Anda di halaman 1dari 3

QND 30 lote 02 Telefone: 3964 1912 Taguatinga Norte

01. Leia o texto abaixo. 1 2 3 4 5 6 7 8 Como geralmente acontecia aos sbados de manh, comecei a trabalhar no laboratrio Cavendish, da Universidade de Cambridge. antes de Francis Crick, no dia 28 de fevereiro de 1953.- Eu tinha bons motivos para levantar cedo. Sabia que estvamos perto - embora no imaginasse o quanto - de decifrar a estrutura de uma molcula quase desconhecida na poca chamada cido desoxirribonuclico (DNA). Mas essa no era uma molcula qualquer: o DNA, como Crick e eu estvamos cientes, contm a chave da natureza das coisas vivas, armazenando as informaes hereditrias que so passadas de uma gerao a outra e orquestrando o mundo inacreditavelmente complexo da clula. Se decifrssemos sua estrutura tridimensional, a arquitetura da molcula, teramos um vislumbre do que Crick - entre srio e brincalho chamava de "o segredo da vida".
WATSON, James D. DNA: o segredo da vida. So Paulo: Companhia das Letras, 2005.

Considere as assertivas abaixo acerca da estrutura, composio e organizao do cido desoxirribonuclico. 1( ) A estrutura tridimensional (l.7) consiste em duas cadeias polinucleotdicas retas e antiparalelas. 2( ) O trecho informaes hereditrias (linha 6) poderia ser substitudo, sem prejuzo semntico,pelo vocbulo protenas . 3( ) H cinco tipos diferentes de bases nitrogenadas comumente encontradas no cido desoxirribonuclico, sendo que o pareamento das bases altamente especfico: bases pricas ligam-se a bases pirimdicas e bases pirimdicas ligam-se a bases pricas atravs de pontes de hidrognio. 4( ) O segredo da vida ( l. 8) relaciona-se com as seqncias de bases nitrogenadas adenina, citosina, guanina e uracila dos genes. 5( ) Apesar das informaes hereditrias (l.5) estarem presentes nos genes , estes , no processo de transcrio , devem ser transformados em molculas de RNA . EEEEE 02. Em 25 de abril de 1953, um estudo de uma nica pgina na revista inglesa Nature intitulado "A estrutura molecular dos cidos nuclicos", quase ignorado de incio, revolucionou para sempre todas as cincias da vida sejam elas do homem, rato, planta ou bactria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o cdigo gentico determinante para a sntese protica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimos" e os "degraus" dessa escada. b) Que relao existe entre DNA, RNA e sntese protica? A sequncia de bases nitrogenadas do DNA (gene) determina a sequncia de bases do RNA( mRNA) que determina a sequncia de aminocidos da protena. c) Como podemos diferenciar duas protenas? Duas protenas diferenciam-se, primariamente, pela sua estrutura primria. 03. A soma das porcentagens de guanina e citosina em uma certa molcula de DNA igual a 58% do total de bases presentes. a) Indique as porcentagens das quatro bases, adenina (A), citosina (C), guanina (G) e timina (T), nessa molcula. Ser considerada apenas a resposta que apresente o resultado correto das 4 bases . 29%C, 29%G, 21%A e 21%T. b) Explique por que impossvel prever a proporo de citosina presente no ARN mensageiro codificado por esse trecho de DNA. No se sabe qual fita do DNA ser transcrita e nem qual ser a quantidade de guanina na fita a ser transcrita. 04. Bactrias (Escherichia coli) foram cultivadas durante vrias geraes em um meio de cultura na qual toda a fonte de nitrognio era 15 o istopo pesado N. De uma amostra dessas bactrias (amostra A), extraiu-se o DNA que foi submetido a uma tcnica de centrifugao que permite separar molculas de DNA de acordo com sua densidade. O restante das bactrias foi transferido para um meio de cultura em que 14 todo o nitrognio disponvel era o istopo normal N. Retirou-se uma segunda amostra (amostra B), quando as bactrias completaram uma diviso celular nesse novo meio e uma terceira amostra (amostra C), quando as bactrias completaram duas divises celulares. O DNA das bactrias das amostras B e C foi tambm extrado e centrifugado. A figura mostra o resultado da centrifugao do DNA das trs amostras de bactrias. a) Por que, na amostra B, todo o DNA tem uma densidade intermediria 14 15 entre o que constitudo apenas por N e o que contm apenas N? Como a duplicao do DNA semiconservativa, cada molcula nova conserva uma fita 15N e outra 14N. b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior X, que quantidade de DNA h na faixa superior?JUSTIFIQUE. mesmo valor =X.

05. Diversas tcnicas so utilizadas para determinar, em genes de uma clula eucariota, a seqncia de bases nitrogenadas codificantes, ou seja, aquela que define a estrutura primria da protena a ser sintetizada. A abordagem experimental mais freqente, hoje, consiste em, primeiramente, extrair os RNA-mensageiros da clula, sintetizar os seus DNA-complementares e, ento, proceder ao seqenciamento das bases presentes nesses DNA. Em uma bactria, no entanto, possvel determinar a seqncia codificante diretamente a partir de seu cromossomo. Explique o motivo pelo qual, em organismos eucariotos, prefervel utilizar o RNA-mensageiro para determinar a regio codificante do DNA. O RNA mensageiro no possui as seqncias correspondentes aos ntrons.

Reviso Gentica Molecular 1 Bimestre 3 Ano - Biologia

QND 30 lote 02 Telefone: 3964 1912 Taguatinga Norte


6. A unio de vrios aminocidos forma os peptdeos. Estes, aps passarem por diferentes processamentos no Retculo endoplasmtico rugoso e complexo de Golgi, formam as protenas. As protenas exercem inmeras funes no nosso organismo, como por exemplo as funes enzimticas. Para descobrir se determinado organismo produz determinada protena, faz-se a construo de uma fita de RNA mensageiro a partir dela. Isso possvel graas relao existente entre os cdons do RNA mensageiro (cada trs nucleotdeos) e os aminocidos presentes nas protenas. Cada trs nucleotdeos correspondem a um aminocido, portanto, a partir de uma seqncia de aminocidos (peptdeo), possvel obter uma seqncia de nucleotdeos (RNA mensageiros). O inverso tambm pode ocorrer. A correspondncia entre os cdons do RNA mensageiro e os aminocidos por ele determinados constitui o cdigo gentico, que est representado na tabela a seguir:

Phe (fenilalanina), Leu (leucina), Ile (isoleucina), Met (metionina), Val (valina), Ser (serina), Pro (prolina), Thr (treonina), Ala (alanina), Tyr (tirosina), His (histidina), Gln (glutanina), Asn (asparagina), Lys (lisina), Asp (cido asprtico), Glu (cido glutmico), Cys (cistena), Trp (triptofano), Arg (arginina), Gly (glicina), pare (cdon de parada).

Com base no texto e em seus conhecimentos, julgue os itens a seguir em C para certos ou E para errados. (15) A partir da seqncia do RNA mensageiro UUU CAU AGU GCU GGG AGC CAC, formado o seguinte peptdeo: Phe-His-SerAla-Gly-Arg-His. (16) A partir da seqncia do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG, formado o seguinte peptdeo: Val-Val-Val-ValArg-Arg-Arg. (17) A partir da seqncia do RNA mensageiro UUAGGGGAGACUCGGCAGGAG, formado o seguinte peptdeo Leu-Gly-Glu-ThrArg-Gln-Glu.

7 . H na mdia uma grande quantidade de notcias envolvendo o DNA: testes de paternidade, engenharia gentica, transgnicos, clonagem teraputica e reprodutiva, terapia gnica, farmacogenmica etc. Para compreender essas notcias, necessrio conhecer a estrutura da molcula de DNA e entender seu funcionamento. Analise os dados dos quadros a seguir, e julgue os itens a seguir. 1( ) Em I, observa-se que o pareamento das bases nitrogenadas do DNA aleatrio. 2( ) O quadro I mostra uma molcula de DNA cuja duplicao ocorre de forma semiconservativa, pois cada uma das fitas originais em I serve de molde para uma nova fita, gerando duas novas duplas hlices. 3( ) Em II, est indicado o processo de transcrio, atravs do qual formam-se molculas que contm as mesmas bases nitrogenadas presentes no DNA. 4( ) Em III, est indicado o processo de traduo, que resulta na formao de polipeptdios, cuja seqncia de aminocidos est codificada numa molcula de cido nuclico. 5( ) A deleo de um dos pares de bases na seqncia mostrada em I no alteraria significativamente a seqncia de aminocidos em III. 8. Observe a seqncia de bases nitrogenadas.

Reviso Gentica Molecular 1 Bimestre 3 Ano - Biologia

QND 30 lote 02 Telefone: 3964 1912 Taguatinga Norte

Em relao a esse assunto, julgue os itens a seguir. 1( ) A introduo de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrio a partir desse ponto. 2( ) A mutao da 3 base na trinca indicada por 9 traduzir um aminocido diferente. 3( ) A seqncia pertence a um DNA e, como formada por 27 nucleotdeos, pode codificar um polipeptdeo contendo, pelo menos, 27 aminocidos. 4( ) A trinca indicada por 5 transcrever um cdon CGA, o qual reconhecido pelo anti-cdon GCU. 5( ) A troca da primeira base, em quaisquer das trincas indicadas, pode resultar na troca do aminocido respectivo na protena. CCECC 9. A indstria de flores movimenta bilhes de dlares por ano e est continuamente buscando criar novas variedades, como uma rosa azul. Pelos mtodos tradicionais, no possvel obter rosas dessa cor, pois a enzima que sintetiza esse pigmento est ausente nas roseiras. As petnias, entretanto, possuem tal enzima. Encontra-se em fase de teste uma tcnica que possibilita inserir em clulas de roseira o gene da petnia responsvel pela codificao da enzima que produz o pigmento azul. Suponha que, em vez de ser introduzido o gene da petnia que define a cor azul, fossem inseridas cpias de seu RNA mensageiro.Indique se h ou no possibilidade de produo de rosas azuis nesse caso e justifique sua resposta. Como a molcula de RNA possui curta durao na clula , a introduo dessa molcula ni causaria impacto no fentipo. 10. A molcula de RNAm sintetizada no ncleo, transcrevendo a seqncia de bases de uma cadeia de DNA. O RNAm no

citoplasma, se liga ao ribossomo, onde se d a produo de cadeias peptdicas.Com o auxlio da tabela abaixo analise a figura e as proposies a seguir.

1( ) O aminocido(I) metionina (met) trazido ao ribossomo pelo RNAt cujo cdon UAC (II), complementar ao anticdon AUG do RNAm. 2( ) Na etapa seguinte da traduo, um segundo RNAt (III), cujo anticdon complementar ao segundo cdon do RNAm geralmente onde h uma trinca UAA, UAG ou UGA, encaixa-se no stio destinado entrada de aminocidos na cadeia peptdica. 3( ) O nmero IV indica um RNAt que j participou da sntese protica e que poder ligar-se novamente com outro aminocido metionina(met) voltando a participar do processo de traduo, se necessrio. 4( ) O final da traduo ocorre quando, na leitura da mensagem gentica, se chega a um cdon de parada (V), a saber, UUG, UUA ou GUA, para os quais no h RNAt ou aminocido correspondente. 5( ) Sabendo-se que os cdons 5 e 6 trazem a informao para um mesmo aminocido, para o qual existe apenas uma trinca de codificao, ento os aminocidos 5 e 6 devem ser metionina(met). FF V F F

Reviso Gentica Molecular 1 Bimestre 3 Ano - Biologia