistochemical study of xenografts of U87CS cells into nude mice brains. a) Hematoxylin eosin staining. Magnitude: ×40.
Consecutive sections of the xenografts in the yellow square, immunohistologically staining with b) CD133: ×100 and c) MDR1: ×100. Im-
munofluorescence staining with, d) MDR1, e) CD133, f) DAPI and g) merge of MDR1 and CD133. Magnitude: ×200.

MDR1 Expression and Chemoresistance of Glioma Stem Cells 905

 Detection of CD133 and MDR1 positive cells
in intracranial xenografts of U87CS cells and
in a surgical specimen of GBM
U87CS cells possessed high tumorigenicity after intracra-
nial transplantation into nude mice brain (Fig. 4a) because a
minimum of 103 U87CS cells was required for tumor initia-
tion while 105 U87MG cells for inoculation produced no brain
tumors (data not shown). We examined the existence of both
CD133+ cells and MRD1+ cells in xenografts of mice brains
with immunohistochemical analysis (Fig. 4b, 4c). Double im-
munofluorescence staining detected CD133+ and simultaneous
MDR1 positive cells around the brain tumors (Fig. 4e, 4f, 4g).
This evidence showed that CD133+ cells were derived from
U87CS cells, and not from autologous mouse stem cells, be-
cause anti-human MDR1 antibody, JSB-1, was not crossreactive
to mouse tissue. Furthermore, we examined the crossreactivity
of CD133 and MDR1 in surgical samples of a 73-year-old male
with GBM. As shown in Fig. 5, CD133+ cells in the GBM tissue
were simultaneously reactive to MDR1 membrane antigen.
DISCUSSION
MDR1 and MRPs have been frequently described in rela-
tion to ABC transporter gene expression in GBM tissues or cell
lines (11–15). Spheroid formations observed in GBM cell lines
are also reported to be responsible for chemoresistance con-
ferred by MDR1 expression (12). From a clinical perspective,
Figure 5. Immunohistochemical study of surgical specimens of a GBM patient. a) and b) hematoxylin eosin staining. Magnitude: ×100.
Immunofluoresence staining of surgical specimen of recurrent GBM patient with c) MDR1, d) CD133 e) DAPI and f) merge of MDR1 and CD133.
Magnitude: ×200.
906
the percentage of MDR1+ cells in surgical specimens increases
with tumor malignancy from low-grade glioma to GBM (14).
These findings suggest that the existence of CS cells expressing
multidrug resistant genes may determine glioma malignancy. In
the present study, U87CS cells, which were induced by spheroid
culture of U87MG cells in NSC medium, increased MDR1 ex-
pression 8.51-fold and conversely reversed this increase to the
levels of parental U87MG cells when switched to the previ-
ous 10% FBS/DMEM medium. As shown in Fig. 3, U87CS
cells showed drug-resistance to four chemotherapeutic agents,
Dox, VP-16, carboplastin, and BCNU. Chemoresistance occurs
by several mechanisms other than drug efflux through ABC
transporters, for example, drug metabolism of inactive forms
by metallothionein (16) and gluthathioneS-transferase (17), ex-
pression of topoisomerase II, a nuclear enzyme that alters DNA
conformation (18),and expression of O6-methylguanine-DNA
methyltransferase (19). The chemoresistance of U87CS cells
may be due to enhanced expression of MDR1 although some
of these other mechanisms may also be involved. On the other
hand, Liu et al reported a drug resistance property related to
BCRP expression using three CD133 positiveCS cells derived
from primary culture cell lines of GBMs (20). Differences in
types of ABC transporters may be simply due to the differ-
ences between cell lines. They used FACS sorting to select
CD133+ cells and CS medium containing no LIF. Differences
in selection and culture conditions may be also responsible for
the diverse expression of ABC transporters. The efflux of drugs
or toxins through ABC transporters is one of the properties of
E. Nakai et al.
normal stem cells that promote a long lifespan (21, 22). Regard-
less of whichever other ABC transporters are present, MDR1
augmentation observed in U87CS cells may be responsible for
GBM developing resistance to chemotherapy.
Since we cannot obtain useful antibodies against CD133
for flow cytometric studies, we examined co-expression of
CD133 and MDR1 in an intracranial xenograft of U87CS cells
with double immunofluorescence staining. As shown in Fig. 4,
CD133+ and MDR1+ cells were found to be scattered around the
xenograft 3 weeks after transplantation. The xenograft itself was
full of CD133− and MDR1− cells showing markers of mature
U87MG cells. This evidence suggests that almost all transferred
U87CS cells could differentiate and proliferate to form solid a
tumor mass, while self-renewing and slow-growing CS cells
could exist around the mass. On the other hand, in the present
study, neovasculature was not detected around the U87CS cells
though it was present in the xenograft mass. Glioma stem cells
are reported to promote angiogenesis through vascular endothe-
lial growth factor (23). When the duration from transplantation
to decapitation is extended, angiogenesis may also be observed
around scattered U87CS cells. Although neovasculature around
U87CS cells was not observed, U87CS cells may be a useful
tool to establish animal models bearing intracranial tumors de-
rived from glioma stem cells for the purpose of elucidating the
mechanisms of invasion and dissemination of malignant brain
tumors.
As shown by Fig. 5, we detected both CD133+ and MDR1+
cells in a surgical specimen of GBM. Since U87CS cells with
enhanced expression of both CD133 and MDR1 demonstrated
in vitro drug resistance (Fig. 3), we speculated that CD133+
and MDR1+ cells should resist and survive chemotherapy in the
surgical specimen of GBM. Liu et al. (20) reported augmentation
of CD133 expression in recurrent GBM tissues in comparison
with primary GBM tissue. If the existence of CS cells reflects
on the chemoresistance of GBMs, recurrent GBM should be
composed of a higher percentage of MDR1+ cells than primary
GBM. Further clinical case studies are required to confer validity
to the correlation between the clinical prognosis of GMB and
the co-expression of CD133 and MDR1.
The mechanism of enhanced MDR1 expression in U87CS
cells remains unclear. Pluripotency of normal stem cells is as-
sumed to be due to the diversely epigenetic control of gene
expression, such as the methylation of DNA or modification
of histone proteins (24, 25). Chekhun et al. described a crucial
role of hypomethylation on the MDR1 promotor region in the
development of multidrug resistance, using MCF-7 breast ade-
nocarcinoma and Dox-resistant variant MCF-7/R cell lines (24).
Moreover, riboregulator H19, an imprinting gene, is reported to
suppress methylation of MDR1 promotor in hepatocellular car-
cinoma cells (25). In U87CS cells presenting with greater drug-
resistance than U87 MG cells, hypomethylation of the MDR1
promotor might occur, irrespective of cellular specificity. Epige-
netic regulation of MDR1 expression in CS cells might provide
a clue for elucidating key factors in the oncogenetic process
from neuronal stem cells to glioma cells.
MDR1 Expression and Chemoresistance of Glioma Stem Cells
ACKNOWLEDGEMENTS
We thank Ms. Atsuko Kataoka for assistance with flow cyto-
metric manipulation.
REFERENCES
1. Salcman, M.; Scholtz, H.; Kaplan, R.S.; Kulik, S. Long-term sur-
vival in patients with malignant astrocytoma. Neurosurgery 1994,
34, 213–219.
2. Nieder, C.; Andratschke, N.; Wiedenmann, N.; Busch, R.; Grosu,
A.L.; Molls, M. Radiotherapy for high-grade gliomas. Does altered
fractionation improve the outcome? Strahlenther Onkol 2004, 180,
401–407.
3. Shibui, S. Randomized controlled trial on malignant brain tumors-
activites of the Japan Clinical Oncology Group-Brain Tumor Study
Group. Neuro Med. Chir. (Tokyo) 2004, 44, 220–221.
4. Singh, S.K.; Clarke, I.D.; Terasaki, M.; Bonn, V.E.; Hawkins, C.;
Squire, J.; Dirks, P.B. Identification of a cancer stem cell in human
brain tumors. Cancer Res. 2003, 63, 5821–5828.
5. Singh, S.K.; Hawkins, C.; Clarke, I.D.; Squire, J.A.; Bayani, J.; Hide,
T.; Henkelman, R.M.; Cusimano, M.D.; Dirks, P.B. Identification of
human brain tumour initiating cells. Nature. 2004, 432, 396–401.
6. Yuan, X.; Curtin, J.; Xiong, Y.; Liu, G.; Waschsmann-Hogiu, S.;
Farkas, D.L.; Black, K.L.; Yu, J.S. Isolation of cancer stem cells
from adult glioblastoma multiforme. Oncogene 2004, 23, 9392–
9400.
7. Galli, R.; Binda, E.; Orfanelli, U.; Cipelletti, B.; Gritti, A.; De, Vitis
S.; Fiocco, R.; Foroni, C.; Dimeco, F.; Vescovi, A. Isolation and
characterization of tumorigenic, stem-like neural precursor from
human glioblastoma. Cancer Res. 2004, 64, 7011–7021.
8. Dean, M.; Fojo, T.; Bates, S. Tumour stem cells and drug resis-
tance. Nat. Rev. Cancer. 2005, 5, 275–284.
9. Zhou, S.; Schuetz, J.D.; Bunting, K.D.; Colapietro, A.M.; Sampath,
J.; Morris, J.J.; Lagutina, I.; Grosveld, G.C.; Osawa, M.; Nakauchi,
H.; Sorrentino, B.P. The ABC transporter Bcrp1/ABCG2 is ex-
pressed in a wide variety of stem cells and is a molecular de-
terminant of the side-population phenotype. Nat. Med. 2001,7,
1028–1034.
10. Hirschmann-Jax, C.; Foster, A.E.; Wulf, G.G.; Nuchtern, J.G.; Jax,
TW.; Gobel, U.; Goodell, M.A.; Brenner, M.K. A distinct "side popu-
lation" of cells with high drug efflux capacity in human tumor cells.
Proc. Natl. Acad Sci. USA. 2004, 101, 14228–14233.
11. Schott, B.; Bennis, S.; Pourquier, P.; Ries, C.; Londos-Gagliardi, D.;
Robert, J. Differential over-expression of mdr1 genes in multidrug-
resistant rat glioblastoma cell lines selected with doxorubicin or
vincristine. Int. J. Cancer. 1993, 55, 115–121.
12. Kolchinsky, A.; Roninson, I.B. Drug resistance conferred by MDR1
expression in spheroids formed by glioblastoma cell lines. Anti-
cancer Res. 1997, 17, 3321–3327.
13. Decleves, X.; Fajac, A.; Lehmann-Che, J.; Tardy, M.; Mercier, C.;
Hurbain, I.; Laplanche, J.L.; Bernaudin, J.F.; Scherrmann, J.M.
Molecular and functional MDR1-Pgp and MRPs expression in hu-
man glioblastoma multiforme cell lines. Int. J. Cancer. 2002, 98,
173–180.
14. Suzuki, T.; Maruno, M.; Wada, K.; Kagawa, N.; Fujimoto, Y.;
Hashimoto, N.; Izumoto, S.; Yoshimine, T. Genetic analysis of hu-
man glioblastomas using a genomic microarray system. Brain Tu-
mor Pathol. 2004,21, 27–34.
15. Benyahia, B.; Huguet, S.; Decleves, X.; Mokhtari, K.; Crinière,
E.; Bernaudin, J.F.; Scherrmann, J.M.; Delattre, J.Y. Mul-
tidrug resistance-associated protein MRP1 expression in human
gliomas: chemosensitization to vincristine and etoposide by in-
domethacin in human glioma cell lines overexpressing MRP1. J.
Neurooncol. 2004, 66, 65–70.
907
16. Romero-Isart, N.; Jensen, L.T.; Zerbe, O.; Winge, D.R.; Vasak,
M. Engineering of metallothionein-3 neuroinhibitory activity into
the inactive isoform metallothionein-1. J. Biol. Chem. 2002, 277,
37023–370238.
17. Hara, A.; Yamada, H.; Sakai, N.; Hirayama, H.; Tanaka, T.; Mori,
H. Immunohistochemical demonstration of the placental form of
glutathione S-transferase, a detoxifying enzyme in human gliomas.
Cancer 1990, 66, 2563–2568.
18. Mousseau, M.; Chauvin, C.; Nissou, M.F.; Chaffanet, M.; Plan-
taz, D.; Pasquier, B.; Schaerer, R.; Benabid, A. Study of the
expression of four chemoresistance-related genes in human pri-
mary and metastatic brain tumors. Eur. J. Cancer 1993, 29, 153–
159.
19. Cai, S.; Xu, Y.; Cooper, R.J.; Hartwell, J.R.; Pollok, K.E.; Kelley,
M.R. Mitochondrial targeting of human O6-methylguanine DNA
methyltransferase protects against cell killing by chemotherapeutic
alkylating agents. Cancer Res. 2005, 65, 3319–3327.
20. Liu, G.; Yuan, X.; Zeng, Z.; Tunici, P.; Tunici, P.; Ng, H.; Abdulka-
dir, I.R.; Lu, L.; Irvin, D.; Black, K.L.; Yu, J.S. Analysis of gene
908 E. Nakai et al.
expression and chemoresistance of CD133+ cancer stem cells in
glioblastoma. Mol. Cancer. 2006, 5, 67.
21. Singh, S.K.; Clarke, I.D.; Hide, T,; Dirks, P.B. Cancer stem cells in
nervous system tumors. Oncogene 2004, 23, 7267–7273.
22. Kondo, T.; Setoguchi, T.; Taga, T. Persistence of a small subpop-
ulation of cancer stem-like cells in the C6 glioma cell line. Proc.
Natl. Acad Sci. USA. 2004, 101, 781–786.
23. Bao, S.; Wu, Q.; McLendon, R.E.; Hao, Y.; Hao, Y.; Shi, Q.; Hjelme-
land, A.B.; Dewhirst, M.W.; Bigner, D.D.; Rich, J.N. Glioma stem
cells promote radioresistance by preferential activation of the DNA
damage response. Nature. 2006, 444, 756–760.
24. Chekhun, V.F.; Kulik, G.I.; Yurchenko, O.V.; Tryndyak, V.P.; Todor,
I.N.; Luniv, L.S, Tregubova, N.A.; Pryzimirska, T.V.; Montgomery,
B.; Rusetskaya, N.V.; Pogribny, I.P. Role of DNA hypomethylation in
the development of the resistance to doxorubicin in human MCF-7
breast adenocarcinoma cells. Cancer Lett. 2006, 231, 87–93.
25. Tsang, W.P.; Kwoko, T.T. Riboregulator H19 induction of MDR1-
associated drug resistance in human hepatocellular carcinoma
cells. Oncogene. 2007, 26, 4877–4881.