Anda di halaman 1dari 10

Exercícios de Metabolismo

pH e Sistemas Tampão

1. Definir ácido e base segundo Bronsted.


2. Caracterizar um sistema tampão e indicar os fatores que determinam sua
eficiência.
3. Definir pka .
4. Dar exemplos de tampões biológicos.
Aminoácidos e Proteínas
1. Escrever a fórmula de um aminoácido. Dar exemplos de:
a. aminoácido com um grupo amino e dois grupos carboxílicos
b. aminoácido com um grupo carboxílico e dois grupos aminos.
2. Definir ponto isoelétrico (pI) de um aminoácido.
3. Analisando o radical R, classificar os aminoácidos em polares e apolares.
Entre os polares, citar aqueles que, em pH 7, apresentam radical com carga
negativa (aminoácidos ácidos), carga positiva (aminoácidos básicos) e carga
nula (polares sem carga).
4. Esquematizar a ligação peptídica.
5. Definir proteínas globulares e fibrosas. Citar exemplos.
6. Definir estrutura primária.
7. Descrever as estruturas regulares - alfa-hélice e conformação beta - que
compõem a estrutura secundária das proteínas globulares.
8. Definir estrutura terciária de proteínas globulares. Esquematizar os tipos de
ligações que a mantêm, indicando os aminoácidos que participam dessas
ligações.
9. Definir estrutura quaternária de proteínas globulares. Citar exemplos de
proteínas com estrutura quaternária.
10. Verificar a posição dos radicais polares e apolares de uma proteína em
solução aquosa.

Enzimas

1. Definir enzima, substrato e sítio ativo.


2. Definir inibidor competitivo e não-competitivo.
3. Caracterizar enzima alostérica. Definir centro alostérico e efetuador
alostérico (positivo e negativo).
4. Definir regulação enzimática por modificação covalente.
5. Definir cofator. Dar exemplos de cofatores inorgânicos (ativadores metálicos)
e orgânicos (coenzimas).
6. Representar o grupo ativo de NAD+ e do FAD nas formas reduzida e
oxidada.
7. Definir vitaminas, relacionando sua função com atividade enzimática.

Estrutura de carboidratos e lipídios


1. Definir carboidrato, açúcar, monossacarídio e oligossacarídio e dar
exemplos.
2. Definir polissacarídio. Citar exemplos de polissacarídios estruturais e de
reserva.
3. Descrever a estrutura do glicogênio e indicar a porção da molécula que sofre
alongamento ou encurtamento.
4. Caracterizar estruturalmente os ácidos graxos mais comuns na natureza.
5. Definir triacilglicerol. Descrever as vantagens para os seres vivos do
armazenamento de trialcilgliceróis.
6. Correlacionar a consistência das gorduras animais e óleos vegetais com a
estrutura dos ácidos graxos componentes destas substâncias.
7. Definir glicerofosfolipídio e esfingolipídio.
8. Citar as funções do colesterol.
9. Indicar a porção hidrofílica e a porção hidrofóbica dos diferentes tipos de
lipídios anfipáticos. Mostrar em que fração celular são comumente encontrados
os lipídios anfipáticos.
10. Caracterizar as classes principais de lipoproteínas plasmáticas, indicando a
sua função.

Glicólise, formação de acetil-CoA e Ciclo de Krebs

Responda utilizando apenas o mapa da glicólise.


1. Quais os passos irreversíveis que aparecem no mapa?
2. Quantas moléculas de piruvato se formam a partir de uma molécula de
glicose?
3. Que hexose dá origem a trioses?
4. Indicar as reações de óxido-redução que aparecem no mapa.
5. Identificar no mapa as reações catalisadas pelas seguintes enzimas:
a) quinase b) mutase c) isomerase d) aldolase e) desidrogenase
6. Considerando o número de moléculas de ATP consumidas e formadas,
estabelecer o saldo final de ATP (balanço energético) na oxidação de uma
molécula de glicose pela via glicolítica.
7. Esquematizar as reações de fermentação alcoólica que possibilitam a
obtenção de NAD+ na forma oxidada. Citar exemplos de tecidos ou organismos
onde ocorrem fermentação lática e alcoólica. Em que condições o músculo
oxida glicose a lactato?
8. Escrever a reação de formação de acetil-CoA a partir de piruvato e indicar:
a) as 5 coenzimas necessárias
b) as vitaminas envolvidas
9. Na oxidação de uma molécula de acetil-CoA no ciclo de Krebs, indicar a
enzima que catalisa a reação onde há produção ou consumo de:
a) CO2 - b) GTP - c) NADH - d) FADH2 - e) H2O

Conversão de sacarídeos, Via das pentoses e Degradação de glicogênio

1. Considerando o número de moléculas de ATP consumidas e formadas,


estabelecer o saldo final de ATP (balanço energético) na oxidação de uma
molécula de lactose pela via glicolítica.
2. Esquematizar as duas reações de oxidação da via das pentoses, citando as
enzimas e as coenzimas envolvidas nestas reações.
3. Definir transaldolase e transcetolase, mostrando a coenzima envolvida. Citar
exemplos de reações catalisadas por cada tipo de enzima.
4. Citar a localização celular da via das pentoses.
5. Mostrar a importância biológica da via das pentoses e citar compostos que
apresentam ribose na sua molécula.
6. Citar tecidos em que ocorre a via das pentoses.
7. Desenhar as estruturas químicas de NADH e NADPH.
8. Discutir os diferentes papeis de NADH e NADPH.
9. Sugerir a razão pela qual a via das pentoses é muito mais ativa nos
adipócitos (onde há alta síntese de ácidos graxos) do que no tecido muscular.
10. Definir polissacarídio. Citar exemplos de polissacarídios estruturais e de
reserva.
11. Descrever a estrutura do glicogênio.
12. Esquematizar as reações de degradação do glicogênio a glicose 1-fosfato.

Cadeia de Transporte de Elétrons e Fosforilação oxidativa

1. Citar os compostos que fazem parte da cadeia de transporte de elétrons.


2. Esquematizar a seqüência dos compostos da cadeia de transporte de
elétrons, indicando os transportadores de elétrons e os transportadores de
prótons e elétrons.
3. Citar a localização celular da cadeia de transporte de elétrons.
4. Citar 3 inibidores da cadeia de transporte de elétrons, indicando os
transportadores sobre os quais atuam.
5. Definir fosforilação oxidativa. O que está sendo fosforilado? O que está
sendo oxidado?
6. Descrever a hipótese do acoplamento quimiosmótico para a fosforilação
oxidativa.
7. Indicar o número de ATP sintetizados para cada NADH e FADH2 oxidados.
8. Citar exemplos de processos biológicos que utilizam ATP.
9. Descrever a estrutura da ATP sintase (ou F1F0-ATPase). Descrever a
função de cada uma das partes. Onde ela está localizada na mitocôndria?
10. Definir desacoplador e citar um exemplo.
11. Definir inibidor de fosforilação oxidativa e citar um exemplo.
12. A membrana interna da mitocôndria é impermeável a ATP e NADH.
Explicar:
a. como o NADH produzido na via glicolítica pode ser oxidado na cadeia
respiratória (lançadeiras do malato e de glicerol fosfato).
b. como o ATP produzido na mitocôndria pode ser utilizado no citoplasma.

Biossíntese de carboidratos

1. Esquematizar as reações de síntese de glicogênio a partir de glicose.


2. Citar a função do glicogênio hepático e do glicogênio muscular.
3. Definir gliconeogênese e citar exemplos de compostos gliconeogênicos.
Citar o tecido responsável pela gliconeogênese.
4. Comparar as três reações irreversíveis da glicólise com as reações de
gliconeogênese que as substituem, quanto a reagentes, produtos, enzimas e
coenzimas.
5. Indicar a localização celular das enzimas da via glicolítica e da
gliconeogênese.
6. Indicar o balanço energético da gliconeogênese se o composto inicial for:
a. piruvato
b. lactato
c. galactose
d. frutose

Regulação do metabolismo de carboidratos

1. Mostrar a relação entre AMP cíclico e a síntese de glicogênio.


2. Citar os hormônios que estimulam a degradação do glicogênio no fígado e
no músculo e mostrar seu modo de ação.
3. Esquematizar as reações catalisadas por adenilato ciclase e fosfodiesterase.
4. Mostrar a relação do AMP cíclico com a degradação do glicogênio a glicose
1-fosfato.
5. Esquematizar as reações de conversão de glicose 1-fosfato a glicose. Citar o
tecido onde essas reações ocorrem.
6. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e
mostrar a conseqüência deste efeito sobre a atividade da via glicolítica.
7. Fazer um resumo dos efeitos do glucagon, adrenalina e insulina no
metabolismo de carboidratos no fígado, musculo e adiposo.
8. Descrever as alterações do metabolismo de carboidratos provocadas por
jejum prolongado e por diabetes.

Metabolismo de ácidos graxos

1. Como os ácidos graxos são transportados no organismo? Como e aonde se


dá a ativação do ácido graxo?
2. O que é beta-oxidação?
3. Considerando 1 volta da beta oxidação, qual o produto formado?
4. Compare em rendimento energético, a degradação total de1 mol de um
ácido graxo com 18 carbonos e 3 moles de glicose.
5. Localize a degradação de um ácido graxo dentro da célula.
6. O que são corpos cetônicos? Forneça local de produção, de utilização e
como são utilizados. Em que condições são formados ?
7. Como a degradação do ácido graxo é regulada?
8. Compare a マ-oxidação, com a biossíntese do acído decanóico (C10) quanto
aos seguintes aspectos. Responda na forma de tabela.
a. Composto de partida
b. Localização intracelular das enzimas que catalizam as reações de ambos os
processos.
c. Coenzimas de óxido-redução utilizadas.
d. Carregador de grupo acila
e. Forma em que as unidades de carbonos são removidas ou adicionadas.
f. Saldo de ATP (considere a oxidação até CO2 e H2O)
g. Valor alto da relação ATP/ADP como determinante da ocorrência de uma ou
outra.
h. dem valor baixo da relação ATP/ADP.

Metabolismo de aminoácidos

1. Como se forma a ureia? De onde vêm os nitrogênios? Qual o órgão


envolvido na síntese da uréia?
2. Qual a fonte de carbono da uréia? Como se forma?
3. Forneça a reação de transaminação. Qual a vitamina envolvida? Quais os
aminoácidos que não sofrem transaminação?
4. O que são aminoácidos cetogênicos e glicogênicos? Cite 3 exemplos de
cada.
De maneira geral, qual o destino dos carbonos e do nitrogênio dos
aminoácidos?
Alanina está sendo sintetizada a partir de seus precursores metabólicos.Com
os compostos abaixo faça uma tabela com duas colunas.A primeira coluna,com
os compostos que são precursores e a segunda, com os compostos que não
são precursores da alanina:
- fosfoenol piruvato - glicogênio
- acetil CoA - carbamoil fosfato
- glicose - gliceraldeído-3-fosfato
- malato - malonil CoA
- Ácido palmítico - acetoacetato

Integração de metabolismo

1. Como se dá a regulação do metabolismo de glicogênio por adrenalina?


Forneça as principais etapas. Explique. Compare o produto final no fígado e no
músculo.
2. Qual o papel do citrato na regulação do metabolismo de carboidratos e
lipídios? Justifique.
3. Considere o metabolismo básico estudado. O que acontece com o
metabolismo de lipídios, carboidratos e proteínas após um jejum prolongado?
Justifique fornecendo as enzimas e os controles adequados sobre as vias.
4. Considere o metabolismo básico estudado. O que acontece com o
metabolismo de lipídios, carboidratos e proteínas após uma refeição rica em
proteínas? Justifique fornecendo as enzimas e os controles adequados sobre
as vias.
5. Abaixo é feita uma série de afirmações referentes a um indivíduo em jejum
há dois dias. Considere que o glicogênio hepático está esgotado.Todas as
afirmações se referem ao hepatócito.Quando não, no texto é chamada atenção
para isto.Preencha a tabela apresentada em seguida as dez primeiras
afirmações, agrupando na coluna da esquerda as letras das afirmações que se
aplicam e na coluna da direita as letras das afirmações que não se aplicam a
situação fisiológica do jejum.
a. A produção de uréia é baixa
b. Verifica-se baixa produção de NADPH, ou mesmo não se verifica.
c. A glicogênio sintetase está na sua forma defosforilada, isto é ativa.
d. Glicose-6-fosfatase encontra-se em atividade, isto é produzindo glicose livre.
e. Acetil Côa proveniente da intensa beta-oxidação dos ácidos graxos está
sendo utilizada na síntese de corpos cetônicos.
f. No citossol não se encontra malonil Coa.
g. Verifica-se níveis altos de insulina plasmática.
h. Verifica-se metabolização de glicose-6-fosfato pela glicólise.
i. Está ocorrendo intensa beta-oxidação de ácidos graxos de tal forma que não
há oxalacetato suficiente para colocar não ciclo de Krebs o produto desta beta-
oxidação.
j. A glicose-6-fosfato no citossol é utilizada na síntese de glicogênio.

Exercícios de Biologia Molecular

Estrutura e Função dos Ácidos Nucleicos

1. Quais as diferenças de composição e estrutura entre RNA e DNA. Como se


distingue entre a uracila e a timina, e entre a ribose e a desoxirribose.
2. Escreva a estrutura da 5' - desoxiadenosina trifosfato (dATP). Especifique o
tipo de ligação entre: (a) a base nitrogenada e o açúcar; (b) o açúcar e o
fosfato; (c) os fosfatos ±,  e Ž .
3. Escreva a sequência de bases da fita complementar do DNA dupla fita que
apresenta uma fita com a sequência:
(5') ATGCCGTATGCATTGCATTC (3')
Exprima, em porcentagem, a composição de bases do DNA de fita dupla.
4. Como são chamadas as ligações covalentes que unem dois nucleotídeos
consecutivos nas moléculas de ácidos nucleicos? Esquematize estas ligações.
5. RNA é facilmente hidrolizado por álcali, enquanto DNA não é. Por que?
6. Explique por que os ácidos nucleicos são desnaturados quando submetidos
a alta temperatura ou pHs extremos? Como estas moléculas podem ser
renaturadas?
7. Defina Temperatura de fusão (Tm) e efeito hipercrômico.
8. O valor de Tm para o DNA pode ser calculado usando-se a fórmula :
Tm = 69,3 + 0,41(%GC), onde GC é a porcentagem de Guanina + Citosina
a. DNA de E. coli contém 50% GC. Calcular o Tm para o DNA desta bactéria.
b. As curvas de fusão da maioria dos DNAs que ocorrem naturalmente revelam
que o Tm é normalmente maior do que 65oC. Por que isto é importante para a
maioria dos organismos?
c. Como varia o Tm com a força iônica da solução?
d. O que acontece com Tm quando se adiciona etanol à solução de DNA?
9. Quais as principais características da dupla-hélice de DNA de acordo com o
modelo proposto por Watson e Crick?
10. Descreva os principais experimentos que indicaram que o DNA é o material
genético.
11. O que são topoisomerases?
12. O núcleo de uma célula humana tem 6ºm de diâmetro e a extensão total do
DNA dos seus 46 cromossomos soma 1,8m. Como é resolvida a discrepância
entre estas duas grandezas?
13. Esquematize a estrutura do nucleossomo. Qual a característica bioquímica
principal das histonas e qual o seu papel na organização da cromatina?

Código Genético e estrutura gênica

1. Baseando-se na lista de códons e amino ácidos abaixo, quais das seguintes


afirmações são corretas?
AGU = serina AGC = serina
AAU = asparagina AAC = asparagina
AUG = metionina AUA = isoleucina
a. o código genético é degenerado
b. a alteração de um único nucleotídeo no DNA que dirige a síntese destes
códons poderia levar à substituição de uma serina por uma asparagina no
polipeptídeo.
c. a alteração de um único nucleotídeo no DNA que dirige a síntese destes
códons necessariamente levaria à substituição de um aminoácido no
polipeptídeo codificado.
d. um tRNA com o anticódon ACU se ligaria a um ribossomo na presença de
um destes códons.
2. Uma globina de 146 aminoácidos sofreu uma mutação no códon
correspondente ao sexto aminoácido da cadeia. A análise do DNA indicou uma
mudança de (5')TTC(3') para (5')TAC(3') na fita molde. Pergunta-se :
a. A mutação provocou a troca de um aminoácido por outro? Em caso
afirmativo, qual é este aminoácido?
b. Quais as implicações para a estrutura da proteína?
c. Qual seria o resultado se a mesma troca ocorresse na base do lado (5') do
DNA?
3. Uma fita de um fragmento de DNA isolado de E. coli tem a seguinte
sequência
5'...AGGTTACCTAGTTGC...3'
Suponha que um mRNA seja transcrito a partir deste DNA usando a fita
complementar como molde. Qual será a seqüência deste mRNA? O que você
pode dizer sobre a capacidade de formação de um híbrido RNA-DNA?
4. Qual é a sequência do polipeptídeo que seria codificado pelo mRNA
sintetizado na
questão 3. Assuma que o quadro de leitura começa com o primeiro
nucleotídeo.
5. Desenhe a estrutura de um gene de procarioto com seus principais
elementos.
6. Desenhe a estrutura de um gene de eucarioto com os seus principais
elementos.
7. Defina RNA poli-cistrônico e mono-cistrônico.

Replicação/ Mutação e Reparo de DNA

1. Combine as propriedades ou funções na coluna à direita com a DNA


polimerase na coluna da esquerda:
(a) DNA polimerase I (1) envolvida na replicação
(b) DNA polimerase II (2) requer um iniciador e um molde
(c) DNA polimerase III (3) envolvida no reparo de DNA
(4) sintetiza a maior parte do DNA durante a replicação
(5) remove o iniciador e preenche as lacunas durante a replicação
2. O fragmento de DNA no esquema abaixo é de fita dupla em ambas as
extremidades porém de fita simples no meio. A polaridade da fita superior está
indicada.
5'__________________________3'
__________P HO_________
a. O fosfato (P) indicado na fita inferior está na extremidade 5' ou 3' do
fragmento ao qual ele pertence ? (Indique no esquema).
b. Como você esperaria que a lacuna fosse preenchida pelos processos de
reparo do DNA "in vivo" ?
c. Quantos fragmentos você esperaria encontrar na fita inferior se o
experimento fosse realizado "in vitro", na presença de todos os
desoxirribonucleotídeos-trifosfato e DNA polimerase?
3. Qual a atividade da DNA polimerase III que é responsável pela editoração
durante a replicação ?
4. Que propriedades do DNA e da DNA polimerase sugerem que a duas fitas
não podem ser replicadas pelo crescimento no mesmo sentido (como mostra a
figura abaixo)? Como a célula supera o problema? Esquematize a formação da
ligação fosfodiester durante a replicação a partir do nucleotídeo trifosfato livre
mostrando o grupo fosfato que é incorporado.

5. Descreva brevemente as 3 etapas de reparo por excisão do DNA lesado por


luz UV e as enzimas nelas envolvidas.
6. Como a maquinaria de reparo de E. coli identifica a fita de DNA que tem um
nucleotídeo não complementar incorporado durante a replicação?
7. Visto que U pareia com A tão bem quanto T pareia com A, por que somente
T é encontrado no DNA? Esquematize o sistema que repara a substituição C
por U.

Transcrição e Processamento de RNA

1. Dê a composição de subunidades da holoenzima e do cerne da RNA


polimerase de E. coli, atribuindo funções às subunidades.
2. As DNA polimerases necessitam de um iniciador, ao qual se liga um novo
nucleotídeo para o crescimento da cadeia polinucleotídica. É necessário um
iniciador para a ação da RNA polimerase?
3. Que subunidades da RNA polimerase bacteriana são necessárias para a
iniciação da transcrição a partir de um promotor? E para a terminação da
transcrição? Explique como uma mutação poderia dar origem a uma E. coli
resistente ao antibiótico rifamicina.
4. Uma pequena cadeia de RNA sintetizado in vitro tem a seguinte seqüência:
5'- AUGUACCGAAGUGGUUU - 3'
a. Coloque os grupos fosfato e um asterisco naqueles que serão radiativos
quando a transcrição for feita na presença de [g 32P]-ATP
b. Faça o mesmo para [a 32P]-UTP
5. Defina "promotor", enumere as suas propriedades e diga como podem ser
localizados através da técnica de "footprinting".
6. A sequência de um segmento de uma molécula. de DNA duplex é:
(a) 5'-ATCGCTTGTACGGA-3'
(b) 3'-TAGCGAACATGCCT-5'
Quando este segmento serve de molde para a RNA polimerase de E. coli ele
dá origem a um segmento de RNA com a seguinte sequência:
(c) 5'-UCCGUACAAGCGAU-3'.
Indique:
a. a fita codificadora;
b. a fita senso;
c. a fita molde;
7. Quais as principais características das sequências de promotores de genes
eucarióticos transcritos em mRNAs? Qual a função dos fatores de transcrição e
"enhancers"?
8. Em que consiste o terminal 5' cap do mRNA e qual o seu papel ? Qual a
característica do terminal 3' encontrado na maioria dos mRNAs de eucariotos e
como eles são formados ?
9. Genes de eucariotos são geralmente constituídos de introns e exons. Estas
seqüências são tanto transcritas como traduzidas? A remoção dos íntrons
(splicing) tem que ser um processo extremamente preciso. Por que? Dê um
exemplo de "splicing" aberrante que leva a um tipo de talassemia em humanos.

10. Suponha que o DNA humano é clivado em fragmentos do tamanho


aproximado de um mRNA humano maduro e que então são preparados
híbridos RNA-DNA. O mesmo procedimento é repetido com E. coli. Quando os
híbridos RNA-DNA de cada espécie são examinados ao microscópio eletrônico,
qual deles mostra o maior grau de hibridização? Explique e faça um esquema.
11. O mRNA monocistrônico de eucariotos geralmente representa o transcrito
primário? E o mRNA dos procariotos? Explique. Faça uma comparação,
indicando as principais diferenças encontradas em eucariotos entre um gene,
seu transcrito primário e o mRNA maduro que deixa o núcleo para a tradução
no citoplasma.

Síntese de Proteínas

1. Escreva os produtos finais das seguintes reações:


a. valina + ATP + tRNAVal + valil-tRNA sintetase .
b. valina + ATP + tRNAIle + isoleucil-tRNA sintetase .
2. Em um experimento verificou-se que Cys-tRNACys pode ser convertido a
Ala-tRNACys e usado num sistema in vitro de síntese de proteínas.
a. Se o Ala-tRNACys for marcado com 14C no aminoácido, a alanina marcada
seria incorporada na proteína sintetizada no lugar de outros resíduos Ala ?
Explique.
b. O que o experimento indica sobre a importância da precisão da reação da
aminoacil-tRNA sintetase em relação ao processo global da síntese protéica ?
3. De acordo com o princípio de oscilação no pareamento de bases ("wobble"),
qual o número mínimo de tRNAs necessário para decodificar os seis códons de
leucina - UUA, UUG, CUU, CUC, CUA e CUG ? Explique.
4. Em procariotos, a maioria da cadeias polipeptídicas são iniciadas com o
aminoácido ______, cujo códon é ______.
5. Num sistema de síntese de proteínas in vitro, que permita o início e término
da síntese em qualquer sequência de RNA, que peptídeo seria produzido pelo
poli-ribonucleotídeo
5'-UUUGUUUUUGUU-3' ? Indique qual o aminoácido N-terminal e o C-terminal
do polipeptídeo obtido.
6. O códon AUG funciona tanto para iniciar uma cadeia polipeptídica quanto
para dirigir a incorporação de uma metionina em posições internas de uma
proteína. Quais os mecanismos de seleção do códon AUG para a iniciação da
tradução em procariotos ?
7. Para cada uma das etapas da tradução, descritas abaixo, dê o nucleotídeo
trifosfato envolvido como cofator e o número de ligações fosfato de alta energia
consumidas.
a. Ativação do aminoácido
b. Formação do complexo de iniciação 70S (procariotos) ou 80S (eucariotos)
c. Entrada do aminoacil-tRNA no ribossomo
d. Formação da ligação peptídica
e.Translocação
8. Os três códons de terminação são ______, _______ e ______.
9. Considere a seguinte sequência de um fragmento de DNA isolado de
bactéria:
5'
CTGATAAGGGATTTAAATTATGTGTCAATCACGAATGCTAATCGCTTAACAC
TTC 3'
Assumindo que esta sequência corresponde a sequência da fita codificadora,
qual seria a sequência de aminoácidos do polipeptídeo produzido quando um
mRNA transcrito deste gene for traduzido? Que características na sequência
do mRNA determinam qual é o códon iniciador? Considere a primeira base
como o início da transcrição.