Cellular Microbiology (2008) 10(6), 12591273

doi:10.1111/j.1462-5822.2008.01124.x First published online 15 February 2008

Resistance to antimicrobial peptides contributes to persistence of Salmonella typhimurium in the C. elegans intestine
Rosanna A. Alegado1 and Man-Wah Tan1,2* Departments of 1Microbiology and Immunology and 2 Genetics, School of Medicine, Stanford University, Stanford, CA 94305, USA. Summary The human pathogen Salmonella typhimurium can colonize, proliferate and persist in the intestine causing enteritis in mammals and mortality in the nematode Caenorhabditis elegans. Using C. elegans as a model, we determined that the Salmonella pathogenicity islands-1 and -2 (SPI-1 and SPI-2), PhoP and the virulence plasmid are required for the establishment of a persistent infection. We observed that the PhoP regulon, SPI-1, SPI-2 and spvR are induced in C. elegans and isogenic strains lacking these virulence factors exhibited signicant defects in the ability to persist in the worm intestine. Salmonella infection also leads to induction of two C. elegans antimicrobial genes, abf-2 and spp-1, which act to limit bacterial proliferation. The SPI-2, phoP and DpSLT mutants are more sensitive to the cationic peptide polymyxin B, suggesting that resistance to worms antimicrobial peptides might be necessary for Salmonella to persist in the C. elegans intestine. Importantly, we showed that the persistence defects of the SPI-2, phoP and DpSLT mutants could be rescued in vivo when expression of C. elegans spp-1 was reduced by RNAi. Together, our data suggest that resistance to host antimicrobials in the intestinal lumen is a key mechanism for Salmonella persistence. (Baumler et al., 1998) in the presence of a number of host imposed stresses, including low pH in the stomach, bile and antimicrobial peptides (AMPs) in the small intestine, and an aerophilic to microaerophilic shift (Foster and Spector, 1995; Rychlik and Barrow, 2005). Although a number of S. typhimurium virulence determinants essential for infecting the mammalian intestinal tract have been described (reviewed in Darwin and Miller, 1999; Wallis and Galyov, 2000), their interactions with host-derived factors in vivo are largely unknown. Specic virulence factors have been shown to act at discrete phases of infection (Galan, 2001). Within the terminal ileum of the small intestine, attachment and invasion are mediated by activation of SPI-1 and SPI-4 (Finlay and Falkow, 1997; Morgan et al., 2004). Following translocation through the intestinal epithelia, SPI-2 and PhoPQ are critical for survival in phagocytes (Fields et al., 1989; Hensel et al., 1998). PhoQ directly senses AMPs (Bader et al., 2005), acidic pH, changes in cation concentration (Bearson et al., 1998), as well as membrane damage brought about by several classes of AMPs that result in modication of bacterial lipopolysaccharide (Groisman et al., 1989; Groisman et al., 1992). SPI-2 is also thought to respond to acidic pH and cation depletion within the phagolysosome (Kim and Falkow, 2004). Recently, components of the PhoP regulon (Merighi et al., 2005) and SPI-2 (Brown et al., 2005) were reported to be expressed prior to invasion of murine intestinal enterocytes. These ndings have expanded the activities of PhoP and SPI-2 beyond the intracellular stage of infection. In addition, SPI-2 appears to be required for pathogenesis in a murine colitis model, in which bacteria remain predominantly luminal (Coburn et al., 2005). Furthermore, mutants lacking pmrH, the rst gene within the PhoP-regulated operon required for LPS modication in response to AMPs, are attenuated by oral infection (Gunn et al., 2000). The exact roles that PhoP and SPI-2 play during the intestinal phase of infection are not clear. The molecular cues of acidic pH and AMPs present within the intracellular environment of the phagolysosome are also present in the gastrointestinal tract and may have similar roles in inducing virulence gene expression. In the current study, we used infection of C. elegans by Salmonella as the experimental system to explore the role

Introduction Salmonella typhimurium is a Gram-negative pathogen that causes enteritis in humans and livestock (Baumler et al., 1998; Kingsley and Baumler, 2000). Salmonella evolved to exist in the alimentary tract of the host
Received 12 October, 2007; revised 8 January, 2008; accepted 8 January, 2008. *For correspondence. E-mail mwtan@stanford.edu; Tel. (+1) 650 736 1688; Fax (+1) 650 725 1534. Present address: Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, CA 94720, USA. 2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd

1260 R. A. Alegado and M.-W. Tan of bacterial virulence factors and host intestinal AMPs during infection. C. elegans has proven to be an amenable infection model for a number of bacterial pathogens, including S. typhimurium (reviewed in Alegado et al., 2003; Kurz and Ewbank, 2007). One striking feature of S. typhimurium pathogenesis in C. elegans is its ability to colonize and establish a persistent intestinal infection, even after a limited exposure (Aballay et al., 2000; Labrousse et al., 2000). Worms feeding on the laboratory food source Escherichia coli OP50 can limit bacterial proliferation in their gut. In contrast, worms feeding on pathogenic S. typhimurium rapidly accumulate the pathogen in the intestine concomitant with bacterial proliferation and distention of the intestinal lumen. However, the bacterial factors required for persistence have yet to be fully investigated. A large number of putative AMP genes encoded in the C. elegans genome are expressed in the pharynx and intestine, sites of contact with intestinal microbes (Alegado et al., 2003; Kurz and Tan, 2004), suggesting that AMPs may play a signicant role in hostpathogen interactions. Two of these, ABF-2 (Kato et al., 2002) and SPP-1 (Banyai and Patthy, 1998), have demonstrated antimicrobial activity. ABF-2 is homologous to insect and mollusk defensins and recombinant ABF-2 has broad activity against a number of yeast, Gram-positive and Gram-negative bacteria. Under normal growth conditions, abf-2 is constitutively expressed in the pharynx (Kato et al., 2002). SPP-1 is a member of the saposin-like protein family, which includes mammalian NK-lysin and granulysin. SPP-1 is active against E. coli (Banyai and Patthy, 1998) and is expressed in the intestine (Alper et al., 2007). While the in vitro activity of these proteins implicates their role in host defence, the immunological signicance of ABF-2 and SPP-1 has not yet been demonstrated at the organismal level. Here, we show that SPI-1, SPI-2, PhoP and the virulence plasmid are required for optimal establishment of a persistent intestinal infection in C. elegans. We observe that in vivo induction of bacterial virulence genes coincides with the induction of host innate defence factors, ABF-2 and SPP-1. Moreover, both worm antimicrobials appear to be instrumental in controlling bacterial proliferation in the intestine. Results Salmonella virulence genes are specically expressed in vivo during infection of C. elegans Although C. elegans is efficient at limiting proliferation of E. coli, its laboratory food source, worms are less effective at preventing colonization of S. typhimurium. Salmonella infection appears to be restricted to the intestinal lumen and a number of bacterial genes that contribute to mortality have been identied (Aballay et al., 2000; Labrousse et al., 2000; Tenor et al., 2004). While PhoP, SPI-1 and SPI-2 are required for killing over a course of 9 days (Aballay et al., 2000), the mechanisms by which these virulence factors operate in the worm is unknown. We sought to dene the context in which each of these virulence factors may act in vivo during C. elegans infection. Wild-type worms were infected with S. typhimurium (SL1344) bearing individual promotergfp fusions: prgH (Hautefort et al., 2003), ssaG (Hautefort et al., 2003) and mig-14 (Brodsky et al., 2002), reporters for transcriptional activity of SPI-1, SPI-2 and the PhoP regulon respectively. PrgH and SsaG are structural components of the type III secretion apparatus and Mig-14 is a protein involved in resistance to AMPs that is dependent on PhoP for expression (Valdivia et al., 2000; Brodsky et al., 2005). The spatiotemporal expression of each of these reporters within C. elegans was determined every 24 h. GFP expression was detected within the intestinal tract of C. elegans 48 h after initial exposure (Fig. 1AF). Importantly, under our assay conditions, these promoter fusions were expressed specically in vivo and not when grown on solid media alone. As no intracellular bacteria were detected within C. elegans intestinal cells over the course of the experiment, either by uorescence or electron microscopy (data not shown), our observations indicate that these genes are expressed during extracellular infection of the worm intestine. To directly assess the transcript abundance of the reporter genes during early infection, we monitored gene expression in vivo using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). Because the PhoP regulon is diverse and complex, we included other genes in our analysis in addition to mig-14. PhoP regulates its own transcription as well as SlyA, a transcription factor that activates a distinct set of genes (Norte et al., 2003) and, indirectly, PmrA that activates the LPS modication pathway in response to AMPs (Gunn and Miller, 1996). The mig-14 and pagC genes appear to be regulated by both SlyA and PhoP, by a mechanism that is not yet understood (Navarre et al., 2005). We chose the transcription factors SlyA and PmrA, as well as downstream targets mig-14, pagC and pagD to represent the PhoP regulon during infection. We also quantied expression of spvR, the regulator of the spv locus on the virulence plasmid (pSLT) that has been shown to be required for full virulence in mammals and mortality in worms (Tenor et al., 2004). The transcript levels of these bacterial genes within infected worms were determined 1, 24, 48 and 72 h after initial exposure and normalized to RNA levels from bacteria grown on solid media from matched time points. At 48 h of infection, the transcript levels of bacterial prgH, ssaG and mig-14 within C. elegans intestine was approximately 10-fold higher than in bacteria grown on

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

Persistence of Salmonella in the C. elegans intestine 1261

Fig. 1. In vivo expression of Salmonella virulence genes. GFP expression in wild-type worms infected for 48 h with S. typhimurium bearing gfp fused to the promoter of prgH (A, B), ssaG (C, D) or mig-14 (E, F). Representative images showing DIC (A, C, E), and merge image from I3 (GFP, green) and A4 (auto-uorescence, blue) lters. B, D and F are at 400 magnication. Note: Bacteria carrying PprgH::gfp and Pmig-14::gfp consistently displayed GFP signal localized as aggregates adjacent to intestinal cells (B and F). Fluorescence from PssaG::gfp-expressing bacteria was observed in cells not associated with intestinal cells (D, arrowheads). (G and H) Relative levels of Salmonella gene transcripts during C. elegans infection as determined by qRT-PCR. Levels of Salmonella transcripts obtained from infected worms were normalized to levels of transcripts from bacteria grown on solid media at matched time points, 1 h (G) 24 h (H), 48 h (I) and 72 h (J). Shown is the mean s. e. of ve independent experiments. Dotted line indicates normalized transcript levels of each gene in solid media controls. Unpaired t-test, * P < 0.05,** P < 0.01, ***P < 0.001.

solid media (Fig. 1I), thus conrming the reporter assays that the SPI-1, SPI-2 and PhoP regulons are expressed during intestinal colonization of C. elegans (Fig. 1AF). In addition, two distinct transcriptional patterns were observed. The rst set, composed of the genes within the PhoP regulon, was highly expressed in vivo within 1 h of exposure relative to bacteria grown on plates (Fig. 1G). At 24 h, these transcripts were no longer induced relative to external bacteria (Fig. 1H). However, later during infection, at 48 and 72 h, expression of the phoP regulon was once again induced (Fig. 1I and J). The reason for this dynamic change is currently not understood. In contrast, in vivo levels of the second set of transcripts, prgH, ssaG and spvR, were initially indistinguishable from external bacteria at the rst hour of infection (Fig. 1G) but were

signicantly higher after 24 h of infection and was sustained until at least 72 h of infection (Fig. 1HJ). The varied expression of these virulence gene sets implies that the worm gut may exert a number of stresses that Salmonella must respond to and suggests that these Salmonella virulence pathways may play a critical role during extracellular infection and persistence. Several Salmonella virulence factors are required for colonization of the worm intestine Caenorhabditis elegans exposed to Salmonella begin to die at day 4 of infection (Aballay et al., 2000), yet the expression pattern of genes within the PhoP regulon, SPI-1, SPI-2 and pSLT during C. elegans infection

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

1262 R. A. Alegado and M.-W. Tan

Fig. 2. Kinetics of colonization of wild-type C. elegans by constant exposure to S. typhimurium. A. Colonization categories. Shown are merged representative images taken with the A4 (autouorescence, blue) and I3 (GFP, green) lters at 200 magnication. Asterisk indicates the grinder in the worm pharynx. B. Colonization of wild-type worms by Salmonella. One-day-old adult wild-type worms were exposed to S. typhimurium SM022 or isogenic mutants. For each bacterial strain tested, the extent of colonization was scored in four sets of 10 worms every 24 h. Shown is a representative of three independent experiments with the average fraction of the population colonized for each category. Chi-squared test, *P < 0.05, **P < 0.001.

suggest that these virulence factors might be required early, perhaps during the establishment of an intestinal infection. We therefore ascertained the consequence of lacking phoP, orgA (SPI-1) or ssaV (SPI-2) or the virulence plasmid (DpSLT) on the ability of S. typhimurium to colonize the C. elegans. We accomplished this by following the kinetics of bacterial accumulation in the nematode intestine over time. The population of intestinal Salmonella reaches between 104 and 105 bacteria/worm the rst 3 days of infection (data not shown, Aballay et al., 2000). To take advantage of the ability to visualize bacteria within living worms over the course of infection, we infected animals with SM022, a derivative of SL1344 harbouring a single chromosomal copy of gfp constitutively driven by the rpsM promoter (Vazquez-Torres et al., 1999). SM022 is phenotypically identical to wild-type SL1344 under all conditions tested (data not shown). Worms were visually scored for severity of colonization based on the extent of luminal distention and gfp signal in the intestine (Fig. 2A). As worms have a number of mechanical and chemical mechanisms for restricting bacteria in the gut, individual animals were colonized at different rates (Fig. 2B). Compared with SM022, the phoPgfp, DpSLTgfp, orgAgfp and ssaVgfp isogenic mutants colonized C. elegans to a similar degree during the rst 48 h of infection. After 72 h, however, these mutants colonized C. elegans signicantly less than SM022 (Fig. 2B). Specically, almost 90% of animals feeding on SM022 scored in the full colonization category whereas animals constantly exposed to any of

the mutants had a score of 50% or less. Differences between SM022 and mutants were also notable when we compared the change in the severity of colonization between 48 and 72 h (Fig. 2B, chi-squared test, P < 0.0001). For example, whereas the full category for SM022 increased from approximately 40% to 90%, the increase was signicantly less for orgAgfp, and for phoPgfp, DpSLTgfp and ssaVgfp, no signicant increase was observed. We therefore conclude that PhoP, pSLT, SPI-2, and to a lesser extent SPI-1, are required to promote Salmonella colonization of the C. elegans intestinal lumen. This was unexpected because SPI-2 and the virulence plasmid pSLT have generally been associated with systemic infection and macrophage persistence in mammals (Libby et al., 1997; Shea et al., 1999). C. elegans antimicrobial genes are induced during Salmonella infection and are required to limit bacterial proliferation in the intestine. During S. typhimurium infection of mice, a-defensins, such as cryptidin, are critical for controlling bacterial burden (Wilson et al., 1999). We asked if C. elegans AMPs, such as SPP-1 and ABF-2, could be important in preventing bacterial colonization. ABF-2 and SPP-1 have demonstrated antibacterial activity in vitro (Banyai and Patthy, 1998; Kato et al., 2002) and are expressed in the gastrointestinal tract, but their involvement in protecting C. elegans from bacterial infection are not known. As an

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

Persistence of Salmonella in the C. elegans intestine 1263

Fig. 3. Antimicrobial response to Salmonella. A,B. Expression of abf-2 and spp-1 during Salmonella infection, as determined by qRT-PCR. Total RNA was obtained from N2 animals feeding on E. coli OP50 or S. typhimurium SM022 at the L4 stage for 1, 24 and 48 h. At 24 h time point, worms were adults. Relative expression levels are shown as fold difference normalized to the 1 h time point in animals feeding on E. coli. Shown is the mean standard error of ve independent experiments. Signicance was determined by paired t-test (*P < 0.05, **P < 0.01). C. Efficacy of RNAi knock-down as veried by semi-quantitative RT-PCR. RNA from worms raised on abf-2 dsRNA, spp-1 dsRNA, or vector control, followed by 24 h exposure to SM022. ama-1 was used as loading control. Wedges indicate serial dilution of input cDNA for PCR reaction. D. Effect of AMP knock-down on bacterial load. N2 worms raised from egg in the presence of abf-2 dsRNA, spp-1 dsRNA or vector control were exposed to SM022 as L4 larvae. Each data point represents the colony forming units per worm (CFU worm -1) obtained from a pool of 10 infected worms 48 h after initial exposure. Horizontal bar indicates the cumulative geometric mean of three independent experiments. Signicance was determined by MannWhitney statistical analysis between vector control and RNAi treatment (* P < 0.05, **P < 0.01).

initial step toward assessing the role of these antimicrobial effectors during C. elegans infection, we determined the levels of abf-2 and spp-1 transcripts in wild-type (N2) worms under infection and normal growth conditions by qRT-PCR. In agreement with previous ndings (Kato et al., 2002), abf-2 gene transcripts could be detected at the fourth larval stage (L4) and in young adults (Figs 3A, E. coli). The spp-1 transcript was also detected in L4 and increased as worms progressed into early adulthood (Figs 3B, E. coli). In Salmonella-infected worms, the abf-2 transcript levels were initially indistinguishable from age-matched uninfected worms within the rst 24 h of exposure. However, at 48 h the expression of abf-2 increased by a hundred-fold (Fig. 3A). spp-1 expression was induced earlier, by approximately 10-fold over uninfected animals at 24 h, and was sustained at 48 h of exposure to Salmonella (Fig. 3B). These results suggest that increased expression of abf-2 and spp-1 is likely a host defence response elicited by S. typhimurium

challenge and may be a part of the worms antimicrobial arsenal. To more directly assess the importance of abf-2 and spp-1 in defence against Salmonella, we investigated the effect of decreased expression of these antimicrobial genes on the ability of Salmonella to colonize C. elegans. Knock-down of individual antimicrobial genes was achieved by feeding-mediated RNA interference (RNAi) (Timmons et al., 2001). Wild-type N2 animals were raised from eggs on E. coli expressing abf-2 double-stranded RNA (dsRNA), spp-1 dsRNA or vector control to the L4 larval stage. L4 animals were shifted to SL1344 for 48 h. Knock-down of abf-2 and spp-1 expression in RNAitreated worms exposed to Salmonella for 48 h was veried by semi-quantitative RT-PCR (Fig. 3C). We determined the colony forming units (CFUs) of Salmonella recovered from RNAi-treated animals and compared them with the numbers recovered from the vector control. We assume that the CFUs recovered reect the number of

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

1264 R. A. Alegado and M.-W. Tan viable bacteria in the intestinal lumen as the infection is extracellular. We found that worms decient in either abf-2 (P = 0.03) or spp-1 (P = 0.009) had a signicantly higher bacterial load compared with the control (Fig. 3D). Together, our data suggest that induction of abf-2 and spp-1 in response to Salmonella infection contributes to host resistance by limiting the extent of Salmonella proliferation in the intestinal lumen. Salmonella virulence factors required for colonization also contributes to bacterial persistence in the worm gut Colonization of the worm intestine by Salmonella, as determined by the constant exposure assay (Fig. 2B), is dependent on both the ability to enter the lumen intact (Avery and Shtonda, 2003) and the ability to survive in the presence of host immune effectors (Fig. 3D). Our results thus far indicate that multiple virulence genes are required for progressive accumulation of Salmonella in the C. elegans digestive tract. To limit pathogen burden, the worm, in turn, induces transcription of host AMPs abf-2 and spp-1. The Salmonella mutants examined here were also found to exhibit varying rates of entry into the intestinal lumen (data not shown). To distinguish between bacterial entry and persistence, we developed an assay in which the differential rate of bacterial entry into the intestine is eliminated. This is achieved by using a worm strain, tnt-3(aj3) that is unable to limit entry of bacteria into the intestine owing to a defective grinder, but is otherwise wild type for immune function (Kim et al., 2002). Compared with N2, tnt-3(aj3) animals were rapidly and uniformly colonized by SM022 (Fig. 4A). For the persistence assay, C. elegans tnt-3(aj3) were exposed to either SM022 or GFP-labelled mutants for 20 h, then shifted to an E. coli food source. After a 20 h exposure, each of the GFPlabelled S. typhimurium mutants accumulated in tnt-3(aj3) animals to the same extent as SM022, mitigating any disparity in entry among bacterial mutants (Fig. 4B, initial). After feeding on E. coli for 12 h, these animals were visually assessed for the presence of GFP-positive bacteria in the intestine as a readout for persistence. Following the shift, 80% of tnt-3(aj3) worms retained SM022 in their intestine (Fig. 4B, shift). By contrast, a signicantly lower proportion of worms initially exposed to phoPgfp, DpSLTgfp, orgAgfp and ssaVgfp retained GFPpositive bacteria in their digestive tract (Fig. 4B, shift), suggesting that these bacterial mutants have persistence defects. To conrm the visual observations, we quantied the severity of the persistence defect of SPI-1 (orgAgfp), SPI-2 (ssaVgfp), phoPgfp and DpSLTgfp mutants. We determined the bacterial load in worms after feeding on Salmonella for 20 h and after being shifted to E. coli for 12 and 36 h. Enumeration of intestinal bacteria showed that,

Fig. 4. Persistence phenotypes of S. typhimurium virulence mutants in the C. elegans intestine. A. Colonization kinetics of N2 and tnt-3 animals. The extent of colonization was determined in four sets of 10 worms every 24 h using the colonization categories as shown in Fig. 2A. Shown is a representative of three independent experiments with the average fraction of the population colonized for each category. B. Visual assessment of persistence. tnt-3 animals were exposed to S. typhimurium SM022, phoPgfp, orgAgfp, ssaVgfp and DpSLTgfp for 20 h then shifted to the normal food source, OP50-rif. Three sets of 40 worms were visually scored as GFP+ or GFP- after 20 h exposure to S. typhimurium (initial), and 12 h after shift to OP50-rif (shift). Shown is a representative of three independent experiments with the mean SD. Students t-test, *P < 0.05, **P < 0.01, ***P < 0.001. C. Quantication of S. typhimurium persistence in the intestine of tnt-3 by viable cell counts over a 36 h time course. Each data point represents the colony forming units per worm (CFU worm-1) obtained from a pool of 10 infected worms. Data points show the mean SD of representative of at least two independent experiments.

similar to the visual assay, all the Salmonella mutants reached levels in the intestine that were indistinguishable from SM022 prior to the shift of the animals to an E. coli food source (Figs 4C. t = 0), suggesting that these strains reach equivalent initial inoculum in the worm intestine.

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

Persistence of Salmonella in the C. elegans intestine 1265 Worms exposed to SM022 displayed a 10-fold drop in CFUs 12 h after the shift to E. coli; the bacterial load remained relatively constant 36 h after the shift (Fig. 4C). In contrast, worms exposed to orgAgfp, phoPgfp and DpSLTgfp had approximately 1000-fold lower CFUs than SM022, and ssaVgfp had approximately 100-fold lower CFUs than SM022, after the 12 h shift, further supporting results from the visual assay. The differences in bacterial load between SM022 and the isogenic mutants were even greater 36 h after shift (Fig. 4C), demonstrating that PhoP, SPI-1, SPI-2 and the virulence plasmid are required for persistence in the worm intestine. Knock-down of antimicrobials specically rescues persistence defects of Salmonella virulence mutants We asked whether the persistence defects due to loss of SPI-1, SPI-2, PhoP, or the virulence plasmid could be a consequence of their failure to cope with the hosts innate defences. If the persistence defect of a bacterial mutant could be rescued by decreasing the levels of a C. elegans AMP, this would suggest that an important role of the virulence factor in vivo is to confer protection from the host defence molecule. We observed that the spp-1 and abf-2 expression was effectively knocked down in tnt-3(aj3) worms by RNAi (Fig. 5E), and that the AMP-dependent rescue was specic. Knock-down of abf-2 or spp-1 expression in C. elegans completely restored persistence of the phoPgfp mutant to SM022 levels (Fig. 5A), consistent with PhoPs known role in protection against AMPs. Conversely, RNAi of spp-1 or abf-2 in the worm failed to rescue the persistence defect of the orgAgfp strain (Fig. 5D). However, lowering expression of antimicrobial genes had distinct effects on the ability of ssaV to persist in vivo. Knock-down of abf-2 expression had no effect on ssaVgfp persistence, whereas knock-down of spp-1 expression restored the persistence of the ssaVgfp mutant to the wild-type level (Fig. 5C). These data suggest that SPI-2 might be important for resistance to a specic class of antimicrobials, the saposin-like SPP-1, but not the defensin-like ABF-2. Like the phoP mutant, persistence of DpSLT in spp-1 and abf-2 RNAi-treated worms returned to wildtype levels (Fig. 5B), supporting a role for pSLT in conferring protection from host AMPs. If our ndings were predictive of resistance to AMPs, then, in addition to PhoP and SPI-2, which have involvement in resistance to cationic peptides (Groisman et al., 1992; Deiwick et al., 1998), DpSLT should also be sensitive to AMPs, and orgA should be unaffected by treatment with antimicrobials. Polymyxin B (PB) is a cationic peptide that interacts with the outer and inner membranes of Gram-negative bacteria in a similar fashion as many AMPs (Vaara, 1992; Trent et al., 2001). Because resistance of Salmonella to PB also correlates with resistance to AMPs derived from eukaryotic hosts, such as protegrin-1, magainin, and cathelicin-related AMP (Brodsky et al., 2002; Rosenberger et al., 2004), we used PB to determine whether the panel of Salmonella mutants was generally sensitive to antimicrobials. We tested our hypothesis using a standard PB resistance assay (Groisman et al., 1997). The phoP and ssaV mutants were signicantly more sensitive PB than wild type (Fig. 5F), consistent with previous reports (Rathman et al., 1996; Deiwick et al., 1998). The DpSLT mutant was also sensitive to PB treatments, and displayed stronger sensitivity to PB than ssaV (Fig. 5F). The role of pSLT in resistance against AMPs has not been previously observed. Notably, survival of orgA mutant in PB was essentially the same as wild type (Fig. 5F), indicating that SPI-1 may not be required for adaptation to AMPs. The nding that SPI-1 mutants are not sensitive to PB, and that their persistence defects could not be rescued by the knock-down of C. elegans abf-2 or spp-1, suggest that SPI-1 may be required for other mechanisms necessary to successfully colonize its host, such as attachment to host cells. However, we have not ruled out the possibility that SPI-1 is required to protect Salmonella from other classes of host AMPs that are distinct from PB, SPP-1 or ABF-2. Discussion While initiation of a persistent S. typhimurium infection in the metazoan intestine is an important aspect of pathogenesis, the molecular mechanisms underlying this process in the organismal context remain to be fully elucidated. To gain insights into the early events of Salmonella infection, we used the C. elegans pathogenesis model, which enabled us to genetically manipulate both host and pathogen, and to follow the infection process visually within the intestine a live host. By combining knock-down of host gene expression with the use of attenuated bacterial mutants to study Salmonella persistence in C. elegans, we dened a set of virulence genes required for colonization and protection from host antimicrobials in vivo. Together, these ndings imply that host AMP-mediated defences are an important challenge Salmonella must overcome in order to establish a long-term infection within the nematode intestine. Specically, we show that as part of an immune response to Salmonella infection, C. elegans induces the expression of ABF-2 and SPP-1 A that are essential for limiting bacterial proliferation in the worms digestive tract. We show that survival of Salmonella in the intestine is multifactorial, and that resistance to host AMPs, promoted by SPI-2, PhoP and pSLT, is a critical mechanism of persistence in vivo.

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

1266 R. A. Alegado and M.-W. Tan

Fig. 5. Interaction between host antimicrobials and Salmonella virulence factors. Worms raised from egg in the presence of to abf-2 dsRNA, spp-1 dsRNA, or plasmid control were exposed as L4 to S. typhimurium SM022, phoPgfp (A), DpSLTgfp (B), ssaVgfp (C), or orgAgfp (D) for 20 h. Bacterial load was determined 12 h after shift to E. coli. Individual data points represent CFUs worm -1 from pools of 10 infected worms; bar indicates the cumulative geometric mean of three independent experiments. MannWhitney non-parametric t-test, *P < 0.05, **P < 0.001, ***P < 0.001. E. Efficacy of RNAi, semi-quantitative RT-PCR. Worms were raised on abf-2 dsRNA, spp-1 dsRNA, or vector control then exposed to SM022 for 24 h ama-1 was used as PCR control. Wedges indicate serial dilution of input cDNA for PCR reaction. F. Resistance of S. typhimurium after 2.5 mg ml-1 polymyxin B challenge. Shown is the mean SD, representative of three independent experiments. unpaired t-test, **P < 0.01, ***P < 0.001.

Salmonella infection elicits a specic immune response in C. elegans In mammals, pathogenic bacteria including S. typhimurium induce AMP production in Paneth cells, one of the four major epithelial cells types in the intestine (Ayabe et al., 2002a, b; Ayabe et al., 2004). AMPs play a key protective role in the mucosa, as evidenced by studies showing that transgenic mice expressing human

beta defensin-5 are resistant to S. typhimurium (Salzman et al., 2003). The immune response of C. elegans to Salmonella has been reported to involve pathogendependent apoptosis in the germline (Aballay and Ausubel, 2001) that appears to be under the control of the p38 mitogen-activated protein kinase pathway (Aballay et al., 2003). Recently, the GATA transcription factor, ELT-2, was identied as a regulator of innate immune responses to a broad spectrum of bacteria, including

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

Persistence of Salmonella in the C. elegans intestine 1267 S. typhimurium (Kerry et al., 2006; Shapira et al., 2006). While ELT-2 and the p38 pathway are necessary to protect C. elegans from Salmonella-mediated mortality, their role during Salmonella colonization and establishment of persistence is not yet known. Our results establish the importance of two bona de AMPs, ABF-2 and SPP-1 on Salmonella pathogenesis in vivo. First, we found that abf-2 and spp-1 were induced in Salmonellainfected worms (Fig. 3A and B). This is congruent with the nding that secretion of the a-defensin cryptidin in the murine intestine is stimulated by S. typhimurium (Wilson et al., 1999). Second, we observed that knockdown in expression of either C. elegans genes by RNAi resulted in increased bacterial load in the host (Fig. 3D). Abrogation of spp-1 expression also resulted in increased proliferation of another Gram-negative pathogen, Pseudomonas aeruginosa (T. Kawli and M.-W. Tan, unpubl. data). Collectively, these results implicate a general role for these antimicrobials against bacterial pathogens in vivo. Similarly, transgenic knockout mice decient in AMPs also had increased bacterial burden (Wilson et al., 1999). Our data corroborate the hypothesis that AMPs in the intestinal lumen contribute signicantly to mucosal defences and highlight the underlying conserved nature of this aspect of innate immunity. It remains to be determined if overexpression of C. elegans AMPs in wild-type animals could also result in increased protection against S. typhimurium as seen in other systems (Salzman et al., 2003). Progressive colonization of the nematode intestine (Fig. 2B) correlates with induction of host defence effectors (Fig. 3A and B), suggesting that a regulated pathway exists, linking bacterial recognition and downstream signalling to expression and release of AMPs. However, the C. elegans pathogen recognition receptors (PRRs) have not been elucidated. The Toll/Toll-like receptor pathway is a conserved component of innate immunity that allows for precise response to different pathogens (reviewed in Hoffmann, 2003). In C. elegans, although some components of the Toll pathway are present and may participate in pathogen recognition, the ultimate output is behavioural (Pujol et al., 2001) rather than effector mediated. Other studies contend that the C. elegans genome encodes several PRRs (ORourke et al., 2006) and whether these may function in host response against Salmonella remains to be determined. Although abf-2 and spp-1 levels are detectable at all time points in our experiments (Fig. 3A and B), the kinetics of induction that occurred 2448 h after initial exposure imply that the induced AMP response may not be due to direct sensing of the bacteria. Given that the rate of response is commensurate with the rate of bacterial colonization, the AMPs induction we observed could be in response to specic bacterial factors produced within the intestinal lumen, or a response to damage to host tissue, similar to a danger signal (Gallucci and Matzinger, 2001). Bacterial persistence in the worm intestine is multifactorial We nd that PhoP, pSLT and the SPI-1 and SPI-2 type III secretion systems of S. typhimurium are expressed in vivo (Fig. 1) and are required to maintain a stable infection of the nematode (Fig. 2B, 4B and C). Expression of SPI-1 in the intestine is well established in mammals (Finlay et al., 1989; Lee and Falkow, 1990) and has been reported in worms (Tenor et al., 2004). An exciting outcome of our work is that a number of genes thought to participate during intracellular growth are expressed and required for extracellular persistence in the nematode digestive tract. This suggests that SPI-2, PhoP and the virulence plasmid must possess additional extracellular functions in the intestine. SPI-2, PhoP and the virulence plasmid are important during the intracellular phase of mammalian infection (Shea et al., 1996; Gulig et al., 1998; Tsolis et al., 1999a). Mammalian systems, such as the calf and murine colitis models that have been developed to examine the enteric phase of salmonellosis have implicated a role SPI-2 in intestinal disease (Coburn et al., 2005; Coombes et al., 2005). Our observation that ssaG is expressed in bacteria restricted to the lumen of C. elegans is in accordance with a previous report that SPI-2 is expressed in the murine ileal loops early in infection (Brown et al., 2005). Collectively, our ndings support the conclusion that SPI-2 has an extracellular role in the development of pathogenesis. We found the expression proles of individual virulence pathways in C. elegans to be temporally distinct (Fig. 1G,H). In particular, genes within the PhoP regulon such as slyA, pmrA, pagC, pagD and mig-14 were rapidly induced, whereas SPI-1, SPI-2 and the spv locus were induced later. Activation of PhoPQ is thought to occur when S. typhimurium encounter membrane stress, such as the acidic environment of the stomach, bile in the duodenum, and AMPs (Rychlik and Barrow, 2005). In agreement with this conjecture, PhoPQ is required for resistance to bile (van Velkinburgh and Gunn, 1999) and mutants in this two-component system are attenuated for colonization of chickens (Methner et al., 2004). In addition, PhoP and its downstream targets were expressed in the intestine of mice (Merighi et al., 2005). It will be interesting to determine if these differences are related to the ability of S. typhimurium to perceive and adapt to precise signals in the C. elegans lumen. The role of the virulence plasmid in enteric disease is less well understood. Several virulence determinants, including the spv locus, rck and the pef mbrial operon are encoded on pSLT (McClelland et al., 2001). While we nd

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

1268 R. A. Alegado and M.-W. Tan the virulence plasmid to be necessary for persistence in the nematode gut, several studies have produced conicting results. Single infection with either S. typhimurium spvR mutants or plasmid-cured strains of S. dublin were fully pathogenic in cattle (Wallis et al., 1995). However, a S. typhimurium spvR mutant showed reduced ability to colonize bovine tissues in a competitive infection (Tsolis et al., 1999b) and pefC mutants were attenuated in attachment to the small intestine and uid accumulation in an infant suckling mouse model (Baumler et al., 1996). It is intriguing that the PhoP regulon is expressed almost immediately in vivo (Fig. 1G), whereas SPI-2 and the virulence plasmid encoded genes are expressed later and concomitant with the induction of abf-2 and spp-1, the worm AMP genes (Fig. 3A and 3B). If abf-2 and spp-1 genes are constitutively expressed, why arent SPI-2 and the virulence plasmid encoded genes induced early as well? One explanation for this result might be that the constitutive levels of these AMPs are not sufficient to elicit SPI-2 or spv gene expression. Alternatively, induction of these virulence factors may be triggered by additional cues in the worm intestine. While these are not mutually exclusive scenarios, the signals that may directly activate Salmonella virulence genes expression have yet to be identied. In the future, dening the conditions existing within the worm gut will shed light on the host factors that may contribute to bacterial gene induction. Given the complexity of experiments involving the mammalian gastrointestinal tract, the use of C. elegans may prove to be a useful genetic system for interrogating the extracellular functions of virulence genes. In addition, the similarities in the extracellular roles for SPI-2 in the C. elegans and mammalian infection models, suggest that it would also be informative to assess the involvement of PhoP and pSLT in the bovine or murine colitis models to further substantiate our conclusions. It also will be interesting to determine if other Salmonella genes, such as sptP, that are important for intracellular survival and C. elegans pathogenesis might also have a role during the extracellular phase of infection of other hosts (Tenor et al., 2004). Resistance to AMPs is a persistence mechanism in the C. elegans digestive tract PhoP, SPI-2 and pSLT play critical roles in protecting Salmonella from C. elegans AMPs, ABF-2 and SPP-1 in the intestine (Fig. 5). These observations are supported by an earlier nding that a key part of PhoPQ-mediated virulence involves resistance to cathelicidin-related AMP (Rosenberger et al., 2004). Interestingly, the interactions between Salmonella genes and individual worm AMPs in vivo appear to be distinct. Loss of spp-1 gene function alone is sufficient to restore the ability of phoP, SPI-2 and DpSLT mutants to persist in the worm intestine, indicating that the ability to resist this host AMP is an important mechanism for persistence. Persistence defects due to the loss of PhoP and pSLT were also ameliorated by knock-down of abf-2, a member of a distinct class of AMPs with homology to insect defensins. In contrast, ssaV (SPI-2) was rescued specically by knock-down of spp-1, but not abf-2, suggesting that SPI-2 may be involved in resistance to a subclass of AMPs or may play a minor, yet detectable, role in AMP resistance. Based on the importance of the worm AMPs ABF-2 and SPP-1 in limiting S. typhimurium infection, we also probed the interaction between antimicrobials and virulence mutants using sensitivity to PB. We found that in addition to phoP, ssaV and DpSLT mutants are sensitive to PB. Sensitivity of the ssaV mutant to PB was not wholly unexpected, as other mutations in the type III secretion apparatus of SPI-2 have increased sensitivity to AMPs (Deiwick et al., 1998). PB sensitivity of a pSLT-cured strain, however, has not been reported. S. typhimurium genes upregulated during growth in PB include the PhoP and RpoS regulon, and the spv locus from pSLT (Bader et al., 2003). Additionally, the rck gene on the virulence plasmid can rescue PB sensitivity of a mig-14 mutant (Brodsky et al., 2002). Thus, pSLT may facilitate general survival against host AMPs during infection. It is unclear how SPI-2 and pSLT promote resistance to PB. In the future, it will be of interest to demonstrate the protective roles of the virulence factors against vertebrate AMPs. As host AMPs are a critical element in innate defences, our system may be useful for identication of new genes involved in resistance to AMPs. Use of the C. elegans model to understand extracellular interactions Previous research in C. elegans has focused primarily on cumulative effect of infection: death (Aballay et al., 2000; 2003; Labrousse et al., 2000; Aballay and Ausubel, 2001; 2002; Tenor et al., 2004). By examining early events during infection, such as persistence in the worm gut rather than worm mortality, the contribution of individual host and bacterial effectors can be more clearly revealed. Using well-characterized bacterial mutants, we found that induction of SPI-1, SPI-2 and PhoP is similar to that of enteric models of disease lending validation to use of our model for the study of Salmonella pathogenesis. By analysing an early event in infection, we determined that resistance to host AMPs is an important mechanism for bacterial persistence. Moreover, we were able to reveal the role for individual AMPs in immunity that was not detected using a mortalitybased assay (data not shown).

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

Persistence of Salmonella in the C. elegans intestine 1269 In summary, as seen in other Salmonella pathogenesis models, the succession of events leading to persistent infection in the nematode intestine is intricate and requires the function of multiple loci. The worm intestinal tract presents a complex environment of signals to which S. typhimurium must perceive and adapt to in order to survive. The identication of bacterial genes that interact with the worm innate immune system that are also shared with many mammalian models presents the opportunity to use the C. elegans model to further dissect the host signalling response during infection.
lumen are scored full; and any animal harbouring bacteria between these extremes was scored as partial (Fig. 2A). Viable cell counts. To determine the number of live bacteria in the worm intestine, three sets of 10 infected worms were surface sterilized by washes with 100 mM levamisole and incubation in M9 containing 100 mM levamisole and 100 mg ml-1 gentamicin. Levamisole treatment inhibits pharyngeal pumping and defecation, and was used both to prevent entry of gentamicin into the intestinal lumen, and the release of luminal bacteria. After incubation, animals were washed with levamisole solution alone to remove gentamicin and homogenized with M9 containing 1% Triton X-100 to recover bacteria within the worm intestine. Appropriate dilutions of whole worm lysates were plated onto selective media. Statistical signicance was determined by non-parametric MannWhitney test. Bacterial persistence. For this assay, we use tnt-3(aj3) animals that are not able to mechanically disrupt bacteria as they pass through the pharynx, but otherwise wild type for immune function (Kim et al., 2002). We observed heterogeneous colonization in the population of wild-type (N2) worms in early stages of Salmonella infection (Fig. 1B), which is ameliorated in tnt-3(aj3) worms (Fig. 4A). L4 stage tnt-3(aj3) worms were exposed for 20 h to S. typhimurium strains expressing gfp. Infected worms were transferred to E. coli OP50-rif lawns grown on NGM containing rifampicin to select against external S. typhimurium that were transferred along with the worms. In the visual persistence assay, worms were given a positive score if gfp was detectable using a Leica MZFLIII stereomicroscope equipped for epiuorescence (GFP2 lter) at 80 magnication.

Experimental procedures C. elegans strains

Caenorhabditis elegans were maintained at 15C on NG agar medium (NGM) and were handled using standard techniques (Brenner, 1974). Bristol strain N2 worms were used as a standard wild-type strain. WE5006 tnt-3(aj3) has a defective grinder owing to a recessive mutation in troponin T (Kim et al., 2002).

Bacterial strains and plasmids

All bacterial strains and plasmids used in this study are listed in Table 1. The S. typhimurium strains SL1344, orgA, ssaV, phoP and SM022, and the E. coli strains DH5a and OP50 have been described previously (Brenner, 1974; Hoiseth and Stocker, 1981; Jones and Falkow, 1994; Rathman et al., 1996; Vazquez-Torres et al., 1999; Guy et al., 2000). Marked mutations were transduced into the SL1344 background with P22HT (Maloy et al., 1996). A rifampicin-resistant mutant of OP50 (OP50-rif) was isolated by plating 1012 cells on L-agar containing 100 mg ml-1 rifampicin. Bacterial strains were grown and maintained at 37C in LuriaBertani (LB) media or on L-agar plates with the appropriate antibiotics at the following concentrations unless otherwise specied: 100 mg ml-1 streptomycin, 50 mg ml-1 kanamycin, 100 mg ml-1 ampicillin, 12 mg ml-1 chloramphenicol, 100 mg ml-1 rifampicin and 15 mg ml-1 tetracycline.

qRT-PCR analysis
Thousands of synchronized worms were grown to the L4 stage, washed off of E. coli OP50 bacterial lawns, and dropped onto SM022 grown on L-agar. Total RNA including worm and bacterial RNA was extracted from worms after exposure to S. typhimurium, as detailed (Reinke et al., 2000) and from bacterial lawns at matched time points. qRT-PCR was performed according to manufacturers recommendations with one-step RT-PCR Kit with SYBR Green (Bio-Rad) using 100 ng RNA samples. Table 1 lists the real-time primers used in this study. Bacterial gene transcripts from infected worms as well as from bacterial lawns were initially normalized to rpoD. The levels of the C. elegans genes abf-2 and spp-1 were normalized to ama-1, which encodes the core subunit of RNA polymerase II.

Infection assays
Salmonella typhimurium lawns were grown from standing overnight cultures in modied LB broth (Lee and Falkow, 1990) and spread on L-agar and grown for 4 h at 37C. Infections of fourth larval stage (L4) or 1-day-old adult hermaphrodites by Salmonella were carried out at 25C. Worms were collected at different time points for quantitative real-time PCR analysis and bacterial cell counts. Bacterial colonization under constant exposure. Age-matched 1-day-old animals exposed to gfp-expressing bacteria were observed by uorescence microscopy at 200 magnication. At each time point, four sets of 10 worms were scored for severity of colonization. Animals bearing no discernable uorescent bacteria were scored as undetectable; animals with distended lumens and extensive bacterial packing along the entire length of the

Transcriptional fusions
Salmonella typhimurium strains utilized in this study harbour a gfp reporter construct, detailed in Table 1. The plasmids were transformed into SL1344. S. typhimurium within infected N2 animals were monitored every 12 h for gfp induction relative to in vitro growth. Infected worms were paralysed with 100 mM levamisole and viewed under Nomarski optics and epiuorescent illumination (Excitation 420 nm, Emission 525 nm, 30 nm band pass) with a Leica DMRXA2 microscope. Images were recorded with a Hamamatsu ORCA-ER charge-coupled device using OpenLab software (Improvision).

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

1270 R. A. Alegado and M.-W. Tan

Table 1. Bacterial strains, plasmids and primers used in this study. Strain or plasmid Bacteria S. typhimurium SL1344 SM022/wtgfp orgAgfp ssaVgfp DpSLTgfp phoPgfp E. coli OP50 OP50-rif HT115(DE3) Plasmid pL4440/pPD129.36 pL4440-DEST-C50F10.2 pL4440-DEST-T07C4.4 pFPV-25 PprgH::gfp PssaG::gfp Pmig-14::gfp Primers gyrB_left gyrB_right rpoD_left rpoD_right GFP_left GFP_right prgH_left prgH_right ssaG_left ssaG_right spvR_left spvR_right pmrA_left pmrA_right pagC_left pagC_right pagD_left pagD_right mig-14_left mig-14_right slyA_left slyA_right abf-2 forward abf-2 reverse abf-2 3UTR forward abf-2 3UTR reverse spp-1 forward spp-1 reverse spp-1 3UTR forward spp-1 3UTR reverse ama-1 forward ama-1 reverse pan-actin forward pan-actin reverse Relevant characteristics Reference or source

Wild-type; hisG rpsL xyl SL1344 PrpsM:gfp-aph SL1344 orgA::Tn5-lacZY PrpsM::gfp-KmR SL1344 DssaV PrpsM::gfp-KmR SL1344 pSLT- PrpsM::gfp-KmR SL1344 phoP::Tn10TcR PrpsM::gfp-KmR Uracil auxotroph OP50 RifR rnc14::DTn10l(DE3) Cloning vector for generating dsRNA, ApR, TcR Construct for knock-down of abf-2, ApR Construct of knock-down of spp-1, ApR ColE1 origin, promoterless gfp ApR pFPV25, PprgH::GFP pFPV25, PssaG::GFP pFPV25, Pmig-14::GFP CACCGTCAGATCTACGAGCA GACGTTGGTGAAGGTTTCGT GGTCTGACCATCGAACAGGT ACCAGGTTGCATAGGTGGAG AGTGGAGAGGGTGAAGG TCTCGCAAAGCATTGAACAC GAGATACGTTGTGGGCTCGT TTCTTGCTCATCGTGTTTCG CCAGCGCTAACGGTTATTGT TTTTCAAACCCCTCATTTGG ATGCACTGGAGCAGGAAATC GCGATTCCCGATGAAAATAA GAGGGATGGACAGGAACTGA AACCAGCATGTAGCCAAACC TGTTGCACAGGCCGATACTA CTGGCCCAACCATTAAAGAA GTTCAGGCCATTGTTCTGGT TAATCTGCCTGGCTTGCTTT CCCTATACCGGGAGGTGTTT GGCAAGAAGCAGCGTAAATC CTCTGGAATTGACGCAGACA GCGCGTTTTATGAATGACCT CCATCGTGGCTGCCGACATCGACTTT GAGCACCAAGTGGAATATCTCCTCCTC AGTATGCAAAACTGTGGAAC TAAATAAATCAAAATTGTGCAC GCATCACGGTGTTTTCTGTG GCAACAGCATAGTCCAGCAA CTAACCCACTCAATCTCAAG TTTTGAAGGAAACATTTATTATTC CCCGGAGGAGATTAAACG CATGTCATGCATCTTCCAC TCGGTATGGGACAGAAGGAC CATCCCAGTTGGTGACGATA

Hoiseth and Stocker (1981) Vazquez-Torres et al. (1999) Jones and Falkow (1994), This work Guy et al. (2000), This work C. Detweiler, This work Miller et al. (1989), This work Brenner (1974) This work Timmons et al. (2001) Timmons et al. (2001) Open Biosystems Open Biosystems Valdivia and Falkow (1997) Hautefort et al. (2003) Hautefort et al. (2003) Valdivia and Falkow (1997)

Feeding-mediated RNAi
Bacterial feeding RNAi experiments were carried out by exposing worms from egg to the L4 larval stage to HT115(DE3) transformed with the appropriate RNAi clone as described previously (Kamath et al., 2001). The identity of each RNAi clone from the Open Biosystems library (Huntsville, AL) was veried by sequence analysis (Sequetech, Palo Alto, CA). Efficacy of

knock-down was measured by semi-quantitative RT-PCR using total RNA harvested from dsRNA-treated animals exposed to pathogen for 48 h 100 ng of RNA from three independent experiments was used as template for cDNA synthesis with the iScript cDNA Synthesis kit (Bio-Rad). Amplication was carried out using the gene-specic primers (abf-2 3UTR forward, abf-2 3UTR reverse, spp-1 3UTR forward, spp-1 3UTR reverse) listed in Table 1.

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

Persistence of Salmonella in the C. elegans intestine 1271 Polymyxin B sensitivity assay

Polymyxin B sensitivity assays were performed in triplicate essentially as described (Groisman et al., 1997). Briey, bacteria were grown in modied N-minimal media, pH 7.4 containing 10 mM MgCl2. Saturated overnight cultures were washed three times with N-minimal media, pH 7.4, diluted 1:100 in N-minimal media, pH 7.4 containing 10 mM MgCl2 for 3 h. Between 5 104 and 1 105 cells were exposed to 2.5 mg ml-1 PB (Sigma) for 1 h at 37C. Per cent survival was calculated as initial input bacterial CFUs relative to bacterial CFUs after challenge.

Acknowledgements
We gratefully acknowledge the suggestions and insightful comments from Denise Monack and Stanley Falkow. We thank Trupti Kawli, Rachel Muir and Jen Berman for critical reading of this manuscript and members of the Tan and Falkow lab for helpful discussion. This work was supported by Stanford Genome Training Grant T32HG00004 from the National Human Genome Research Institute and a Ford Foundation Predoctoral Fellowship (R.A.A.) and R01-GM066269 from the National Institutes of Health (M.W.T.).

References
Aballay, A., and Ausubel, F.M. (2001) Programmed cell death mediated by ced-3 and ced-4 protects Caenorhabditis elegans from Salmonella typhimurium-mediated killing. Proc Natl Acad Sci USA 98: 27352739. Aballay, A., and Ausubel, F.M. (2002) Caenorhabditis elegans as a host for the study of hostpathogen interactions. Curr Opin Microbiol 5: 97101. Aballay, A., Yorgey, P., and Ausubel, F.M. (2000) Salmonella typhimurium proliferates and establishes a persistent infection in the intestine of Caenorhabditis elegans. Curr Biol 10: 15391542. Aballay, A., Drenkard, E., Hilbun, L.R., and Ausubel, F.M. (2003) Caenorhabditis elegans innate immune response triggered by Salmonella enterica requires intact LPS and is mediated by a MAPK signaling pathway. Curr Biol 13: 4752. Alegado, R.A., Campbell, M.C., Chen, W.C., Slutz, S.S., and Tan, M.W. (2003) Characterization of mediators of microbial virulence and innate immunity using the Caenorhabditis elegans host-pathogen model. Cell Microbiol 5: 435444. Alper, S., McBride, S.J., Lackford, B., Freedman, J.H., and Schwartz, D.A. (2007) Specicity and complexity of the Caenorhabditis elegans innate immune response. Mol Cell Biol 27: 55445553. Avery, L., and Shtonda, B.B. (2003) Food transport in the C. elegans pharynx. J Exp Biol 206: 24412457. Ayabe, T., Wulff, H., Darmoul, D., Cahalan, M.D., Chandy, K.G., and Ouellette, A.J. (2002a) Modulation of mouse Paneth cell alpha-defensin secretion by mIKCa1, a Ca2+activated, intermediate conductance potassium channel. J Biol Chem 277: 37933800. Ayabe, T., Satchell, D.P., Pesendorfer, P., Tanabe, H., Wilson, C.L., Hagen, S.J., and Ouellette, A.J. (2002b)

Activation of Paneth cell alpha-defensins in mouse small intestine. J Biol Chem 277: 52195228. Ayabe, T., Ashida, T., Kohgo, Y., and Kono, T. (2004) The role of Paneth cells and their antimicrobial peptides in innate host defense. Trends Microbiol 12: 394398. Bader, M.W., Navarre, W.W., Shiau, W., Nikaido, H., Frye, J.G., McClelland, M., et al. (2003) Regulation of Salmonella typhimurium virulence gene expression by cationic antimicrobial peptides. Mol Microbiol 50: 219230. Bader, M.W., Sanowar, S., Daley, M.E., Schneider, A.R., Cho, U., Xu, W., et al. (2005) Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell 122: 461472. Banyai, L., and Patthy, L. (1998) Amoebapore homologs of Caenorhabditis elegans. Biochim Biophys Acta 1429: 259 264. Baumler, A.J., Tsolis, R.M., Bowe, F.A., Kusters, J.G., Hoffmann, S., and Heffron, F. (1996) The pef mbrial operon of Salmonella typhimurium mediates adhesion to murine small intestine and is necessary for uid accumulation in the infant mouse. Infect Immun 64: 6168. Baumler, A.J., Tsolis, R.M., Ficht, T.A., and Adams, L.G. (1998) Evolution of host adaptation in Salmonella enterica. Infect Immun 66: 45794587. Bearson, B.L., Wilson, L., and Foster, J.W. (1998) A low pH-inducible, PhoPQ-dependent acid tolerance response protects Salmonella typhimurium against inorganic acid stress. J Bacteriol 180: 24092417. Brenner, S. (1974) The genetics of Caenorhabditis elegans. Genetics 77: 7194. Brodsky, I.E., Ernst, R.K., Miller, S.I., and Falkow, S. (2002) mig-14 is a Salmonella gene that plays a role in bacterial resistance to antimicrobial peptides. J Bacteriol 184: 3203 3213. Brodsky, I.E., Ghori, N., Falkow, S., and Monack, D. (2005) Mig-14 is an inner membrane-associated protein that promotes Salmonella typhimurium resistance to CRAMP, survival within activated macrophages and persistent infection. Mol Microbiol 55: 954972. Brown, N.F., Vallance, B.A., Coombes, B.K., Valdez, Y., Coburn, B.A., and Finlay, B.B. (2005) Salmonella pathogenicity island 2 is expressed prior to penetrating the intestine. PLoS Pathog 1: e32. Coburn, B., Li, Y., Owen, D., Vallance, B.A., and Finlay, B.B. (2005) Salmonella enterica serovar Typhimurium pathogenicity island 2 is necessary for complete virulence in a mouse model of infectious enterocolitis. Infect Immun 73: 32193227. Coombes, B.K., Coburn, B.A., Potter, A.A., Gomis, S., Mirakhur, K., Li, Y., and Finlay, B.B. (2005) Analysis of the contribution of Salmonella pathogenicity islands 1 and 2 to enteric disease progression using a novel bovine ileal loop model and a murine model of infectious enterocolitis. Infect Immun 73: 71617169. Darwin, K.H., and Miller, V.L. (1999) Molecular basis of the interaction of Salmonella with the intestinal mucosa. Clin Microbiol Rev 12: 405428. Deiwick, J., Nikolaus, T., Shea, J.E., Gleeson, C., Holden, D.W., and Hensel, M. (1998) Mutations in Salmonella pathogenicity island 2 (SPI2) genes affecting transcription of SPI1 genes and resistance to antimicrobial agents. J Bacteriol 180: 47754780.

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

1272 R. A. Alegado and M.-W. Tan

Fields, P.I., Groisman, E.A., and Heffron, F. (1989) A Salmonella locus that controls resistance to microbicidal proteins from phagocytic cells. Science 243: 10591062. Finlay, B.B., and Falkow, S. (1997) Common themes in microbial pathogenicity revisited. Microbiol Mol Biol Rev 61: 136169. Finlay, B.B., Heffron, F., and Falkow, S. (1989) Epithelial cell surfaces induce Salmonella proteins required for bacterial adherence and invasion. Science 243: 940943. Foster, J.W., and Spector, M.P. (1995) How Salmonella survive against the odds. Annu Rev Microbiol 49: 145174. Galan, J.E. (2001) Salmonella interactions with host cells: Type III secretion at work. Annu Rev Cell Dev Biology 17: 5386. Gallucci, S., and Matzinger, P. (2001) Danger signals: SOS to the immune system. Curr Opin Immunol 13: 114119. Groisman, E.A., Chiao, E., Lipps, C.J., and Heffron, F. (1989) Salmonella typhimurium phoP virulence gene is a transcriptional regulator. Proc Natl Acad Sci USA 86: 7077 7081. Groisman, E.A., Parra-Lopez, C., Salcedo, M., Lipps, C.J., and Heffron, F. (1992) Resistance to host antimicrobial peptides is necessary for Salmonella virulence. Proc Natl Acad Sci USA 89: 1193911943. Groisman, E.A., Kayser, J., and Soncini, F.C. (1997) Regulation of polymyxin resistance and adaptation to low-Mg2+ environments. J Bacteriol 179: 70407045. Gulig, P.A., Doyle, T.J., Hughes, J.A., and Matsui, H. (1998) Analysis of host cells associated with the Spv-mediated increased intracellular growth rate of Salmonella typhimurium in mice. Infect Immun 66: 24712485. Gunn, J.S., and Miller, S.I. (1996) PhoP-PhoQ activates transcription of pmrAB, encoding a two-component regulatory system involved in Salmonella typhimurium antimicrobial peptide resistance. J Bacteriol 178: 68576864. Gunn, J.S., Ernst, R.K., McCoy, A.J., and Miller, S.I. (2000) Constitutive mutations of the Salmonella enterica serovar Typhimurium transcriptional virulence regulator phoP. Infect Immun 68: 37583762. Guy, R.L., Gonias, L.A., and Stein, M.A. (2000) Aggregation of host endosomes by Salmonella requires SPI2 translocation of SseFG and involves SpvR and the fms-aroE intragenic region. Mol Microbiol 37: 14171435. Hautefort, I., Proenca, M.J., and Hinton, J.C. (2003) Singlecopy green uorescent protein gene fusions allow accurate measurement of Salmonella gene expression in vitro and during infection of mammalian cells. Appl Environ Microbiol 69: 74807491. Hensel, M., Shea, J.E., Waterman, S.R., Mundy, R., Nikolaus, T., and Banks, G. (1998) Genes encoding putative effector proteins of the type III secrtion system of Salmonella pathogenicity island 2 are required for bacterial virulence and proliferation in macrophages. Mol Microbiol 30: 163174. Hoffmann, J.A. (2003) The immune response of Drosophila. Nature 426: 3338. Hoiseth, S.K., and Stocker, B.A. (1981) Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature 291: 238239. Jones, B.D., and Falkow, S. (1994) Identication and characterization of a Salmonella typhimurium oxygen-regulated gene required for bacterial internalization. Infect Immun 62: 37453752. Kamath, R.S., Martinez-Campos, M., Zipperlen, P., Fraser, A.G., and Ahringer, J. (2001) Effectiveness of specic RNA-mediated interference through ingested doublestranded RNA in Caenorhabditis elegans. Genome Biol 2: RESEARCH0002. Kato, Y., Aizawa, T., Hoshino, H., Kawano, K., Nitta, K., and Zhang, H. (2002) abf-1 and abf-2, ASABF-type antimicrobial peptide genes in Caenorhabditis elegans. Biochem J 361: 221230. Kerry, S., TeKippe, M., Gaddis, N.C., and Aballay, A. (2006) GATA transcription factor required for immunity to bacterial and fungal pathogens. PLoS ONE 1: e77. Kim, C.C., and Falkow, S. (2004) Delineation of upstream signaling events in the Salmonella pathogenicity island 2 transcriptional activation pathway. J Bacteriol 186: 4694 4704. Kim, D.H., Feinbaum, R., Alloing, G., Emerson, F.E., Garsin, D.A., Inoue, H., et al. (2002) A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate immunity. Science 297: 623626. Kingsley, R.A., and Baumler, A.J. (2000) Host adaptation and the emergence of infectious disease: the Salmonella paradigm. Mol Microbiol 36: 10061014. Kurz, C.L., and Tan, M.W. (2004) Regulation of aging and innate immunity in C. elegans. Aging Cell 3: 185193. Kurz, C.L., and Ewbank, J.J. (2007) Infection in a dish: highthroughput analyses of bacterial pathogenesis. Curr Opin Microbiol 10: 1016. Labrousse, A., Chauvet, S., Couillault, C., Lopold Kurz, C., and Ewbank, J.J. (2000) Caenorhabditis elegans is a model host for Salmonella typhimurium. Curr Biol 10: 15431545. Lee, C.A., and Falkow, S. (1990) The ability of Salmonella to enter mammalian cells is affected by bacterial growth state. Proc Natl Acad Sci USA 87: 43044308. Libby, S.J., Adams, L.G., Ficht, T.A., Allen, C., Whitford, H.A., Buchmeier, N.A., et al. (1997) The spv genes on the Salmonella dublin virulence plasmid are required for severe enteritis and systemic infection in the natural host. Infect Immun 65: 17861792. McClelland, M., Sanderson, K.E., Spieth, J., Clifton, S.W., Latreille, P., Courtney, L., et al. (2001) Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413: 852856. Maloy, S.R., Stewart, V.J., and Taylor, R.K. (1996) Genetic Analysis of Pathogenic Bacteria. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press Plainview. Merighi, M., Ellermeier, C.D., Slauch, J.M., and Gunn, J.S. (2005) Resolvase-in vivo expression technology analysis of the Salmonella enterica serovar Typhimurium PhoP and PmrA regulons in BALB/c mice. J Bacteriol 187: 74077416. Methner, U., Barrow, P.A., Gregorova, D., and Rychlik, I. (2004) Intestinal colonisation-inhibition and virulence of Salmonella phoP, rpoS and ompC deletion mutants in chickens. Vet Microbiol 98: 3743. Miller, S.I., Kukral, A.M., and Mekalanos, J.J. (1989) A twocomponent regulatory system (phoP phoQ) controls Salmonella typhimurium virulence. Proc Natl Acad Sci USA 86: 50545058.

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273

Persistence of Salmonella in the C. elegans intestine 1273

Morgan, E., Campbell, J.D., Rowe, S.C., Bispham, J., Stevens, M.P., Bowen, A.J., et al. (2004) Identication of host-specic colonization factors of Salmonella enterica serovar Typhimurium. Mol Microbiol 54: 9941010. Navarre, W.W., Halsey, T.A., Walthers, D., Frye, J., McClelland, M., Potter, J.L., et al. (2005) Co-regulation of Salmonella enterica genes required for virulence and resistance to antimicrobial peptides by SlyA and PhoP/PhoQ. Mol Microbiol 56: 492508. Norte, V.A., Stapleton, M.R., and Green, J. (2003) PhoPresponsive expression of the Salmonella enterica serovar Typhimurium slyA gene. J Bacteriology 185: 35083514. ORourke, D., Baban, D., Demidova, M., Mott, R., and Hodgkin, J. (2006) Genomic clusters, putative pathogen recognition molecules, and antimicrobial genes are induced by infection of C. elegans with M. nematophilum. Genome Res 16: 10051016. Pujol, N., Link, E.M., Liu, L.X., Kurz, C.L., Alloing, G., Tan, M.W., et al. (2001) A reverse genetic analysis of components of the Toll signaling pathway in Caenorhabditis elegans. Curr Biol 11: 809821. Rathman, M., Sjaastad, M.D., and Falkow, S. (1996) Acidication of phagosomes containing Salmonella typhimurium in murine macrophages. Infect Immun 64: 27652773. Reinke, V., Smith, H.E., Nance, J., Wang, J., Van Doren, C., Begley, R., et al. (2000) A global prole of germline gene expression in C. elegans. Mol Cell 6: 605616. Rosenberger, C.M., Gallo, R.L., and Finlay, B.B. (2004) Interplay between antibacterial effectors: a macrophage antimicrobial peptide impairs intracellular Salmonella replication. Proc Natl Acad Sci USA 101: 24222427. Rychlik, I., and Barrow, P.A. (2005) Salmonella stress management and its relevance to behaviour during intestinal colonisation and infection. FEMS Microbiol Rev 29: 1021. Salzman, N.H., Ghosh, D., Huttner, K.M., Paterson, Y., and Bevins, C.L. (2003) Protection against enteric salmonellosis in transgenic mice expressing a human intestinal defensin. Nature 422: 522526. Shapira, M., Hamlin, B.J., Rong, J., Chen, K., Ronen, M., and Tan, M.W. (2006) A conserved role for a GATA transcription factor in regulating epithelial innate immune responses. Proc Natl Acad Sci USA 103: 1408614091. Shea, J.E., Hensel, M., Gleeson, C., and Holden, D.W. (1996) Identication of a virulence locus encoding a second type III secretion system in Salmonella typhimurium. Proc Natl Acad Sci USA 93: 25932597. Shea, J.E., Beuzon, C.R., Gleeson, C., Mundy, R., and Holden, D.W. (1999) Inuence of the Salmonella typhimurium pathogenicity island 2 type III secretion system on bacterial growth in the mouse. Infect Immun 67: 213 219. Tenor, J.L., McCormick, B.A., Ausubel, F.M., and Aballay, A. (2004) Caenorhabditis elegans-based screen identies Salmonella virulence factors required for conserved host pathogen interactions. Curr Biol 14: 10181024. Timmons, L., Court, D.L., and Fire, A. (2001) Ingestion of bacterially expressed dsRNAs can produce specic and potent genetic interference in Caenorhabditis elegans. Gene 263: 103112. Trent, M.S., Ribeiro, A.A., Lin, S., Cotter, R.J., and Raetz, C.R. (2001) An inner membrane enzyme in Salmonella and Escherichia coli that transfers 4-amino-4-deoxy-Larabinose to lipid A: induction on polymyxin-resistant mutants and role of a novel lipid-linked donor. J Biol Chem 276: 4312243131. Tsolis, R.M., Adams, L.G., Ficht, T.A., and Baumler, A.J. (1999a) Contribution of Salmonella typhimurium virulence factors to diarrheal disease in calves. Infect Immun 67: 48794885. Tsolis, R.M., Townsend, S.M., Miao, E.A., Miller, S.I., Ficht, T.A., Adams, L.G., and Baumler, A.J. (1999b) Identication of a putative Salmonella enterica serotype Typhimurium host range factor with homology to IpaH and YopM by signature-tagged mutagenesis. Infect Immun 67: 6385 6393. Vaara, M. (1992) The outer membrane as the penetration barrier against mupirocin in Gram-negative enteric bacteria. J Antimicrob Chemother 29: 221222. Valdivia, R.H., and Falkow, S. (1997) Fluorescence-based isolation of bacterial genes expressed within host cells. Science 277: 20072011. Valdivia, R.H., Cirillo, D.M., Lee, A.K., Bouley, D.M., and Falkow, S. (2000) mig-14 is a horizontally acquired, hostinduced gene required for Salmonella enterica lethal infection in the murine model of typhoid fever. Infect Immun 68: 71267131. Vazquez-Torres, A., Jones-Carson, J., Baumler, A.J., Falkow, S., Valdivia, R., Brown, W., et al. (1999) Extraintestinal dissemination of Salmonella by CD18-expressing phagocytes. Nature 401: 804808. van Velkinburgh, J.C., and Gunn, J.S. (1999) PhoP-PhoQregulated loci are required for enhanced bile resistance in Salmonella spp. Infect Immun 67: 16141622. Wallis, T.S., and Galyov, E.E. (2000) Molecular basis of Salmonella-induced enteritis. Mol Microbiol 36: 9971005. Wallis, T.S., Paulin, S.M., Plested, J.S., Watson, P.R., and Jones, P.W. (1995) The Salmonella dublin virulence plasmid mediates systemic but not enteric phases of salmonellosis in cattle. Infect Immun 63: 27552761. Wilson, C.L., Ouellette, A.J., Satchell, D.P., Ayabe, T., LopezBoado, Y.S., Stratman, J.L., et al. (1999) Regulation of intestinal alpha-defensin activation by the metalloproteinase matrilysin in innate host defense. Science 286: 113 117.

2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd, Cellular Microbiology, 10, 12591273