Characterization of 26 New miniSTR Loci

Email: becky.hill@nist.gov Phone: 301-975-4275 Carolyn R. Hill, Michael D. Coble,* and John M. Butler
National Institute of Standards and Technology, Biochemical Science Division, Gaithersburg, MD 20899-8311 *Current address: Armed Forces DNA Identification Laboratory, Research Section, Rockville, MD 20850 Copy of poster available: A total of 26 novel mini-short tandem repeat (miniSTR) loci have been developed and characterized to aid in the analysis of degraded DNA samples. These new markers produce short PCR products in the target range of 50 150 base pairs (bp) by moving the primer sequences as close as possible, if not directly next to the identified repeat region [1]. More than 900 candidate loci were initially screened to determine optimal miniSTR markers based on the following criteria: small amplicon sizes (<125 bp), narrow allele spreads (<24bp), observed heterozygosities (>0.70), and locations on chromosomes unoccupied by the 13 CODIS STR loci, or at least 50 Mb away from them on the same chromosome [2]. The miniSTR loci selected included D1GATA113E02, D1S1627, D1S1677, D2S441, D2S1776, D3S3053, D3S4529, D4S2364, D4S2408, D5S2500, D6S474, D6S1017, D8S1115, D9S1122, D9S2157, D10S1248, D10S1435, D11S4463, D12ATA63A05, D14S1434, D17S974, D17S1301, D18S853, D20S482, D20S1082, and D22S1045. All of these markers were sequenced and evaluated across more than 600 samples, and their population statistics were determined [3]. The heterozygosities of the new loci were compared to those of the 13 CODIS loci and all were found to be comparable. Only seven of the new loci had lower heterozygosity values than the CODIS loci; however, all of these were much smaller in size [3]. This data suggests that these additional 26 miniSTR loci will serve as useful complements to the CODIS loci to aid in the forensic analysis of degraded DNA. In addition, these new loci will be valuable in a variety of scenarios, particularly for paternity cases, missing persons work, or mass fatality DNA identification testing involving kinship samples [2]. In fact, three of these new markers (D10S1248, D2S441, and D22S1045) from the initial six miniSTR loci previously described [2] have recently been recommended for adoption by the European DNA community as new core loci for forensic testing [4,5].
[1] Butler, J.M., Shen, Y., McCord, B.R. (2003) The development of reduced size STR amplicons as tools for analysis of degraded DNA. J. Forensic Sci. 48(5): 1054-1064. [2] Coble, M.D., Butler, J.M. (2005) Characterization of new miniSTR loci to aid analysis of degraded DNA. J. Forensic Sci. 50(1): 43-53. [3] Hill, C.R., Coble, M.D., Butler, J.M. (2006) Development of additional new miniSTR loci for improved analysis of degraded DNA samples. submitted. [4] Gill, P., Fereday, L., Morling, N., Schneider, P.M. (2006) The evolution of DNA databases--recommendations for new European loci. Forensic Sci. Int. 156:242-244. [5] Gill, P., Fereday, L., Morling, N., Schneider, P.M. (2006) Letter to the Editor: New multiplexes for Europe Amendments and clarification of strategic development. Forensic Sci. Int .in press.

Poster #44 at Promega Meeting, Nashville, TN, October 10-12, 2006

REVISED 10/26/06 with final nomenclature changes

http://www.cstl.nist.gov/biotech/strbase/pub_pres/Promega2006_Hill.pdf

Issue of Potential Disease Linkage with New and Currently Used STR Loci The repeat unit nomenclature for these STR loci is defined by using the top strand in the GenBank accession reference sequence, selecting the first 5 full tandem repeat, and allowing a single nucleotide change in the repeat structure for a compound repeat (e.g., D22S1045 ATT and ACT). We have altered the nomenclature for D10S1248 and D22S1045 from that previously published in Coble and Butler (2005).
PubMed searches have noted potential disease linkages with the following STR loci: TH01 nicotine dependence, schizophrenic and bipolar disorders, hypertension, malaria predisposition D5S818 malaria predisposition D8S1179 neural tube defects (Meckel-Gruber syndrome), urinary microalbuminuria, type-2 diabetes D21S11 trisomy-21 (Downs syndrome) D18S51 trisomy-18 (Edwards syndrome) D10S1248 variation in sleep respiration rate, urogenital development D2S441 (also known as D2S1778) hereditary gingival fibromatosis, congenital glaucoma D22S1045 May-Hegglin anomaly D12ATA63 none known D9S2157 none known Please keep in mind though as noted by Butler [JFS 2006;51(2):253-265] that many of the core STR loci in current use have a common origin to loci widely used for human disease gene linkage analysis studies and it is important to keep in mind that even though medical genetic researchers claim to have shown linkage between a particular disease gene and a core STR marker, these types of findings are often tentative and should not prevent the continued use of the STR locus in question. In fact, Colin Kimpton and coworkers from the European DNA Profiling Group recognized early on in the application of STRs for human identity testing that it is likely that many or possibly most STRs will eventually be shown to be useful in following a genetic disease or other genetic trait within a family and therefore this possibility must be recognized at the outset of the use of such systems [FSI 1995;71:137-152]. The Marshfield genome-scan ~400 STR marker set used in searches for disease-causing gene includes TPOX, D7S820, D8S1179, D13S317, D16S539, and D19S433. The majority of the 26 new miniSTR loci characterized here are part of the same Marshfield genome-scan STR marker set.

D10S1248
GenBank accession AL391869; positions 136,773..136,874

Allele Frequencies from 1,613 Population Samples

Population U.S. Caucasian African American U.S. Hispanic Japanese Spanish Singapore/Chinese Singapore/Malay Singapore/Indian
# Tested

8
-0.004 -------

9
-0.004 -0.004 0.002 0.003 ---

10
-0.004 -0.004 0.002 0.003 ---

11
-0.037 --0.002 --0.008

12
0.036 0.121 0.061 0.123 0.061 0.078 0.052 0.020

13
0.330 0.241 0.264 0.296 0.265 0.360 0.310 0.191

14
0.289 0.278 0.318 0.243 0.318 0.224 0.236 0.253

15
0.192 0.204 0.236 0.218 0.201 0.232 0.247 0.272

16
0.125 0.080 0.104 0.092 0.123 0.084 0.110 0.197

17
0.025 0.025 0.014 0.018 0.023 0.016 0.041 0.056

18
0.002 0.002 -0.004 0.004 -0.003 0.003

19
0.002 -0.004 ------

265 257 140 142 264 185 182 178

D2S441
GenBank accession AC079112; positions 85,324..85,415

Population U.S. Caucasian African American U.S. Hispanic Japanese Spanish Singapore/Chinese Singapore/Malay Singapore/Indian

# Tested

8
----0.002 --0.003

9
0.002 --------

10
0.202 0.084 0.332 0.229 0.191 0.227 0.231 0.343

11
0.350 0.370 0.318 0.363 0.301 0.376 0.272 0.382

11.3
0.061 0.053 0.036 0.018 0.102 0.062 0.190 0.062

12
0.053 0.171 0.025 0.222 0.032 0.203 0.110 0.065

12.3
0.002 0.006 0.004 -0.002 -0.006 --

13
0.029 0.041 0.014 0.032 0.019 0.014 0.011 0.017

13.3
-0.002 -------

14
0.245 0.253 0.214 0.127 0.305 0.114 0.168 0.110

14.3
-0.002 -------

15
0.057 0.019 0.050 0.011 0.046 0.005 0.014 0.014

16
--0.004 ----0.006

17
--0.004 ------

265 257 140 142 264 185 182 178

Possibility of Increased Stutter Percentages with Trinucleotide Repeats

Average stutter with these trinucleotide repeats is only slightly higher than with tetranucleotide repeats.

D22S1045
GenBank accession AL022314; positions 92,943..93,047 Population U.S. Caucasian African American U.S. Hispanic Japanese Spanish Singapore/Chinese Singapore/Malay Singapore/Indian
# Tested

8
-0.010 -------

9
---------

10
-0.043 0.018 ----0.006

11
0.140 0.130 0.061 0.190 0.117 0.178 0.170 0.264

12
0.015 0.056 0.018 -0.004 --0.003

13
0.009 0.004 0.011 -0.008 -0.006 0.003

14
0.058 0.080 0.025 0.021 0.036 0.032 0.052 0.093

15
0.332 0.259 0.454 0.327 0.352 0.305 0.382 0.396

16
0.362 0.187 0.311 0.218 0.362 0.230 0.162 0.160

17
0.079 0.210 0.096 0.201 0.116 0.233 0.209 0.070

18
0.004 0.016 0.007 0.035 0.006 0.019 0.014 0.003

19
-0.006 -0.007 -0.003 0.006 0.003 Stutter % -4 = 6.3% Stutter % -4 = 11.5% Stutter % -4 = 5.5%
*<50 RFUs

265 257 140 142 264 185 182 178

Stutter % -4 = 8.8%

Stutter % -4 = 10.2%

Stutter % -4 =4.0%
*<50 RFUs

Stutter % -4 = 4.3%
*<50 RFUs

Stutter % -3 = 2.9%

Stutter % -3 = 11.7% +3 = 3.0%

Stutter % -3 = 4.4%

Stutter % -3 = 7.5%

Stutter % -3 = 6.9%

Stutter % -3 = 12.7% +3 = *4.3%

*<50 RFUs

Selection and Characterization of New miniSTR Loci

The 26 new miniSTR loci were chosen based on their size and location on certain chromosomes. The candidate loci are all either located on chromosomes that differ from the 13 CODIS core loci or are at least ~ 50 Mb apart from an existing CODIS locus on the same chromosome, and therefore unlinked from that particular marker. The 26 new loci are separated into 9 groups of 3 loci, and are named NC01 NC09, for Non CODIS loci. Coble and Butler (2005) J. Forensic Sci. 50(1): 43-53
> 900 characterized STR markers for screening

Stutter % -4 = 5.8%

Stutter % -3 = 5.0%

Stutter % -3 = 11.1% +3 = 3.2%

Stutter % -3 = 6.2%

Stutter % -3 = 11.5%

Stutter % -3 = 11.3% +3 = 5.5%

Stutter % -3 = 16.4% +3 = 6.5%

The D22S1045 nomenclature has changed by +3 repeats from Coble and Butler (2005) where only the 14 ATT repeats were considered without the

Nomenclature adjustments of +3 for D22S1045 and -1 for D10S1248 were made for the following: Japanese data from Asamura et al. (2006) Int J Legal Med 120:182-184 Spanish data from Martn et al. (2006) Forensic Sci Int, in press additional 1 ACT and 2 ATT repeats (originally called a 13 TAA repeat due to using Singapore data from Yong et al. (2006) Forensic Sci Int, in press

D10S1248 [GGAA]

D2S441 [TCTA]

D22S1045 [ATT]
D9S2157 Stutter N = 156 alleles/93 samples Min: 3.5% Max: 20.6% Average: 11.32%

D12ATA63 [YAA]

D9S2157 [ATA]

>900 STRs screened

Computer Work
107 potential loci Candidate STR marker selection Pull down sequence data from the web Identify Chromosome Location (e.g. Human BLAT Search ) Screen for PCR Primers (e.g. Primer3) Test primers for Multiplex-ability (e.g. AutoDimer - NIST )

a different GenBank reference). Some confusion in nomenclature has arisen due to the GenBank accession numbers in Table 1 of Coble and Butler (2005) being different from those used in primer design and allele designation.

Characteristics of the new 26 non-CODIS (NC) miniSTR loci are listed below along with the 13 CODIS and 4 additional kit STR loci (D2S1338, D19S433, Penta D, and Penta E).
Heterozygosity
Locus Name GenBank (repeat #) Z97987 (11) AC093119 (13) AL513307 (15) AC079112 (12) AC009475 (11) AC069259 (9) AC117452 (13) AC022317 (9) AC110763 (9) AC008791 (17) AL357514 (17) AL035588 (10) AC090739 (9) AL161789 (12) AL162417 (10) AL391869 (13) AL354747 (11) AP002806 (14) AC009771 (13) AL121612 (13) AC034303 (10) AC016888 (12) AP005130 (11) AL121781 (14) AL158015 (14) AL022314 (17) Chromosomal Position Chr 1 7.377 Mb Chr 1 106.676 Mb Chr 1 160.747 Mb Chr 2 68.214 Mb Chr 2 169.471 Mb Chr 3 173.234 Mb Chr 3 85.935 Mb Chr 4 93.976 Mb Chr 4 30.981 Mb Chr 5 58.735 Mb Chr 6 112.986 Mb Chr 6 41.785 Mb Chr 8 42.656 Mb Chr 9 76.918 Mb Chr 9 133.065 Mb Chr 10 130.567 Mb Chr 10 2.233 Mb Chr 11 130.338 Mb Chr 12 106.825 Mb Chr 14 93.298 Mb Chr 17 10.459 Mb Chr 17 70.193 Mb Chr 18 3.981 Mb Chr 20 4.454 Mb Chr 20 53.299 Mb Chr 22 35.779 Mb Location 1p36.23 1p21.1 1q23.3 2p14 2q24.3 3q26.31 3p12.1 4q22.3 4p15.1 5q11.2 6q21 6p21.1 8p11.21 9q21.2 9q34.2 10q26.3 10p15.3 11q25 12q23.3 14q32.13 17p13.1 17q25.1 18p11.31 20p13 20q13.2 22q12.3 Observed Size (bp) 81 - 105 81 - 100 81 - 117 78 - 110 127 - 161 84 - 108 111 - 139 67 - 83 85 - 109 85 - 126 107 - 136 81 - 110 63 - 96 93 - 125 71 - 107 79 - 123 82 - 139 88 - 116 76 - 106 70 - 98 95 - 124 114 - 139 82 - 104 85 - 126 73 - 101 82 - 115 Allele Range 7 - 13 10 - 16 9 - 18 9 - 17 7 - 15 7 - 13 13 - 20 8 - 12 7 - 13 14 - 24 10 - 17 6 - 13 9 - 20 9 - 17 7 - 19 8 - 19 5 - 19 10 - 17 9 - 19 13 - 20 5 - 12 9 - 15 9 - 16 9 - 19 8 - 17 8 - 19 Repeat Motif GATA ATT TTCC TCTA AGAT TATC ATYT GRAT ATCT GRYW [AGAT][GATA] ATCC ATT TAGA ATA GGAA TATC TATC YAA CTRT CTAT AGAT ATA AGAT ATA ATT Overall 0.668 0.746 0.746 0.774 0.763 0.739 0.761 0.511 0.722 0.747 0.761 0.740 0.663 0.734 0.844 0.792 0.766 0.730 0.829 0.696 0.732 0.649 0.711 0.691 0.696 0.784 Af. Am. 0.673 0.783 0.743 0.798 0.740 0.713 0.752 0.385 0.752 0.757 0.765 0.807 0.629 0.753 0.884 0.825 0.798 0.780 0.788 0.685 0.757 0.626 0.772 0.673 0.792 0.817 Cau. 0.632 0.737 0.749 0.780 0.801 0.724 0.723 0.551 0.709 0.747 0.802 0.698 0.660 0.742 0.840 0.785 0.770 0.676 0.842 0.721 0.702 0.717 0.645 0.689 0.653 0.785 Hisp. 0.727 0.693 0.743 0.721 0.734 0.814 0.829 0.664 0.691 0.729 0.679 0.693 0.729 0.686 0.779 0.743 0.700 0.743 0.879 0.650 0.743 0.564 0.721 0.729 0.600 0.721 N 654 660 660 660 654 648 660 660 654 664 648 664 664 659 661 663 663 664 659 663 664 664 664 648 664 663 Forward Primer (5'dye labels shown) [VIC] - TCTTAGCCTAGATAGATACTTGCTTCC [VIC] - CATGAGGTTTGCAAATACTATCTTAAC [NED] - TTCTGTTGGTATAGAGCAGTGTTT [VIC] - CTGTGGCTCATCTATGAAAACTT [FAM] - TGAACACAGATGTTAAGTGTGTATATG [VIC] - TCTTTGCTCTCATGAATAGATCAGT [VIC] - CCCAAAATTACTTGAGCCAAT [FAM] - CTAGGAGATCATGTGGGTATGATT [NED] - AAGGTACATAACAGTTCAATAGAAAGC [NED] - CTGTTGGTACATAATAGGTAGGTAGGT [NED] - GGTTTTCCAAGAGATAGACCAATTA [VIC] - CCACCCGTCCATTTAGGC [FAM] - TCCACATCCTCACCAACAC [VIC] - GGGTATTTCAAGATAACTGTAGATAGG [FAM] - CAAAGCGAGACTCTGTCTCAA [FAM] - TTAATGAATTGAACAAATGAGTGAG [FAM] - TGTTATAATGCATTGAGTTTTATTCTG [FAM] - TCTGGATTGATCTGTCTGTCC [FAM] - GAGCGAGACCCTGTCTCAAG [VIC] - TGTAATAACTCTACGACTGTCTGTCTG [VIC] - GCACCCAAAACTGAATGTCATA [FAM] - AAGATGAAATTGCCATGTAAAAATA [NED] - GCACATGTACCCTAAAACTTAAAAT [FAM] - CAGAGACACCGAACCAATAAGA [VIC] - ACATGTATCCCAGAACTTAAAGTAAAC [NED] - ATTTTCCCCGATGATAGTAGTCT Reverse Primer (extra G on 5'end --> +A) GTCAACCTTTGAGGCTATAGGAA GTTTTAATTTTCTCCAAATCTCCA GTGACAGGAAGGACGGAATG GAAGTGGCTGTGGTGTTATGAT GTCTGAGGTGGACAGTTATGAAA GTTTGTGATAATGAACCCACTCAG GAGACAAAATGAAGAAACAGACAG GCAGTGAATAAATGAACGAATGGA GTGAAATGACTGAAAAATAGTAACCA GTCGTGGGCCCCATAAATC GTCCTCTCATAAATCCCTACTCATATC GTGAAAAAGTAGATATAATGGTTGGTG GCCTAGGAAGGCTACTGTCAA GCTTCTGAAAGCTTCTAGTTTACC GAAAATGCTATCCTCTTTGGTATAAAT GCAACTCTGGTTGTATTGTCTTCAT GCCTGTCTCAAAAATAAAGAGATAGACA GAATTAAATACCATCTGAGCACTGAA GGAAAAGACATAGGATAGCAATTT GAATAGGAGGTGGATGGATGG GGTGAGAGTGAGACCCTGTC GTGTGTATAACAAAATTCCTATGATGG GTCAACCAAAACTCAACAAGTAGTAA GCCACATGAATCAATTCCTATAATAAA GCAGAAGGGAAAATTGAAGCTG GCGAATGTATGATTGGCAATATTTTT D1GATA113 D1S1627

61 markers with clean flanking regions

(e.g. Marshfield Clinic Center (e.g. NCBI GenBank) of Medical Genetics)

47 markers with amplicon size < 125 bp

29 additional markers Test Markers on Population samples

Laboratory Work
Sequence homozygotes to determine allele sizes Build Bins for Genotyping Construct Allelic Ladders

18 markers for initial testing

41 markers for future studies

D1S1677 (NC02) D2S441 (NC02) D2S1776 D3S3053 D3S4529 D4S2364 (NC02)

Two three loci miniplexes

12 additional markers

NC01
Miniplex01 D10S1248 D14S1434 D22S1045 Miniplex02 D1S1677 D2S441 D4S2364

Subject of This Current Work

NC01

NC01
PCR Product Size (bp)

NIST Allelic Ladders

GeneMapperID bins and panels created following population analysis and sequencing
NC02
D4S2364

D4S2408 D5S2500 D6S474 D6S1017 D8S1115 D9S1122 D9S2157 D10S1248 (NC01)

D12ATA63
GenBank accession AC009771; positions 55,349..55,437

D10S1248

D10S1248
6FAM (blue)

D14S1434
VIC (green)

D2S441
*Lasergene map of D12ATA63

D14S1434

D10S1435 D11S4463 D12ATA63 D14S1434 (NC01) D17S974 D17S1301

NED (yellow)

D22S1045

D22S1045

D1S1677

D12ATA63

*European Recommended Loci

Miniplex Sets Used in This Study

**Loci may be used in different combinations in the future** NC01: D10S1248, D14S1434, D22S1045 NC02: D4S2364, D2S441, D1S1677 NC03: D3S3053, D6S474, D20S482 NC04: D1GATA113, D2S1776, D4S2408 NC05: D1S1627, D5S2500, D8S1115, NC06: D3S4529, D6S1017, D9S2157 NC07: D9S1122, D10S1435, D12ATA63 NC08: D17S1301, D18S853, D20S1082 NC09: D17S974, D11S4463

New miniSTR Loci Chromosomal Positions

1

D18S853 D20S482 D20S1082 D22S1045 (NC01)

(chosen to avoid linkage with CODIS 13 STRs to enable use of the product rule)
mD1GATA113 mD1S1677 mD1S1627 mD2S1776
D2S1338

TPOX

4
D3S1358

mD2S441 mD3S4529

mD4S2408 mD5S2500 mD4S2364

FGA D5S818 CSF1PO

mD6S1017 mD6S474

Summary
From Butler, J.M. (2006) Genetics and genomics of core STR loci used in human identity testing. J. Forensic Sci. 51(2): 253-265.

mD3S3053
9

Heterozygosity
Repeat TAGA CTTT TCAT GAAT TCTR TCTR AGAT GATA TCTR TATC GATA AGAA TCTR TKCC AAGG AAAGA AAAGA Overall 0.745 0.886 0.745 0.707 0.826 0.763 0.721 0.806 0.774 0.747 0.766 0.876 0.844 0.882 0.803 ----------Af. Am. 0.759 0.883 0.759 0.763 0.802 0.767 0.735 0.763 0.763 0.693 0.786 0.860 0.829 0.903 0.876 ----------Cau. 0.733 0.889 0.721 0.668 0.836 0.763 0.702 0.817 0.779 0.748 0.733 0.870 0.844 0.882 0.752 ----------Hisp. 0.743 0.886 0.764 0.679 0.850 0.757 0.729 0.864 0.786 0.843 0.793 0.914 0.871 0.843 0.764 ----------N 659 659 659 659 659 659 659 659 659 659 659 659 659 659 659 -----------

10mD10S1435

11

TH01

12

Location

mD8S1115
D7S820 D8S1179

VWA

Locus CSF1PO

GenBank (repeat #) X14720 (12) M64982 (21) D00269 (9) M68651 (11) M25858 (18) AC099539 (16) AC008512 (11) AC004848 (13) AF216671 (13) AL353628 (11) AC024591 (11) AP001534 (18) AP000433 (29) AC010136 (20) AC008507 (16) AP001752 (13) AC027004 (5)

Chromosome Position Chr 5 149.436 Mb Chr 4 155.866 Mb Chr 11 2.149 Mb Chr 2 1.472 Mb Chr 12 19.83 Mb Chr 3 45.557 Mb Chr 5 123.139 Mb Chr 7 83.433 Mb Chr 8 125.976 Mb Chr 13 81.620 Mb Chr 16 84.944 Mb Chr 18 59.100 Mb Chr 21 19.476 Mb Chr 2 218.705 Mb Chr 19 35.109 Mb Chr 21 43.880 Mb Chr 15 95.175 Mb

Location 5q33.1 4q31.3 11p15.5 2p25.3 12p13.31 3p21.31 5q23.2 7q21.11 8q24.13 13q31.1 16q24.1 18q21.33 21q21.1 2q35 19q12 21q22.3 15q26.2

Size (bp) 276 - 320 196 - 348 160 - 204 209 - 257 152 - 212 97 - 149 134 - 178 253 - 297 123 - 175 193 - 237 233 - 277 264 - 394 138 - 256 289 - 341 106 - 140 376 - 449 379 - 474

Alleles 5 - 16 12.2 - 51.2 3 - 14 4 - 16 10 - 25 8 - 21 7 - 18 5 - 16 7 - 20 5 - 16 5 - 16 7 - 40 12 - 41.2 15 - 28 9 - 17.2 2.2 - 17 5 - 24

New miniSTR markers are being characterized and information will be made available on STRBase (http://www.cstl.nist.gov/biotech/strbase/newSTRs.htm). Several of these miniSTR loci have been recommended for adoption by the European DNA community as new core loci. (Gill et al. 2006) In addition to increasing the successful typing of degraded materials, these loci can also provide additional discrimination in complex paternity cases or missing persons cases.
Acknowledgments and Disclaimer This project was funded by the National Institute of Justice through interagency agreement 2003-IJ-R-029 to the NIST Office of Law Enforcement Standards. Points of view are those of the authors and do not necessarily represent the official position or policies of the US Department of Justice. Certain commercial equipment, instruments and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. We thank Margaret Kline, Jan Redman, Richard Schoske, Peter Vallone, and Amy Decker for initial preparation and quantitation of the NIST U.S. population samples.

mD9S1122

13 CODIS core STR loci

mD9S2157
15

mD10S1248
16

mD11S4463
17 mD17S974

mD12ATA63

FGA TH01 TPOX VWA D3S1358 D5S818 D7S820 D8S1179 D13S317 D16S539 D18S51 D21S11 D2S1338 D19S433

13

14

18 mD18S853
D18S51

D13S317

mD14S1434

Rejected Loci and Why

D6S1027: D9S324: D10S1430: D10S2327: D14S297: D15S817: not in HWE perhaps due to null alleles allelic drop-out, complex repeats complex repeats tri-, quad-allelic profiles poor heterozygosity tri-,quad-allelic profiles
19
D19S433

Penta E

D16S539

mD17S1301
X
AMEL_X

20 mD20S482

21
D21S11 Penta D

22

AMEL_Y

mD20S1082

mD22S1045

NC01 NC02 NC03

NC04 NC05 NC06

NC07 NC08 NC09

Chromosome

CODIS Identifiler

PowerPlex 16 Sex-Typing

*32 loci x 663 samples = 21,216 total data points in this study

Positions determined along May 2004 Human Genome Reference Sequence (NCBI Build 35)

For more information, see STRBase:

Penta D Penta E

http://www.cstl.nist.gov/biotech/strbase/newSTRs.htm http://www.cstl.nist.gov/biotech/strbase/miniSTR.htm

Butler et al. (2003) J. Forensic Sci. 48(4):908-911