Available online at www.sciencedirect.

com

Journal of Virological Methods 146 (2007) 125128

Rapid and sensitive detection of Taura syndrome virus by reverse transcription loop-mediated isothermal amplication
Wansika Kiatpathomchai a,b, , Wansadaj Jareonram b , Sarawut Jitrapakdee c , T.W. Flegel b
a

National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Pathumthani 12120, Thailand b CENTEX Shrimp, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand c Department of Biochemistry, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand Received 27 March 2007; received in revised form 7 June 2007; accepted 11 June 2007 Available online 23 July 2007

Abstract Reverse transcription loop-mediated isothermal amplication (RT-LAMP) assay is a novel method of gene amplication that amplies nucleic acid with high specicity, sensitivity and rapidity, which can be applied for disease diagnosis in shrimp aquaculture. The method is performed under isothermal conditions with a set of four specially designed primers that recognize six distinct sequences of the target. In this study, using the RT-LAMP method, a protocol for detecting Taura syndrome virus which is a causative agent of Penaeus vannamei was developed. Time and temperature conditions for detection of TSV were optimized for 60 min at 63 C. The nucleic acids of other shrimp pathogens (yellow head virus; YHV and white spot syndrome; WSSV) were not amplied by this RT-LAMP system. The detection of TSV using RT-LAMP was 10 times more sensitive than the RT-PCR but less sensitive than nested RT-PCR. However this system was more convenient, rapid, and does not require sophisticated PCR machine. 2007 Elsevier B.V. All rights reserved.
Keywords: Taura syndrome virus (TSV); Penaeus vannamei; Shrimp; Loop-mediated isothermal amplication; LAMP; RT-LAMP; RT-PCR

1. Introduction Taura syndrome virus (TSV) was rst discovered in Ecuador in 1992 (Jimenez, 1992). It was a serious cause of shrimp mortality for reared Penaeus (Litopenaeus) vannamei (P. vannamei) in the Americas where it spreads principally through the regional and international transfer of live postlarvae and broodstock (Brock, 1997). TSV is a small, non-enveloped icosahedral virus containing a single-stranded positive-sense RNA genome of 10,205 nucleotides (Bonami et al., 1997; Mari et al., 2002) and was classied in the family Dicistroiridae (Mayo, 2002, 2005). The capsid is comprised of three major proteins, i.e. 55, 40, 24 kDa designated VP1, VP2 and VP3, respectively as well as a 58 kDa minor protein designated V0 (Bonami et al., 1997; Mari et al., 2002).

Corresponding author at: CENTEX Shrimp, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand. Tel.: +66 2 2015878; fax: +66 2 3547344. E-mail address: wansika@biotec.or.th (W. Kiatpathomchai).

Loop-mediated isothermal amplication (LAMP) assay is a novel approach that allows amplication of DNA with high specicity, sensitivity and rapidity under isothermal conditions. LAMP, originally described by Notomi et al. (2000), can amplify target nucleic acid to 109 copies at 6065 C within 1 h. The method relies on autocycling strand displacement DNA synthesis by the Bst DNA polymerase large fragment, a DNA polymerase with high strand displacement activity, and a set of two specially designed inner primers and two outer primers. LAMP is highly specic for the target sequence because of the recognition of the target sequence by six independent sequences in the initial stage and by four independent sequences in the later stages of the LAMP reaction. As the reaction is conducted under isothermal conditions, it can be performed with a simple and inexpensive water bath. Therefore, a thermal cycler is not required. As there is no time loss in thermal changes, the amplication efciency of the LAMP method is extremely high (Parida et al., 2004; Savan et al., 2005). The development of a loop-mediated isothermal amplication (LAMP) assay for detection of shrimp white spot syndrome virus (WSSV) DNA was described by Kono et al. (2004). The

0166-0934/$ see front matter 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2007.06.007

126

W. Kiatpathomchai et al. / Journal of Virological Methods 146 (2007) 125128

LAMP assay is also useful for RNA template detection upon the use of reverse transcriptase together with DNA polymerase (Notomi et al., 2000; Whiting and Champoux, 1998). In this paper, the RT-LAMP assay for detection of TSV RNA in P. vannamei is described. 2. Materials and methods 2.1. Shrimp samples

fragment; New England Biolabs Inc., Beverly, MA, USA), 1 of the supplied buffer, 0.125 U of AMV Reverse transcriptase (Promega) and the specied amount of template RNA in a nal volume of 25 l. Different amounts of RNA template were used. Uninfected samples and reaction mix without template were included as the negative controls. To determine the optimum time for amplication, the lamp reaction was carried out at 63 C for 30, 45 and 60 min. 2.5. Sensitivity of RT-LAMP

TSV infected P. vannamei were collected from shrimp farms in Samutsakorn province, Thailand. Shrimp haemolymph (50 l) was collected in a syringe preloaded with 100 l (i.e., two volumes) of 10% (w/v) sodium citrate solution (Kiatpathomchai et al., 2004). 2.2. RNA extraction Total RNA was extracted from 90 l of haemolymph-citrate mixture using 750 l of TRI Reagent (Molecular Research Center Inc., USA). After incubation for 5 min with vigorous mixing, 200 l of chloroform was added with vigorous mixing and the tube was incubated for 10 min before centrifugation at 12,000 g for 10 min. The aqueous phase was transferred to a fresh tube followed by precipitating with 500 l of 100% isopropanol for 10 min on ice and centrifuged at 12,000 g for 10 min. The pellet was washed with 70% (v/v) ethanol, air dried and dissolved in 50 l of RNase-free water (Kiatpathomchai et al., 2004). RT-PCR amplication was carried out using 2 l of this RNA solution as template. 2.3. Primers for RT-LAMP RT-LAMP primers for TSV were designed according to the published sequence of TSV structural gene (Gen-Bank accession number: AF277674; Mari et al., 2002) using Primer Explorer version 3 (http://primerexplorer.jp/lamp3.0.0/index.html). The details of the primers are given in Table 1. 2.4. Optimization of LAMP condition The RT-LAMP reactions were carried out at 60, 63 and 65 C for 1 h, followed by heat inactivation at 90 C for 2 min to terminate the reaction. The reaction mixture contained 2 M each of inner primers TSV-FIP and TSV-BIP, 0.2 M each of outer primers TSV-F3 and TSV-B3, 1.4 mM of dNTP mix (Promega, Madison, WI, USA), 0.6 M betaine (SigmaAldrich, St. Louis, MO, USA), 6 mM MgSO4 , 8 U of Bst DNA polymerase (large
Table 1 Primers used for RT-LAMP of structural gene of TSV Primer name TSV-F3 TSV-B3 TSV-FIP TSV-BIP Genome position 9117-9141 9345-9327 9207-9184/TTTT/9144-9163 9259-9278/TTTT/9320-9303

Ten-fold serial dilutions (101 to 107 diluted) of RNA extracted from TSV-infected shrimp was used as template for RT-LAMP following optimized conditions. The products were analyzed by 2% agarose gel electrophoresis. 2.6. RT-PCR for TSV detection Ten-fold serial dilutions (101 to 106 diluted) of RNA extracted from TSV-infected shrimp was then amplied by RT-PCR from OIE manual of diagnostic tests for aquatic animals 2006. The primers amplify a 231 bp sequence of the TSV genome (Nunan et al., 1998). The RT-PCR products were detected by 1.5% agarose gel electrophoresis following ethidium bromide staining and visualizing on a UV transluminator. 2.7. Nested RT-PCR for TSV detection Ten-fold serial dilutions (103 to 107 diluted) of RNA extracted from TSV-infected shrimp was then amplied by RT-PCR using IQ2000TM TSV Detection and Prevention System (Farming IntelliGene Technology Corporation) according to the manufacturers protocol. The nested PCR products were detected by 2% agarose gel electrophoresis following ethidium bromide staining and visualizing on a UV transluminator. 2.8. Specicity of RT-LAMP detection The specicity of RT-LAMP primers was examined using 200 ng of total RNA/DNA extracted from YHV-infected shrimp, WSSV-infected shrimp, and healthy shrimp as the template. 3. Results 3.1. Optimization of reaction temperature for TSV detection The RT-LAMP was carried out using RNA as template in order to determine the optimal temperature and reaction time.

Sequences 5 -3 CAATTGAAATTCTGAGATTAGAGTC GGTACATATCGAGCCACTC CTAGCTTCAGTGACCACGGTATAGTTTTATTTTGAGTCCAAAGCTCCA GCGAACCCATGCGGGTATAGTTTTCAATGCGACCAATGACTG

W. Kiatpathomchai et al. / Journal of Virological Methods 146 (2007) 125128

127

Fig. 1. Determination of LAMP conditions at various temperatures using 103 (A) and 105 (B) dilutions of RNA extracted from TSV-infected shrimp. Lane M: molecular marker; lane 1: the reaction was carried out at 60 C; lane 2: the reation was carried out at 63 C; lane 3: carried out at 65 C.

Fig. 3. Sensitivity of RT-PCR (OIE manual) for detection of TSV. Lane M: molecular marker; lane P: non-diluted RNA extracted from TS-infected sample; lane N: negative control; lanes 16: 101 to 106 dilutions of RNA extracted from TSV-infected sample.

3.3. Specicity of RT-LAMP detection RT-LAMP products were detected at only 63 C when using 103 and 105 dilution of RNA extracted from TSV infected sample (Fig. 1). No amplication product was found when the reaction was performed at 63 C for 30 min. For the reaction time carried out at 63 C for 45 and 60 min, LAMP products were detected (data not shown). However, for the complete amplication, the reaction time of 60 min was selected as an optimal reaction time. 3.2. Comparison in sensitivity between RT-LAMP, RT-PCR and nested RT-PCR To compare the sensitivity of detection limit, RT-LAMP, RT-PCR and nested RT-PCR were carried out using various concentrations of RNA extracted from TSV-infected shrimp as template. RT-LAMP was able to detect template at 105 dilution (Fig. 2), while the RT-PCR using OIE manual and nested RT-PCR using IQ2000TM TSV Detection and Prevention System were able to detect template at 104 (Fig. 3, lane 4) and 106 (Fig. 4, lane 4) dilutions, respectively. The cross-amplication of 200 ng each of nucleic acids of other shrimp disease viruses, i.e. WSSV infected Penaeus monodon DNA, YHV infected P. monodon RNA, healthy P. vannamei RNA and healthy P. monodon RNA was also evaluate to determine the specicity of RT-LAMP method. The result showed that neither of these nucleic acids was positive by this method (Fig. 5). This result indicates that RT-LAMP method is highly specic to TSV. 4. Discussion In this study, the RT-LAMP diagnostic protocol was carried out for the detection of TSV in shrimp. Two sets of primer (outer and inner) used were able to amplify a 204 bp sequence of VP3 capsid gene of TSV. The optimal condition of RT-LAMP reaction for the detection of TSV-RNA was 63 C and 60 min. The RT-LAMP is a faster detection method for the detection of shrimp virus, compared to the RT-PCR which takes 3045 min for RT reaction and at least 12 h for conventional PCR. Furthermore, no cross-reaction with WSSV and YHV-infected shrimp was observed indicating that RT-LAMP was specic to TSV. The sensitivity of RT-LAMP appears to be 10 times more sensitive than RT-PCR using OIE manual, but 10 times less sensitive

Fig. 2. Sensitivity of RT-LAMP for detection of TSV. Lane M: molecular marker; lane N: negative control; lane 1: non-diluted RNA extracted from TSV infected shrimp; lanes 28: 101 to 107 dilutions of RNA extract from TSV-infected sample.

Fig. 4. Sensitivity of nested RT-PCR (IQ2000TM TSV Detection and Prevention System) for detection of TSV. Lane M: molecular marker; lanes 15: 103 to 107 dilutions of RNA extracted from TS-infected sample; lane N: negative control.

128

W. Kiatpathomchai et al. / Journal of Virological Methods 146 (2007) 125128

been supported by a Thailand Graduate Institute of Science and Technology Scholarship (TGIST). References
Brock, J.A., 1997. Special topic review: Taura syndrome, a disease important to shrimp farms in the Americas. World J. Microbiol. Biotechnol. 13, 415418. Bonami, J.R., Hasson, K.W., Mari, J., Poulos, B.T., Lightner, D.V., 1997. Taura syndrome of marine penaeid shrimp: characterization of the viral agent. J. Gen. Virol. 78, 313319. Jimenez, R., 1992. In: Jiminez, R. (Ed.), Sindrome de Taura (Resumen). Acuacultura del Ecuador. In Revista especializada de la Camara Nacional de Acuacultura, vol. 1. Guayaquil, Ecuador, pp. 116. Kiatpathomchai, W., Jitrapakdee, S., Panyim, S., Boonsaeng, V., 2004. RT-PCR detection of yellow head virus (YHV) infection in Penaeus monodon using dried haemolymph spots. J. Virol. Methods 119, 15. Kono, T., Savan, R., Sakai, M., Itami, T., 2004. Detection of white spot syndrome virus in shrimp by loop-mediated isothermal amplication. J. Virol. Methods 115, 5965. Mari, J., Poulos, B.T., Lightner, D.V., Bonami, J.R., 2002. Shrimp Taura syndrome virus, genomic characterization and similarity with member of the genus Cricket paralysis-like viruses. J. Gen. Virol. 83, 915926. Mayo, M.A., 2002. A summary of taxonomic changes recently approved by ICTV. Arch. Virol. 147, 16551656. Mayo, M.A., 2005. Changes to virus taxonomy 2004. Arch. Virol. 150, 189198. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplication of DNA. Nucleic Acids Res. 28, e63. Nunan, L.M., Poulos, B.T., Lightner, D.V., 1998. Reverse transcription polymerase chain reaction (RT-PCR) used for the detection of Taura Syndrome Virus (TSV) in experimentally infected shrimp. Dis. Aquat. Organ. 34, 8791. Parida, M., Posadas, G., Inoue, S., Hasebe, F., Morita, K., 2004. Real-time reverse transcription loop-mediated isothermal amplication for rapid detection of West Nile virus. J. Clin. Microbiol. 42, 257263. Savan, R., Kono, T., Itami, T., Sakai, M., 2005. Loop-mediated isothermal amplication: an emerging technology for detection of sh and shellsh pathogens. J. Fish. Dis. 28, 573581. Whiting, S.H., Champoux, J.J., 1998. Properties of strand displacement synthesis by Moloney murine leukemia virus reverse transcriptase: mechanistic implications. J. Mol. Biol. 8, 278, 559577.

Fig. 5. Specicity of RT-LAMP primers for detecting different sources of 200 ng each of RNA/DNA templates. Lane M: molecular marker; lane N: negative control; lane 1: YHV infected P. monodon; lane 2: WSSV infected P. monodon; lane 3: healthy P. vannamei; lane 4: healthy P. monodon; lane 5: TSV infected P. vannamei.

than nested RT-PCR using an IQ2000 Kit for the detection of TSV. Whilst RT-PCR requires 23 h, RT-LAMP requires only 1 h thus RT-LAMP can shorten overall detection. Additionally, the nested RT-PCR protocol needs the 2nd step for adding the nested PCR reaction reagent into the tube after completeness of the 1st RT-PCR reaction while RT-LAMP needs only one step. This shows that the RT-LAMP protocol was more convenient, rapid, and does not require sophisticated PCR machine. This method could be used for both screening and conrmatory diagnosis of suspected shrimp, even though the virus titer is relatively low. This method is recommended as an applied protocol for health management program and disease surveillance of shrimp in hatcheries as well as in grow-out pond, in order to prevent the disease. Acknowledgements This study was supported by National Center for Genetic Engineering and Biotechnology (BIOTEC), Thailand. W.J. has