Efina 10356 Metabolisme Mikroba
Efina 10356 Metabolisme Mikroba
NIM : 19/444678/BI/10356
Judul jurnal : Anoxygenic photo- and chemo-synthesis of phototrophic sulfur bacteria from an
alpine meromictic lake
Produksi utama merupakan konversi dari energy dan karbon inorganic menjadi materi
organic oleh organisme autotroph. Produksi tak hanya fotosintesis, namun juga kemosintesis. Hal
ini biasa dilakukan mikroorganisme dalam kondisi anaerobic. Beberapa diantaranya (bakteri
belerang fototrofik anoksigenik) mampu melaksanakan fotosintesis dan kemosintesis. Sehingga
pada jurnal ini bertujuan untuk menyelidiki produksi utama dengan membandingkan aktibitas
fotosintesis dan kemosintesis dari 3 spesies bakteri belerang berbeda yang hidup di danau
meromictic (Danau Cadagno).
Danau meromictic sendiri dicirikan dengan stratifikasi kolom air permanen yang
memungkinkan pembentukan kompartemen anoksik yang stabil. Sehingga memiliki lingkungan
yang sesuai untuk menopang pertumbuhan bakteri sulfur fototrofik anoksigenik. Bakteri sulfur
fototrofik anoksigenik sendiri memiliki peran penting di lingkungan anoksik sebagai produsen
utama pengikat karbon anorganik. Mekanismenya mereka mengoksidasi foto-donor elektron
yang berbeda kemudian berkembang di lingkungan akuatik yang menyediakan cahaya, sulfida,
termasuk sedimen mata air panas dan danau air tawar.
Pada penelitian ini digunakan 2 jenis bakteri, yaitu bakteri purple sulfur bacteria (PSB)
dan green sulfur bacteria (GSB). Secara ekologi, keduanya mirip namun berbeda jauh secara
filogenetik karena keduanya meskipun berada di lingkungan yang sama tetapi memiliki strategi
evolusioner berbeda. Dilihat dari pigmen penangkap cahaya, GSB memiliki struktur klorosom
yang memberikan afinitas lebih tinggi dengan intensitas cahaya lebih rendah dibanding PSB.
Perbedaan kedua yaitu cara kedua jenis mikroba tersebut mengakumulasi globula sulfur di dalam
dan diluar sel. Ketiga, strategi evolusi yang berbeda dapat ditemukan bahkan dalam kelompok
yang sama.
Sampel penelitian diambil dari Danau Cadagno yang terletak di Lembah Piora pada
ketinggian 1921 meter di atas permukaan laut, di pegunungan Alpen Swiss bagian selatan
(46◦33’ N, 8◦43 E dan kedalaman sekitar 21 m). Akan diambil sampel dari danau tersebut,
kemudian dipilih 3 strain bakteri. Bakteri yang dipilih yaitu dari strain bersel besar, motil oleh
flagela PSB C. okenii strain LaCa, strain PSB T. syntrophicum sel kecil Cad16T dan strain GSB
Chlorobium phaeobacteroides 1VII D7. Bakteri tersebut diisolasi dari Danau Cadagno kemudian
ditanam secara murni di laboratorium. Pertama, sampel diuji foto asimilasi dan kemo asimilasi
CO2 in situ menggunakan kantong dialisis dan 14CO2 radioaktif kemudian dibandingkan
aktivitas populasi tunggal dengan komunitas mikroba yang ada di kemoklin. Setelah itu, di
laboratorium, diselidiki kapasitas untuk foto-oksidasi hidrogen sulfida pada intensitas cahaya dan
konsentrasi substrat yang berbeda. Kemudian hasil dievaluasi peran konsentrasi rendah oksigen
dalam fiksasi karbon kemotrofik.
Analisis kondisi fisik dan kimia air danau menggunakan analisis CTD menunjukkan
kolom air terdapat tiga zona berbeda di Danau Cadagno, yaitu meromictic dan mixolimnion. Hal
ini dilihat dari profil oksigen dalam grafik (a) dan (c) memperluas lapisan air aerobik dari
permukaan sampai kira-kira. kedalaman 12 m di mana oksigen menghilang (0,31 mg / L). Dalam
profil campuran oksigen, suhu dan konduktivitas homogen hingga kedalaman sekitar 6 m karena
hasil dari angin dan pencampuran permukaan yang didorong secara konvektif. Lapisan bawah
danau, yang disebut monimolimnion, dari 14 m ke dasar, berwarna gelap, anoksik dan dengan air
dengan kepadatan tinggi karena suhu rendah dan adanya garam terlarut.
Tingkat asimilasi 14CO2 dari PSB C. okenii strain LaCa, PSB T. syntrophicum Dalam
strain Cad16T dan GSB C. phaeobacteroides strain 1VII D7, sesuai dengan 72,8% dari total
komunitas di Danau Cadagno. Hal ini menunjukkan bahwa bakteri tersebut jauh lebih aktif jika
ada cahaya, hal ini dibuktikan dengan hasil fotosintesis lebih signifikan daripada kemotropi (baik
dalam in situ maupun in vitro). Dalam kedua percobaan, dengan adanya cahaya, PSB T.
syntrophicum Cad16T bersel kecil terbukti paling efektif dalam asimilasi foto CO2, diikuti oleh
PSB C. okenii LaCa. Sementara itu GSB C. phaeobacteroides 1VII D7 menunjukkan aktivitas
foto-asimilasi yang rendah juga karena ukurannya yang sangat kecil dibandingkan dengan PSB.
Dari keterangan di atas pada percobaan asimilasi 14CO2, kedua spesies PSB lebih efisien
daripada C. phaeobacteroides 1VII D7 dalam proses fotosintesis. PSB C. okenii LaCa bersel
besar mampu mengoksidasi jumlah sulfida tertinggi mungkin karena ukuran selnya yang besar.
Namun setelah hasil dinormalisasi menjadi biovolume seluler, GSB C. phaeobacteroides 1VII
D7 yang kecil menjadi yang paling efisien. Setelah 6 minggu inkubasi di Lake Cadagno
chemocline di dalam kantong dialisis, kultur menunjukkan afinitas yang lebih tinggi untuk
menurunkan konsentrasi sulfida dibandingkan dengan kultur laboratorium.
Dari sudut pandang ekologi, pada tingkat spesies individu, T. syntrophicum Cad16T
tampaknya paling efektif dalam memfiksasi CO2, terutama di jika ada cahaya. Sebaliknya, yang
paling melimpah tetapi juga yang terkecil, C. phaeobacteroides 1VII D7, adalah yang paling aktif
di bagian timur dalam hal fiksasi CO2 dan paling reaktif terhadap oksigen. Bakteri terbesar dan
paling efisien dalam foto-oksidasi H2S in vitro, C. okenii LaCa, dalam penelitian ini tampaknya
tidak terlalu kuat dalam memfiksasi CO2, hasil ini berbeda dengan penelitian sebelumnya. Di
lingkungan alam, bagaimanapun, dapat menghasilkan proses turbulensi yang dikenal sebagai
biokonveksi, yang dapat mewakili keunggulan kompetitif dalam pencarian kondisi lingkungan
yang optimal dan mempengaruhi keefektifan mikroorganisme lain.
FEMS Microbiology Ecology, 97, 2021, fiab010
doi: 10.1093/femsec/fiab010
Advance Access Publication Date: 29 January 2021
Research Article
RESEARCH ARTICLE
ABSTRACT
Meromictic lakes are interesting ecosystems to study anaerobic microorganisms due their permanent stratification
allowing the formation of a stable anoxic environment. The crenogenic meromictic Lake Cadagno harbors an important
community of anoxygenic phototrophic sulfur bacteria responsible for almost half of its total productivity. Besides their
ability to fix CO2 through photosynthesis, these microorganisms also showed high rates of dark carbon fixation via
chemosyntesis. Here, we grew in pure cultures three populations of anoxygenic phototrophic sulfur bacteria previously
isolated from the lake, accounting for 72.8% of the total microbial community and exibiting different phenotypes: (1) the
motile, large-celled purple sulfur bacterium (PSB) Chromatium okenii, (2) the small-celled PSB Thiodictyon syntrophicum and (3)
the green sulfur bacterium (GSB) Chlorobium phaeobacteroides. We measured their ability to fix CO2 through photo- and
chemo-synthesis, both in situ in the lake and in laboratory under different incubation conditions. We also evaluated the
efficiency and velocity of H2 S photo-oxidation, an important reaction in the anoxygenic photosynthesis process. Our results
confirm that phototrophic sulfur bacteria strongly fix CO2 in the presence of light and that oxygen increases
chemosynthesis at night, in laboratory conditions. Moreover, substancial differences were displayed between the three
selected populations in terms of activity and abundance.
Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and
reproduction in any medium, provided the original work is properly cited.
1
2 FEMS Microbiology Ecology, 2021, Vol. 97, No. 3
Keywords: chemocline; phototrophic sulfur bacteria; CO2 fixation; anoxygenic photosynthesis; chemotrophy
flagella PSB C. okenii strain LaCa, the small-celled PSB T. syn- intensity of 136.4 μmol/m2 /s PAR measured with a portable
trophicum strain Cad16T and the GSB Chlorobium phaeobacteroides LI-180 Spectrometer (LI-COR Biosciences, Lincoln, NE) with
strain 1VII D7, all previously isolated from Lake Cadagno and incandescent 100 W bulbs emitting the entire visible spectrum
grown in pure cultures in the laboratory. First, we tested the CO2 (Figure S1, Supporting Information).
photo- and chemo-assimilation in situ using dialysis bags and
radioactive 14 CO2 and compared the single population activity
with the microbial community present in the chemocline. Then, Flow cytometry
in the laboratory, we investigated the capacity to photo-oxidize
hydrogen sulfide at different light intensities and substrate con- Phototrophic sulfur bacteria in pure cultures were enumerated
centrations, and we evaluated the role of low concentrations of by flow cytometry (FCM) measuring chlorophyll-like autofluores-
oxygen in chemotrophic carbon fixation. cence particle events (Tonolla et al. 2017; Danza et al. 2018). A BD
Accuri C6 cytometer (Becton Dickinson, San José, CA) equipped
with two lasers (488 and 680 nm), two scatter detectors and
MATERIALS AND METHODS four fluorescence detectors (laser 488 nm: FL1 = 533/30, FL2 =
(12.3 m depth) of the structure (Figure S2, Supporting Informa- H2 S gas, which is only one component of the total sulfide equi-
tion). The HOBO logger values were analyzed after their retrieval librium system. Therefore, according to the following equation
at the end of the experiment. (Jeroschewski, Steuckart and Kuhl 1996):
The analysis of the inorganic carbon assimilation in the
chemocline of Lake Cadagno was carried out on the 22nd of
K1
August 2019, after an acclimatization period of 6 weeks at [S2− ] = [H2 S] 1 +
[H3 O + ]
between 11.78 and 12.28 m depth (from the 11th of July). The
dialysis bags were retrieved, homogenized to avoid sample het- where K1 is a reaction rate constant and [H3 O+ ] is a proxy for the
erogeneities and dropped in 30 mL sealed bottles with 75 μL of pH of the sample solution, the H2 S concentrations correspond to
radioactive 14 C (NaH14 CO3 ; 1.0 mCi; 8.40 mCi mM/L, 20 μCim/L; S2− concentrations of 0.02, 0.04, 0.40 and 1.20 mM.
Cat. No. NEC-086S Perkin-Elmer, Zurich, Switzerland). On the A light/dark photoperiod (5 min/5 min) was applied using
22nd of August 2019, at 10:00 h, triplicate of sealed 30 mL bot- 100 W incandescent bulbs emitting the entire spectrum for a
tles filled with cultures coming from dialysis bags (cell counts total of 90 min. The sample in the microrespiratory chamber
are reported in Table 1) were incubated for 4 h at 11.8 m depth was incubated under ten following increasing light intensities
Table 1. FISH and FCM (± standard deviation) quantification of PSB C. okenii, PSB T. syntrophicum and GSB C. phaeobacteroides in the chemocline
of Lake Cadagno and in dialysis bags (22 August 2019).
Chemocline
10:00 12.29 1.07 ± 0.35 1.49 ± 0.34 12.6 ± 3.0 3.69 ± 0.42
22:00 12.65 0.48 ± 0.05 2.23 ± 0.04 10.9 ± 6.4 4.76 ± 0.22
Measure of intracellular ATP The slides were treated with Citifluor AF1 (Citifluor Ltd., London,
UK) and examined by epifluorescence microscopy using filter
The mean activity of microbial cells in pure cultures has sets F31 (AHF Analysentechnik, Tübingen, Germany; D360/40,
been determined by quantifying the ATP present using the 400DCLP and D460/50 for DAPI) and F41 (AHF Analysentechnik;
BacTiter-Glo Microbial Cell Viability Assay (Promega Corpora- HQ535/50, Q565LP and HQ610/75 for Cy3). The microorganisms
tion, Dübendorf, CH) and a BioOrbit 1253 luminometer (BioOr- were counted at 1000× magnification in 40 fields of 0.01 mm2 .
bit OY, Turku, Finland). The BacTiter-Glo reagent was prepared
according to the manufacturer’s instructions. The kit protocol
recommends incubating an equal volume of reagent and sample RESULTS
(100 μL:100 μL) at room temperature for 5 min before recording Physical and chemical analysis of Lake Cadagno water
the luminescence, expressed in Relative Light Units (RLU). The column
RLU values were converted to ATP concentrations using a cali-
bration curve, measured with separate preparations of the ATP Measurements of the physicochemical parameters of Lake
reagent. Cadagno water column were carried out on the 22nd August
2019. The profiles showed in Fig. 1 were taken at the beginning
of both 4 h 14 CO2 incubation periods in Lake Cadagno, at 10:00 h
Fluorescent in situ hybridization (FISH)
(Fig. 1A and B) and at 22:00 h (Fig. 1C and D).
The total cell number of PSB T. syntrophicum and GSB C. phaeobac- The CTD analysis of the water column put in evidence
teroides in the bacterial layer of the Lake Cadagno chemocline the three distinct zones in the meromictic Lake Cadagno, the
were identified and quantified using FISH with species-specific mixolimnion, well highlighted by profiles of oxygen in graphs (a)
Cy3-labeled oligonucleotides, S453F (CCTCATGGGTATTARCCA- and (c) extending the aerobic water layer from the surface until
CAAGGCG) and CHLP 441 (AAATCGGGATATTCTTCCTCCAC), approx. 12 m depth, where oxygen disappears (0.31 mg/L). In the
respectively. A total of 20 mL of lake water were filtered mixolimnion profiles of oxygen, temperature and conductivity
onto 0.2 μm polycarbonate filters, fixed for 30 min with a 4% are homogenized down to approximately 6 m depth as a result of
paraformaldehyde solution and washed twice in PBS. Bacteria wind and convectively-driven surface mixing. Below the homo-
were then resuspended in 600 μL of PBS/EtOH 1:1. Both samples geneous zone, the temperature decreased from 14.6◦ C to its low-
were observed in 2 and 5 μL aliquots of paraformaldehyde-fixed est value of 4.4◦ C, while conductivity increased from 0.108 to
water samples (n = 3) spotted onto gelatin-coated slides (0.1% 0.205 mS/cm at 12 m of depth (Fig. 1, graph A and C). The values
gelatin, 0.01% KCr(SO4 )2 ; Glöckner et al. 1996). Hybridizations of temperature and conductivity did not change between day
were performed as described by Zarda et al. (1997) with concomi- and night. The second zone is called chemocline (from approx-
tant DAPI staining for total bacterial community quantification. imately 12 to 14 m depth) and coincides with the beginning of
6 FEMS Microbiology Ecology, 2021, Vol. 97, No. 3
the anaerobic layer, confirmed by the increase of the hydrogen microorganism close to the anaerobic water. The lower layer of
sulfide concentration until a maximal value of 1.4 mg/L at 18 m the lake, called monimolimnion, from 14 m to the bottom, is
of depth (Fig. 1A and C, green lines). Here the profile of conduc- dark, anoxic and with high-density water due to the low tem-
tivity remains constant in correspondence of the turbidity peak. perature and presence of dissolved salts.
In the chemocline the turbidity profile strongly increases to a
maximal value up to 16.0 FTU (Fig. 1B and d, purple lines). Dur-
The anoxigenic phototrophic sulfur bacteria
ing the day, the turbidity layer absorbed the light completely,
community
and light did not penetrate below 14 m depth (Fig. 1B and D,
yellow lines). The profile of light shows an uncommon behav- The turbidity peaks showed in Fig. 1 (B and D, purple lines)
ior, with a steep reduction in the first 2 m, until approximately between 12 and 14 m depth were analyzed using flow cytom-
4 m depth (Fig. 1B, yellow line). The measurement on the Lake etry (FCM) and fluorescent in situ hybridization (FISH) in order
Cadagno are normally carried out by the way of a platform (5 m to identify our population of interest within the entire microbial
long and 3 m wide) in the middle of the lake, where the depth community.
is maximal (21 m depth). The CTD is lowered from the centre FCM analysis, using a red autofluorescence signal (laser 488,
of the platform, to reduce oscillations as much as possible, pro- emission 670 nm), confirmed a high concentration of photosyn-
ducing this artificial profile derived from the shadow of the plat- thetic microorganisms in correspondence to the turbidity peaks
form. A couple of meters before the complete disappearance of (Fig. 1B and D). The top of the bacterial layer changed slightly
oxygen, the measure of BGAPC (Blue-Green Algae PhycoCyanin) during the day, at 10:00 h it was at 12.29 m and 22:00 h at 12.65 m
reached the maximum value of approximately 50 ppb (Fig. 1B of depth, while the number of photosynthetic cells at the top of
and D, cyan lines; values multiplied by 5). This peak of phyco- the turbidity peak did not vary much with 6.34 × 105 and 6.60 ×
cyanin pigments highlights the presence of cyanobacterial-like 105 cells/mL in the morning and in evening, respectively.
Di Nezio et al. 7
Big-celled C. okenii were directly identified and counted by similar behavior, while C. okenii and C. phaeobacteroides did not
FCM on SSC/FSC dot plots after positive FL3 fluorescence dis- seem to show a big difference between day and night.
crimination, revealing some difference in number between day
and night, of 1.07 × 105 and 4.88 × 104 cells/mL, respectively. The
Role of oxygen in the 14 CO2 fixation
remaining of the phototrophic community in the bacterial layer
was composed mainly of PSB and GSB, as further confirmed by Inorganic carbon fixation was further analyzed in the laboratory
FISH analyses. GSB C. phaeobacteroides was the most abundant evaluating two environmental conditions such as low tempera-
among the three strains, with day and night numbers of 1.26 ture (around 4◦ C) and the presence of microaerophily (around 5%
× 106 and 1.09 × 106 cells/mL while PSB T. syntrophicum had a of O2 ). The oxygen was added in order to verify the possibility of
cell number of 1.49 × 105 and 2.23 × 105 cells/mL day and night, PSB chemotrophic microrespiration suggested in recent studies
respectively (Table 1). All together this three species account for (Berg et al. 2019; Luedin et al. 2019). The low temperature mea-
the 72.8% of the anoxygenic phototrophic sulfur bacteria com- surement, similar to the natural environment, has been selected
munity of Lake Cadagno, the remaining 27.2% being represented to verify the possibility of artifacts related to the higher tem-
by other species not considered in this study, because pheno- peratures used in growing PSB and GSB in the laboratory. In the
Figure 3. 14 CO2 assimilation under laboratory conditions. Inorganic carbon fixation [14 C amol/cell/h] by pure cultures of PSB C. okenii LaCa, PSB T. syntrophicum Cad16T
and GSB C. phaeobacteroides 1VII D7 isolated from Lake Cadagno in the presence of light and in the dark (grey areas). RT (room temperature) was 22◦ C. Fixation of 14 CO2
was quantified during 4 h in liquid autotrophic cultures. Standard errors are shown as error bars.
Cad16T and C. phaeobacteroides 1VII D7, then the effect of light and 5). A saturation effect on the S−2 consumption is also visi-
intensity and different hydrogen sulfide concentration was ble. For this reason, the photo-oxidation activity is measured for
tested. The oxidation rate of each strain and condition has different increasing sulfide concentrations. The kinetic param-
been compared taking into account the maximal velocity of the eters considered for the strains are summarized in Table 2.
oxidation process (Vmax ) and light half-saturation constant (K;
Table 2). Dialysis bags cultures
Under both conditions, in all the three strains, the increase Cultures of C. okenii LaCa reached their maximal sulfide oxida-
in light intensity irradiation (from 0 to 50 μE m2 /s) resulted in an tion rate of 2.29 × 10−8 μmol/cell/h with a starting S2− concentra-
increase in the sulfide oxidation rates, confirming the positive tion of 0.02 mM, with a corresponding light intensity constant K
effect of light irradiance on the photosynthetic process (Figs 4 of 4.41 μE/m2 /s (Fig. 4A and Table 2). The lowest sulfide oxidation
Di Nezio et al. 9
Table 2. Comparison of kinetic parameters, Vmax (μmol/cell/h) and K (μE/m/s), derived from enzyme activity model.
Figure 5. Light-dependent sulfide oxidation in laboratory cultures. Sulfide oxidation rate [μmol/cell/h] vs light [μE/m2 /s] for laboratory cultures of (A) C. okenii LaCa,
(B) T. syntrophicum Cad16T and (C) C. phaeobacteroides 1VII D7 at different light intensities. No oxidation was observed at the concentration of 0.02 mM S2− . Error bars
represent standard deviation (N = 3). If no error bars are shown, SD was smaller than the symbols used.
rate of C. okenii was of 5.42 × 10−9 μmol/cell/h under the concen- concentration of 1.2 mM was not analysed for dialysis bags cul-
tration of 0.04 mM S2− , with a corresponding K value of 10.64 tures because too high compared to that encountered in the nat-
μE/m2 /s (Fig. 4A and Table 2). T. syntrophicum Cad16T showed ural environment.
similar values with both 0.02 and 0.04 mM S2− , with an oxidation
rate of 1.57 × 10−8 μmol/cell/h with K of 235.05 μE/m2 /s and 1.21 Laboratory cultures
× 10−8 μmol/cell/h with K of 19.31 μE/m2 /s, respectively. Differ- In C. okenii LaCa cultures, the increase in light intensity irradia-
ently to C. okenii, T. syntrophicum had its minimal sulfide uptake tion resulted in marked changes in the sulfide oxidation rates,
of 3.23 × 10−9 μmol/cell/h under the 0.4 mM concentration, with with little variation among analytical replicates. Maximal sul-
a K of 14.52 μE/m2 /s. C. phaeobacteroides 1VII D7 showed the low- fide oxidation rates of 9.72 × 10−8 μmol/cell/h was reached with
est sulfide oxidation rates under every concentration, with a a starting S2− concentration of 1.2 mM, with a corresponding
maximal oxidation rate of 1.51 × 10−8 μmol/cell/h and a K value light intensity constant K of 32.01 μE/m2 /s (Fig. 5A and Table 2).
of 598.64 μE/m2 /s under the concentration of 0.4 mM S2- (Fig. 4C The lowest sulfide oxidation rate of C. okenii was of 2.53 × 10−9
and Table 2). In all cases, a saturation effect produced by the μmol/cell/h under the initial concentration of 0.04 mM S2− , with
light intensity increase has been observed. The highest sulfide a corresponding K value of 3.40 μE/m2 /s (Fig. 5A and Table 2).
10 FEMS Microbiology Ecology, 2021, Vol. 97, No. 3
T. syntrophicum Cad16T showed a similar behavior with both 0.04 the 1.2 mM S2− , with small differences among the other S2− ini-
and 0.4 mM S2− , with an oxidation rate of 3.06 × 10−9 μmol/cell/h tial concentrations and incubation conditions, although with a
with K of 4.89 μE/m2 /s and 3.04 × 10−9 μmol/cell/h with K of significantly lower ATP concentrations compared to the other
6.33 μE/m2 /s, respectively. Similarly to C. okenii, T. syntrophicum strains (Figure S8b and e, Supporting Information). Similarly to
reached its maximal sulfide uptake of 7.15 × 10−9 μmol/cell/h PSB, we observed an increase in the ATP concentration for GSB C.
under the 1.2 mM concentration, with a K of 11.14 μE/m2 /s. C. phaeobacteroides in both laboratory and dialysis bags cultures for
phaeobacteroides 1VII D7 showed sulfide oxidation rates compa- all the hydrogen sulfide concentrations tested (Figure S8c and f,
rable to T. syntrophicum under every concentration, with a max- Supporting Information).
imal oxidation rate of 8.00 × 10−9 μmol/cell/h and a K value of As already shown in the past (Danza et al. 2017), the oxidation
5.38 μE/m2 /s under the concentration of 1.2 mM S2− (Fig. 5C and of sulfide correlates with the production of intracellular sulfur
Table 2). As observed with the dialysis bags cultures, the light globules of PSB, resulting in an increase of the SSC parameter.
intensity increase produced a saturation effect. In the control At low concentrations of H2 S only cultures from dialysis bags
microcosms kept in the dark, as well as in control with no cells showed a substantial increase in SSC, further confirming their
exposed to light, no sulfide oxidation occurred (Figure S5, Sup- adaptation to lower concentrations of sulfide.
Figure 6. Flow cytometry cellular dynamics in anoxygenic photosynthetic sulfur bacteria. Mean SSC for laboratory and dialysis bags cultures before (Start) and after
−
(End) the sulfide oxidation test under (A and E) 0.02 mM S2 (no H2 S oxidation observed in laboratory cultures), (B and F) 0.04 mM S2− , (C and G) 0.4 mM S2− , (D) 1.2 mM
−
S2 . Error bars represent standard deviation (N = 3). If no error bars are shown, SD was smaller than the symbols used.
were taken in September, when C. okenii population normally day in parallel to the phototrophic fixation by the aid of opaque
declines, making way for the development of small-celled PSB bottles, so ongoing phototrophic activity might have influenced
populations (Danza et al. 2018), known to be able to fix CO2 in the results increasing the dark fixation values.
the dark (Storelli et al. 2013). In our case the dominance of C. In the presence of light, our values were in between higher
okenii was also confirmed by the presence of bioconvection, as values recorded by Storelli et al. (2013) and Camacho et al. (2001)
shown by temperature and conductivity profiles (Fig. 1A and C; and lower values observed by Musat et al. (2008) and Luedin et al.
blue and green graphs), normally absent in September. More- (2019). In 2019 we were confronted with a particular weather sit-
over, the dark fixation measurement was carried out during the uation with a very cold Spring that caused ice-cover on Lake
12 FEMS Microbiology Ecology, 2021, Vol. 97, No. 3
Cadagno to thaw only at the beginning of June (usually at the species possess the capacity of microaerobic respiration (Cama-
end of April). This late Winter condition and late Summer strat- cho, Vicente and Miracle 2000; Casamayor, Garcı́a-Cantizano and
ification negatively influenced the development of chemocline Pedrós-Alió 2008; Peduzzi et al. 2011; Luedin et al. 2019), and
microorganisms highlighted during the season by much lower therefore it may well be possible that C. okenii showed chemoau-
turbidity in the bacterial layer than normal (15–20 instead of 35– totrophic growth on oxygen, in the absence of light. This is cor-
40 FTU). The lack of a complete development of the bacterial roborated by our results from the laboratory experiment, where
community can partially explain the total lower 14 CO2 assimila- we observed an increased in C. okenii’s dark fixation in the pres-
tion observed during our experiment. This may also be due to ence of oxygen. This consideration is also supported by the fact
the seasonal variations observed in the phototrophic sulfur bac- that, on the day of the test (at 10:00 h), the chemocline resulted
teria community composition (Danza et al. 2018). PSB C. okenii is partly oxygenated with around 0.57 mg O2 /L (36 μM) in presence
present in high concentrations in mid-Summer (July), when bio- of light and 0.95 mg O2 /L (59 μM) in the dark at the depth where
convection is more intense (Sommer et al. 2017), while other PSB the dialysis bags were positioned. This small amount of oxy-
and GSB are less abundant. The decrease in C. okenii population gen probably diffused from the oxic upper layer produced during
observed towards the end of Summer (late September), when the day by photosynthetic microplankton, such as cryptomon-
both in vitro and in situ, show that, in the presence of low levels exposed to light intensities much higher than those normally
of oxygen, dark CO2 fixation activity of C. okenii LaCa is present, encountered in the chemocline of Lake Cadagno. Therefore, the
thereby confirming that these bacteria can take energy in the higher light intensity irradiance necessary to obtain the satura-
dark from aerobic respiration but with much lower efficiency, in tion with laboratory grown cultures, compared to what observed
accordance with recent results (Berg et al. 2019). The fact that C. in a previous work using fresh isolates (Danza 2018), might be
okenii and other members of the family Chromatiaceae are capable due to a higher production of photoprotective pigments caused
of aerobic respiration (Kampf and Pfennig 1980) is also suggested by the exposure to strong artificial light (Šlouf et al. 2012). Indeed,
by the presence of several oxygen-dependent enzymes such as both dialysis bags PSB cultures showed, on average, a higher
cytochrome bd oxidase, superoxide dismutase and hemerythrin- response to lower sulfide concentrations (Vmax ) compared to lab-
like proteins (French, Bell and Ward 2008; Forte et al. 2016; Berg oratory cultures, particularly showing photo-oxidation activity
et al. 2019). Other PSB were also found to oxidize thiosulfate and even at 0.02 mM S2 (Fig. 4A and B). At the same sulfide concen-
sulfide under aerobic chemolithoautotrophic conditions, using trations, GSB C. phaeobacteroides had oxidation rates comparable
RubisCO and the Calvin cycle to assimilate CO2 (Kondratieva to those observed in the laboratory cultures (Fig. 4C). The better
et al. 1976). response showed by dialysis bags cultures to lower sulfide con-
oxidation of sulfide. In the laboratory cultures, the increase in strain Cad16T and GSB C. phaeobacteroides strain 1VII D7, corre-
SSC signal observed after the incubation, and the relative maxi- sponding to the 72.8% of the total community in Lake Cadagno,
mal SSC values, positively correlated with the initial sulfide con- indicated that they are much more active in the presence of light
centration (Fig. 6A–D), whereas in dialysis bags cultures a major via photosynthesis than in the dark via chemotrophy, both in situ
increase in the internal complexity was observed at lower S2− and in vitro.
concentrations, particularly for C. okenii (Fig. 6E). The absence of In both experiments, in the presence of light, small-celled
sulfide oxidation and SSC variation recorded under dark incuba- PSB T. syntrophicum Cad16T proved to be the most effective in
tion corroborates this observation (Figure S5b and c, Supporting CO2 photo-assimilation, followed by the other PSB C. okenii LaCa.
Information). These findings are in line with those from Danza As in previous studies, GSB C. phaeobacteroides 1VII D7 showed
et al. (2017) and other studies (Casamayor et al. 2007; Frigaard a low photo-assimilation activity also because of its very small
and Dahl 2008) correlating sulfide oxidation with the intracellu- size compared to PSB. Moreover, for all strains, the presence of
lar accumulation of sulfur globules, as a result of their photo- oxygen strongly reduced the photosynthetic activity, while in
synthetic activity (Mas and Van Gemerden 1995). Moreover, the absence of light, especially for PSB C. okenii LaCa, the presence
higher SSC values observed at low sulfide concentrations in dial- of a small amount of O2 strongly increased the fixation of CO2 .
the 24 h sampling campaign. We are also grateful to the staff of Casamayor EO. Vertical distribution of planktonic autotrophic
the Alpine Biology Centre Foundation (CBA), especially Professor thiobacilli and dark CO2 fixation rates in lakes with oxygen-
Dr Raffaele Peduzzi for laboratory facilities and housing and Dr sulfide interfaces. Aquat Microb Ecol 2010;59:217–28.
Sandro Peduzzi for helpful discussion. Crowe SA, Jones CA, Katsev S et al. Photoferrotrophs thrive
in an Archean Ocean analogue. Proc Natl Acad Sci USA
2008;105:15938–43.
SUPPLEMENTARY DATA Dahl TW, Anbar AD, Gordon GW et al. The behavior of molybde-
num and its isotopes across the chemocline and in the sed-
Supplementary data are available at FEMSEC online.
iments of sulfidic Lake Cadagno, Switzerland. Geochim Cos-
mochim Acta 2010;74:144–63.
Danza F, Ravasi D, Storelli N et al. Bacterial diversity in the water
FUNDING
column of meromictic Lake Cadagno and evidence for sea-
This work was supported by the Swiss National Science Foun- sonal dynamics. PLoS One 2018;13:1–17.
dation (grant numbers 315230–179264) and by the Laboratory of Danza F, Storelli N, Roman S et al. Dynamic cellular complexity of
Haas S, de B D, Klatt JM et al. Low-light anoxygenic photosynthe- Morana C, Roland FAE, Crowe SA et al. Chemoautotrophy and
sis and Fe-S-biogeochemistry in a microbial mat. Front Micro- anoxygenic photosynthesis within the water column of a
biol 2018;9:1–15. large meromictic tropical lake (Lake Kivu, East Africa). Lim-
Habicht KS, Miller M, Cox RP et al. Comparative proteomics nol Oceanogr 2016;61:1424–37.
and activity of a green sulfur bacterium through the water Musat N, Halm H, Winterholler B et al. A single-cell view on the
column of Lake Cadagno, Switzerland. Environ Microbiol ecophysiology of anaerobic phototrophic bacteria. Proc Natl
2011;13:203–15. Acad Sci U S A 2008;105:17861–6.
Hadas O, Pinkas R, Erez J. High chemoautotrophic primary Ng C, Demaere MZ, Williams TJ et al. Metaproteogenomic anal-
production in Lake Kinneret, Israel: a neglected link in ysis of a dominant green sulfur bacterium from Ace Lake,
the carbon cycle of the lake. Limnol Oceanogr 2001;46: Antarctica. ISME J 2010;4:1002–19.
1968–76. Overmann J. Ecology of phototrophic sulfur bacteria. In: Hell R,
Hanada S. Filamentous anoxygenic phototrophs in hot springs. Dahl C, Knaff DB et al. (eds.). Sulfur Metabolism in Phototrophic
Microbes Environ 2003;18:51–61. Organisms. Vol 49. Dordrecht: Springer, 2008, 375–96.
Hancke K, Dalsgaard T, Sejr MK et al. Phytoplankton produc- Overmann J. The family Chlorobiaceae. Prokaryotes 2006;7:
Sorokin DY, Kuenen JG, Muyzer G. The microbial sulfur cycle at Watanabe T, Kojima H, Takano Y et al. Diversity of sulfur-
extremely haloalkaline conditions of soda lakes. Front Micro- cycle prokaryotes in freshwater lake sediments investigated
biol 2011;2, DOI: 10.3389/fmicb.2011.00044. using aprA as the functional marker gene. Syst Appl Microbiol
Stayton CT. What does convergent evolution mean? The 2013;36:436–43.
interpretation of convergence and its implications in the Widdel F, Bak F. Gram-negative mesophilic sulfate-reducing bac-
search for limits to evolution. Interface Focus 2015;5, DOI: teria. The Prokaryotes. New York: Springer, 1992, 3352–78.
10.1098/rsfs.2015.0039. Wilson WA, Roach PJ, Montero M et al. Regulation of glyco-
Storelli N, Peduzzi S, Saad MM et al. CO2 assimilation in the gen metabolism in yeast and bacteria. FEMS Microbiol Rev
chemocline of Lake Cadagno is dominated by a few types 2010;34:952–85.
of phototrophic purple sulfur bacteria. FEMS Microbiol Ecol Wirth SB, Gilli A, Niemann H et al. Combining sedimentologi-
2013;84:421–32. cal, trace metal (Mn, Mo) and molecular evidence for recon-
Storelli N, Saad MM, Frigaard NU et al. Proteomic analysis of the structing past water-column redox conditions : the example
purple sulfur bacterium Candidatus “Thiodictyon syntroph- of meromictic Lake Cadagno (Swiss Alps). Geochim Cosmochim
icum” strain Cad16T isolated from Lake Cadagno. EuPA Open Acta 2013;120:220–38.