Mechanisms of Ageing and Development 123 (2002) 649 661 www.elsevier.

com/locate/mechagedev

Activation of an adipogenic program in adult myoblasts with age

Jane M. Taylor-Jones a, Robert E. McGehee b, Thomas A. Rando d, Beata Lecka-Czernik a, David A. Lipschitz a, Charlotte A. Peterson a,c,*
Department of Geriatrics, Donald W. Reynolds Center on Aging, Uni6ersity of Arkansas for Medical Sciences, 629 South Elm Street, Little Rock, AR 72205, USA b Department of Pediatrics, Uni6ersity of Arkansas for Medical Sciences, 629 South Elm Street, Little Rock, AR 72205, USA c Central Arkansas Veterans Health Care System, Little Rock, AR 72205, USA d GRECC, VA Palo Alto Health Care System, and Department of Neurology and Neurological Sciences, Stanford Uni6ersity School of Medicine, Stanford, CA 94305, USA Received 13 August 2001; received in revised form 26 October 2001; accepted 14 November 2001
a

Abstract Myoblasts isolated from mouse hindlimb skeletal muscle demonstrated increased adipogenic potential as a function of age. Whereas myoblasts from 8-month-old adult mice did not signicantly accumulate terminal markers of adipogenesis regardless of culture conditions, myoblasts from 23-month-old mice accumulated fat and expressed genes characteristic of differentiated adipocytes, such as the fatty acid binding protein aP2. This change in differentiation potential was associated with a change in the abundance of the mRNA encoding the transcription factor C/EBPa, and in the relative abundance of PPARg2 to PPARg1 mRNAs. Furthermore, PPARg activity appeared to be regulated at the level of phosphorylation, being more highly phosphorylated in myoblasts isolated from younger animals. Although adipogenic gene expression in myoblasts from aged animals was activated, presumably in response to PPARg and C/EBPa, unexpectedly, myogenic gene expression was not effectively repressed. The Wnt signaling pathway may also alter differentiation potential in muscle with age. Wnt-10b mRNA was more abundantly expressed in muscle tissue and cultured myoblasts from adult compared with aged mice, resulting in stabilization of cytosolic b-catenin, that may potentially contribute to inhibition of adipogenic gene expression in adult myoblasts. The changes reported here, together with those reported in bone marrow stroma with age, suggest that a default program may be activated in mesenchymal cells with increasing age resulting in a more adipogenic-like phenotype. Whether this change in differentiation potential contributes to the increased adiposity in muscle with age remains to be determined. Published by Elsevier Science Ireland Ltd.
Keywords: Skeletal muscle; Aging; Myoblasts; Myogenic differentiation; Adipogenic differentiation

* Corresponding author. Tel.: + 1-501-526-5826; fax: + 1-501-526-5817. E-mail address: petersoncharlottea@uams.edu (C.A. Peterson). 0047-6374/02/$ - see front matter. Published by Elsevier Science Ireland Ltd. PII: S 0 0 4 7 - 6 3 7 4 ( 0 1 ) 0 0 4 1 1 - 0

650

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661

1. Introduction Skeletal muscle repair and regeneration are largely mediated by satellite cells, myoblasts that reside between the sarcolemma and basal lamina of muscle bers in postnatal muscle and remain throughout adult life (Snow, 1977). Following muscle injury, satellite cells are stimulated to proliferate, migrate to the site of injury and fuse with existing bers or fuse and differentiate to form new bers de novo, thereby regenerating damaged or degenerating bers (Carlson and Faulkner, 1983; Grounds and Yablonka-Reuveni, 1993; Bischoff, 1994). Furthermore, during work-induced muscle hypertrophy, mature muscle bers accumulate new nuclei as myoblasts divide and subsequently fuse with adjacent bers (Darr and Schultz, 1987; Rosenblatt et al., 1994). Although satellite cells retain their myogenic potential even into old age (Allen et al., 1980), decits in satellite cell function with age have been described. Myoblasts cultured from old rats displayed a longer lag period prior to entering the cell cycle than cells from younger rats (Dodson and Allen, 1987; Johnson and Allen, 1993). Moreover, myoblasts showed a steady decline in replicative capacity in vitro as the age of the donor increased (Schultz and Lipton, 1982; Webster and Blau, 1990; Renault et al., 2000) that appears to be linked to telomere shortening (Decary et al., 1997). Thus, alterations in myoblast function during aging may contribute to diminished capacity for regeneration and muscle hypertrophy. Myoblast differentiation is regulated by the myogenic basic helix-loop-helix (bHLH) transcription factor family (MyoD, Myf5, myogenin, and MRF4) (Lassar et al., 1994; Sabourin and Rudnicki, 2000). MyoD and Myf5 accumulate in proliferating, undifferentiated myoblasts, whereas myogenin and MRF4 expression increase during differentiation. MyoD and myogenin are overexpressed in skeletal muscle from old animals, particularly during regeneration (Marsh et al., 1997; Musaro et al., 1995). Although all four members are capable of activating muscle-specic gene expression in a variety of cell types, effectively converting them into myoblasts, the activity of the myogenic bHLH regulators can be overcome in

myoblasts in vitro so that they can be induced to transdifferentiate into other cells types. Treatment of C2C12 mouse myoblasts with BMP-2 resulted in accumulation of alkaline phosphatase and calcication characteristic of osteoblast differentiation (Katagiri et al., 1994). Primary mouse myoblasts engineered to secrete BMP-2 have been shown to be converted to an osteogenic lineage and contribute to bone formation if transplanted into SCID mice (Lee et al., 2000). On the other hand, myoblasts are converted to adipocyte-like cells by treatment with thiazolidinediones, potent activators of the transcription factor peroxisome proliferator-activated receptor g (PPARg) (Grimaldi et al., 1997; Teboul et al., 1995). Although PPARg clearly activates adipocyte-specic gene expression (Tontonoz et al., 1994a; Mandrup and Lane, 1997), it has been hypothesized that PPARg normally regulates fatty acid metabolism in skeletal muscle, as well as in adipose tissue (Lapsys et al., 2000). However, overexpression of PPARg and C/EBPa, also an activator of adipocyte-specic genes, stimulates adipogenic differentiation in C2C12 myoblasts (Hu et al., 1995). More recently it was suggested that Wnt10b may be involved in the inhibition of adipogenic differentiation, as disruption of Wnt signaling caused transdifferentiation of myoblasts into adipocytes (Ross et al., 2000). In the absence of Wnt signaling, b-catenin is part of a complex that targets it for rapid degradation (Kikuchi, 2000). Wnt ligands bind to transmembrane receptors of the Frizzled family and in response to canonical Wnt signaling, b-catenin is released from the complex, stabilized and translocated to the nucleus where it regulates the transcription of genes that promote myogenesis (Cossu and Borello, 1999; Ridgeway et al., 2000; Hoppler et al., 1996) and inhibit adipogenesis (Ross et al., 2000). Thus, mesodermal cell fate is controlled by both positive and negative regulatory mechanisms. As muscle tissue normally contains adipocytes and preadipocytes, the potential contribution of myoblast conversion to an adipogenic cell type that would increase fat content in muscle, in vivo, has not been described. An inverse relationship between adipogenic and osteoblastic potential has been documented in the

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661

651

bone marrow (Beresford et al., 1992; Gimble et al., 1996; Kajkenova et al., 1997). In addition, ex vivo cultures of bone marrow isolated from the senescence accelerated mouse-P6 (SAMP6), demonstrated decreased osteoblastogenesis and increased adipogenesis (Jilka et al., 1996). These results suggest a switch in the differentiation program of multipotent mesenchymal progenitors during aging and provides a potential explanation for the association of decreased bone formation with the increased adiposity of the bone marrow seen with advancing age in animals and humans (Moore and Dawson, 1990; Robey and Bianco, 1999). Although the increase in inter- and intramuscular fat that occurs as a function of age (Pahor and Kritchevsky, 1998) likely involves changes in muscle metabolism, most notably less efcient fatty acid oxidation, results presented here suggest that altered myoblast potential may also contribute to increased adipogenesis in muscle during aging.

Differentiation Media (MDM) consisting of DMEM media (GiboBRL) with 2% horse sera (Hyclone, Logan, UT) and 0.5% pen-strep. This treatment regimen was performed at least three times on each isolate. Myogenic differentiation was assayed by myotube formation and mysoin heavy chain expression after 72 h in MDM (see below).

2.2. Acti6ation and assessment of the adipogenic program

Proliferating myoblasts were grown to \ 95% conuence in MGM then switched to Adipocyte Inducing Media (AIM) composed of MGM supplemented with a cocktail of IBMX (115 mg/ml iso-butylmethylxanthine (Sigma); 5 10 4 M dexamethasone (Sigma); and 25 U/ml insulin (Novolin, Clayton, NC) (McGehee et al., 1993) for 3 days with daily feeding. On day 4, AIM was replaced with MGM supplemented with insulin only. Cultures were harvested 24 h later for RNA isolation. For AIM cultures receiving rosiglitazone (520 mM nal concentration, GlaxoWelcome, Durham, NC), treatment began on day 2 with daily feeding until harvest. Induction of adipogenic differentiation was performed at least three times and using duplicate plates, adipocyte differentiation was assessed by Oil Red-O staining (see below).

2. Materials and methods

2.1. Isolation and culture of primary myoblasts

Myoblasts were isolated from the tibialis anterior of four adult (8 month) and four aged (23 month) DBA/2JNIA mice as described (Rando and Blau, 1994). Results shown are from myoblasts pooled from groups of adult or groups of aged mice, although comparable results were obtained from analysis of individual animals. Proliferating myoblasts were plated on collagen-coated plates (Sigma, St. Louis, MO) and maintained in Myoblast Growth Media (MGM) containing Hams F-10 media (BioWhittaker, Walkersville, MD) supplemented with 20% fetal bovine sera (FBS) (BioWhittaker), 0.5% pen-strep (GibcoBRL, Grand Island, NY), and 5 ng/ml bFGF (Promega, Madison, WI). Cells were serially preplated to yield pure populations (\ 98%) of myoblasts. For differentiation, myoblasts were cultured on E-C-L Attachment Matrix (Upstate Biotechnology, Lake Placid, NY) or Matrigel (Becton Dickinson, Bedford, MA), grown to conuence in MGM, then switched to Myoblast

2.3. Northern analysis of RNA and RT-PCR

Myoblasts isolated from different aged mice were harvested for RNA as described (DupontVersteegden et al., 2000). Ten mg of total RNA was resolved on 1% denaturing agarose gels and ribosomal bands visualized with ethidium bromide (Gibco/BRL) using the Stratagene (La Jolla, CA) Eagle Eye imaging system for normalization of RNA loading using Scion Image (NIH) software. Northern blotting was performed as described (Dupont-Versteegden et al., 2000) with radioactively labeled [a-dCTP 32P] (New England Nuclear, Boston, MA) probes, generated using the AMBION Decaprime II kit (Austin, TX). Hybridized lters were exposed to FUJI Medical X-ray Film RX (Stamford, CT) and signals quan-

652

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661

titated using Scion Image (NIH) software. cDNA probes included MyoD, myogenin, and actin (Hughes et al., 1993) and lipoprotein lipase (LPL) (Holm et al., 1988). Blots shown are representative and were repeated at least three times. Using the Clontech (Palo Alto, CA) Advantage RT-for-PCR and Advantage cDNA PCR kits, RT-PCR was performed as described in the user manual for semi-quantitative analysis using gyceraldehyde-3-phosphate (GAPDH) as the positive control for sample normalization. Reactions were carried out using an Applied Biosystems (Norwalk, CT) GeneAMP PCR System 2400. Cycle number and annealing temperatures were empirically determined for each set of primers (see below). PCR products were resolved on 2% agarose gels by combining GibcoBRL UltraPure agarose and FMC (Rockland, ME) NuSieve GTG agarose 1:1. To insure the amplication reactions were within the linear range, PCR products were visualized with ethidium bromide on the ChemiImager Imaging System 5500 (Alpha Innotech Corporation, San Leandro, CA) to determine signal saturation. Figures shown are representative and the experiments was repeated a minimum of three times. Primers and PCR conditions were as follows: aP2(5%-GGGATTTGGTCACCATCCG, 3%-CCAGCTTGTCACCATCTCG) GenBank c K02 109, 62 C annealing, 32 cycles, 204 bp product. C/EBPa(5%-GCCGCCTTCAACGACGAG, 3%TGGCCAGGCTGTAGGTGCAT) Genbank c NM 007678, 57 C annealing, 30 cycles, 449 bp product. PPARg1(5% - TTCTGACAGGACTGTGTGACAG, 3%-ATAAGGTGGAGATGCAGGTTC) (Gimble et al., 1996), 55 C annealing, 27 cycles, 354 bp product. PPARg2(5%-GCTGTTATGGGTGAAACTCTG, 3%-same as for PPARg1) (Gimble et al., 1996), 62 C annealing, 35 cycles, 351 bp product. Wnt-10b(5%-CTGCCACTGTCGTTTCCACTG, 3%-AGACCCTTTCAACAACTGAACG) (personal communication, J.O. Mason, University of Edinburgh, UK), 60 C annealing, 32 cycles, 660 bp product.

GAPDH(5%-ATTGGGAAGCTTGTCATCAACG, 3%-CACCCTGTTGCTGTAGCCGT) Genbank c 32599, 60 C annealing, 23 cycles, 781 bp product.

2.4. Western analysis

Whole cell extracts were prepared as described (McGehee et al., 1993). Fifty mg protein samples were resolved on a 12% SDS/PAGE gel and western blotting was performed as described (Kiyokawa et al., 1994). Filters were stained with Ponceau S to verify that an equal mass of protein was loaded per lane (data not shown). Primary antibody against PPARg (Santa Cruz Biotechnology, Santa Cruz, CA) was diluted 1:167 and the secondary antibody, an HRP-conjugated goat anti-rabbit (Pierce, Rockford, IL), was diluted 1:5000. For b-catenin analysis, whole cell extracts were ultracentrifuged into cytosolic and membrane-bound fractions (Young et al., 1998). Western blots were performed as described above loading 15 mg of protein per sample. Primary antibody against b-catenin (BD Transduction Laboratories, Lexington, KY) was diluted 1:500. The secondary antibody was the same as described for PPARg, and used at the same concentration. The ChemiGlow chemiluminescent substrate kit (Alpha Innotech Corporation) was used in conjunction with the ChemiImager Imaging System (Alpha Innotech Corporation) to visualize the protein bands.

2.5. Immunocytochemistry
For desmin antibody staining (Sigma), cultures were xed in neutral buffered formalin for 15 min followed by 1 h incubation with primary antibody, diluted 1:40. The secondary antibody, an AP-conjugated rat anti rabbit IgG (Zymed, South San Francisco, CA), was added at a dilution of 1:200. The reaction was visualized using the Vector Alkaline Phosphatase substrate Kit IV (Burlingame, CA). Myogenic differentiation was assessed by staining for myosin heavy chain using antibody A4.1025 as described (Sarbassov et al., 1995). Lipid accumulation in myoblast cultures and in

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661

653

frozen tissue sections was detected by Oil Red-O staining following xation in 3.7% formaldehyde as described (Patel and Lane, 2000). In some cases, counterstaining with 3% methyl green or hematoxylin was performed. Slides were visualized using a Nikon E600 microscope with CoolSnap camera (Tokyo, Japan).

3. Results Following isolation from hindlimb skeletal muscles, primary cultures were maintained in myoblast growth medium (MGM) to enrich for myoblasts. The purity of the myoblast cultures was determined immunocytochemically with a monoclonal antibody recognizing desmin, an intermediate-lament protein expressed specically in myoblasts (George-Weinstein et al., 1993). Cultures from the adult (8 month, Ad) and aged (23 month, Ag) mice were indistinguishable morphologically and more than 98% of the cells were desmin positive in each population (Fig. 1A and B). Myoblasts were induced to undergo myogenic differentiation, characterized by fusion into multinucleated myotubes, by culture in low serum (myoblast differentiation medium, MDM). Myoblasts from both adult (Fig. 1C) and aged (Fig. 1D)

2.6. Statistical analysis

Cultures were treated a minimum of three times with each of the differentiation regimens. Northern, western and PCR analyses were performed at least three times from each batch of cells. All data were log2 transformed prior to analysis. ANOVA was used to determine the signicance (P B 0.5) of the data from all experiments. Fold differences are indicated in the text and are presented as means 9 S.D in the gure legends.

Fig. 1. Purication and differentiation of mouse myoblasts isolated from 8 month (A and C) and 23 month (B and D) old mice. Both populations of myoblasts cultured in MGM reacted strongly with an antibody recognizing desmin (A and B). Following 3 days in myoblast differentiation medium (MDM), myoblasts from both adult (C) and aged (D) animals had fused to form myotubes that expressed myosin heavy chain.

654

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661

the abundance decreased during myogenic differentiation in both populations, LPL mRNA continued to be overexpressed by more than four-fold in myoblasts from old animals. This observation prompted examination of additional markers of

Fig. 2. Total RNA isolated from myoblasts obtained from adult (Ad) and aged (Ag) animals prior to differentiation (MGM) and following 3 days in low serum (MDM), were analyzed by northern blot with the indicated probes. Myogenic markers were expressed at comparable levels in different aged myoblasts, whereas LPL mRNA was overexpressed an average of 6.229 1.37-fold in old myoblasts. 18S ribosomal RNA was used as a control for RNA loading.

animals fused efciently and expressed high levels of myosin heavy chain. The extent of myoblast differentiation was monitored at the RNA level by northern analysis (Fig. 2). Although slight variation in accumulation of muscle-specic gene products was observed between myoblast isolates, results of Analysis of Variance (ANOVA) indicated that no reproducible differences were apparent between myoblasts from adult and aged animals in MGM or MDM (Fig. 2). MyoD mRNA abundance dropped, whereas myogenin and sarcomeric actin mRNAs increased comparably upon exposure to MDM (Fig. 2). Thus, the two populations of myoblasts possesed apparently equivalent myogenic potential. One difference observed between myoblasts from different aged animals was in LPL mRNA abundance. LPL mRNA was expressed at more than six-fold higher levels in myoblasts from aged than adult animals in MGM (Fig. 2). Although
Fig. 3. Myoblasts isolated from 8-month-old mice (A) and from 23-month-old mice (B and C) following 24 h in MDM stained with Oil Red-O, counterstained with methyl green. Oil Red-O staining, indicated by the arrows, was observed in mononucleated myoblasts (B), and in myoblasts undergoing fusion into myotubes (C) derived from the older animals. Fig. 4. Oil Red-O staining of myoblasts following culture in adipocyte inducing medium (AIM). Fat accumulation was augmented in myoblasts isolated from older (B) compared with younger (A) mice.

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661

655

Fig. 5. Total RNA isolated from myoblasts obtained from 8 month (Ad) and 23 month (Ag) mice following culture in MGM, AIM, and MDM were analyzed by RT-PCR. Primer sets and conditions used to generate the specic products indicated are described in the Methods. C/EBPa was 6.57 9 2.41-fold overexpressed in aged myoblasts in MGM. aP2 mRNA accumulated to signicantly higher levels in aged myoblasts under all culture conditions (6.54 90.56, MGM; 4.96 90.48, AIM; 6.15 9 2.13, MDM).

adipogenesis. Oil Red-O staining to monitor accumulation of neutral triglycerides revealed that myoblasts from adult animals demonstrated essentially no staining (Fig. 3A), whereas Oil RedO positive droplets were abundant in myoblasts from aged animals (Fig. 3B). That triglyceride accumulation was occurring in myoblasts, as opposed to other contaminating cell types, was evidenced by the fact that myoblasts undergoing fusion into myotubes were Oil Red-O positive (Fig. 3C). To augment fat accumulation, myoblasts were cultured under conditions reported to induce adipogenic differentiation in preadipocyte cell lines (McGehee et al., 1993). Myoblasts from older animals responded to culture in the presence of adipocyte inducing medium (AIM) by increasing triglyceride accumulation (Fig. 4B) to a much greater extent than those from younger animals (Fig. 4A). To determine if the adipogenic potential of myoblasts from old animals is, in fact, increased, we next examined the expression of genes encoding transcription factors that regulate adipogenesis and terminal differentiation markers of adipocytes (Fig. 5). C/EBPa mRNA was expressed at more than six-fold higher levels in myoblasts from older animals compared with those from younger animals in MGM. Expression was comparable in myoblasts from different aged animals cultured in AIM and comparable but reduced in MDM. Tran-

scripts encoding both PPARg1 and PPARg2 accumulated in myoblasts from adult and old mice (Fig. 5). PPARg1 mRNA was detected at lower cycle number than PPARg2 in all cases, demonstrating that it was more abundantly expressed. However, the relative abundance of PPARg2 to PPARg1 was consistently higher in myoblasts from older as compared with younger animals in all culture conditions (Fig. 5). Similarly, mRNA encoding the marker of terminally differentiated adipocytes, aP2, was expressed at more than six-fold higher levels in myoblasts from aged animals. Although the relative abundance of PPARg1 to PPARg2 may inuence activity, the fact that PPARg1 and PPARg2, together with C/EBPa mRNAs accumulated in myoblasts from younger animals in AIM, but aP2 did not, suggest that transcription factor activity may be controlled post-transcriptionally in this system. We attempted to modulate PPARg activity by treating myoblasts with the specic ligand and activator of PPARg, the thiadolazindione rosiglitazone. At concentrations between 5 and 20 mM, rosiglitazone did not increase expression of adipogenic markers. As shown in Figs. 5 and 6A, aP2 mRNA was highly expressed in myoblasts from old animals cultured in MGM and AIM, and addition of rosiglitazone did not augment expression. Furthermore, rosiglitazone had no effect on the expression of myogenic markers (Fig. 6B). Myogenin mRNA was upregulated in AIM compared with MGM, although to a lesser extent than in MDM, in both adult and old myoblasts, and rosiglitazone did not dampen this response.

Fig. 6. Total RNA isolated from myoblasts obtained from 8 month (Ad) and 23 month (Ag) mice following culture in MGM, AIM, AIM supplemented with rosiglitazone (ros, 5mM), and MDM were analyzed by RT-PCR (A) and northern blot (B). Neither the marker of adipocyte differentiation (aP2) nor the myogenic marker (myogenin, MyoG) was affected by up to 20 mM rosiglitazone. 18S ribosomal RNA was used as a control for RNA loading.

656

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661

Fig. 7. Protein extracts derived from myoblasts puried from 8 month (Ad) and 23 month (Ag) mice following culture in MGM, AIM, and MDM were analyzed by western blot using an antibody recognizing both PPARg1 and 2. Differences in protein abundance and phosphorylation state were apparent.

As PPARg activity has also been shown to be modulated by phosphorylation (Hu et al., 1996; Han et al., 2000; Lazennec et al., 2000), we next investigated PPARg by western analysis to detect differences in phosphorylation state. Analysis of myoblast protein extracts derived from adult animals cultured in AIM and MDM demonstrated that PPARg2 was hyperphosphorylated compared with those from old mice, suggesting that PPARg2 was likely to be inactive in myoblasts from younger animals (Fig. 7). However, under the other culture conditions, PPARg phosphorylation could not account for the fact that aP2 mRNA was expressed at high levels only in old myoblasts (Fig. 5). This may be due to the fact that adipogenic gene expression in myoblasts not only requires functional PPARg, but also sufcient C/EBPa, which was not readily detectable in adult myoblasts cultured in MGM (Fig. 5). Additional pathways may regulate adipogenic gene expression in primary myoblasts. Fig. 8A shows that Wnt-10b mRNA accumulation was inversely correlated to the expression of aP2 mRNA. In myoblasts cultured in AIM, the most permissive environment for adipogenic differentiation, whereas aP2 mRNA expression was greater in aged compared with adult myoblasts, Wnt-10b mRNA was 2.5-fold more abundant in adult compared with aged myoblasts. The activity of the Wnt pathway was affected by altered Wnt-10b gene expression with age as demonstrated by a three-fold higher accumulation of cytosolic bcatenin, a downstream target of the Wnt pathway, in adult myoblasts (Fig. 8B). The Wnt pathway may also be involved in regulating adipogenic potential in muscles in vivo with age, as Wnt-10b mRNA preferentially accumulated in muscle iso-

lated from adult compared with aged animals (Fig. 8C). In the analysis of whole muscle, the vast majority of RNA was contributed by the muscle bers as opposed to satellite cells, suggest-

Fig. 8. Analysis of the Wnt signaling pathway. (A) Total RNA isolated from myoblasts obtained from 8 month (Ad) and 23 month (Ag) mice cultured in AIM were analyzed by RT-PCR using primers and reaction conditions specic for aP2 and Wnt-10b mRNAs. aP2 and Wnt-10b mRNA abundance was inversely correlated (aP2, 6.89 91.53 overexpressed in aged myoblasts; Wnt-10b, 2.5 90.05 overexpressed in adult myoblasts). (B) Protein extracts derived from myoblasts isolated from 8 month (Ad) and 23 month (Ag) mice cultured in AIM were differentially centrifuged to separate cytosolic and membrane fractions, followed by western blot analysis using an antibody recognizing b-catenin. Free b-catenin accumulated to 2.95 90.045 higher levels in adult myoblasts. (C) Total RNA isolated from the tibialis anterior muscle of 8 month (Ad) and 23 month (Ag) mice were analyzed by RT-PCR using primers and reaction conditions specic for Wnt-10b and gyceraldehyde-3-phosphate (GAPDH) mRNAs. Differences in Wnt-10b mRNA accumulation were apparent with age.

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661

657

Fig. 9. Cryostat sections of human vastus lateralis muscle from a 41-year-old (A) and a 78-year-old (B) stained with Oil Red-O and counterstained with hematoxylin. Oil Red-O positive bers were abundant in muscle from the older individual.

ing that the well-documented increased accumulation of intra- and intermuscular fat observed in humans with age (reviewed in Pahor and Kritchevsky, 1998, and illustrated in Fig. 9) may be due, at least in part, to a change in gene expression, regulated by crosstalk between multiple signaling pathways.

4. Discussion Numerous experimental systems have demonstrated the potential of stem cells to give rise to a variety of differentiated cell types. This may be advantageous in particular cases of injury or disease, but would have unfavorable consequences if stem cells resident within a tissue differentiate inappropriately. Our data suggest that myoblast potential may change during the normal course of

aging such that genes typical of an adipogenic phenotype are expressed. Results presented utilized mass cultures of essentially pure and comparably myogenic cells based on desmin, MyoD and myogenin expression and fusion potential. Cultures were not maintained for the time required, or under the growth conditions to permit, a small subpopulation of cells to overgrow the myoblast population and generate the magnitude of adipogenic response observed. Furthermore, the fact that adipogenic markers were expressed in myoblasts from aged animals simultaneously undergoing myogenic fusion (Fig. 3), support the idea that a change in myoblast potential had occurred with age. However, we cannot rule out the possibility that the myoblast populations are heterogeneous and that only a subset of myoblasts isolated from aged animals exhibited altered differentiation potential. For example, the relative contribution of the recently described side population of muscle-derived stem cells (Gussoni et al., 1999; Jackson et al., 1999; Beauchamp et al., 1999; Seale et al., 2000) is currently unknown. These cells appear to be very rare in muscle and, although they have been demonstrated to be able to differentiate into other cells types dependent on location, they have only been shown to give rise to satellite cells in muscle (Gussoni et al., 1999; Jackson et al., 1999; Lee et al., 2000). Clarication of this point awaits detailed clonal analysis currently underway. In any case, our data indicate a stable change in the in vitro differentiation potential of myoblasts as a function of age. This potential is clearly inuenced by a variety of agents including growth factors, substrate, density, and passage number. Thus, cues from the aging muscle environment may determine if this program is activated in vivo. Adipocyte-specic gene expression is primarily controlled by PPARg and C/EBPa (Lowell, 1999; Loftus and Lane, 1997; Mandrup and Lane, 1997). Two isoforms of PPARg, derived from different promoters and alternative splicing have been identied (Chen et al., 1993; Tontonoz et al., 1994a; Zhu et al., 1995). Previously it has been reported that whereas PPARg1 has a fairly broad tissue distribution, PPARg2 is restricted to adipose tissue (Mukherjee et al., 1996; Tontonoz et al., 1994b). Furthermore, a bone marrow cell line that ex-

658

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661

pressed PPARg1 did not express markers of terminal adipocyte differentiation until stably transfected with a PPARg2 expression construct (Lecka-Czernik et al., 1999). We show here that myoblasts express both PPARg1 and PPARg2 mRNAs. The abundance of PPARg2 relative to PPARg1 mRNA was highest in myoblasts from aged animals, potentially contributing to increased adipogenic potential in those cells. Surprisingly, adipogenesis was not augmented by exposure of either adult or aged cells to rosiglitazone, a synthetic, high afnity ligand for PPARgs. This is in contrast to reports using a myoblast cell line and myoblasts isolated from 1-day-old mice (Grimaldi et al., 1997; Teboul et al., 1995), suggesting that PPARg activity in adult primary myoblasts may be regulated distinctly. That cellular context inuences PPARgligand activity has been demonstrated (Camp et al., 2000), and it was hypothesized that this may be due to variations in abundance of specic cofactors. It is possible that PPARg2 in aged muscle is activated by endogenous ligands and cofactors unique to, or at least overexpressed, in that environment. In vitro, even in the apparent absence of exogenous ligand, the combination of PPARg and C/EBPa expressed in aged myoblasts appears sufcient to promote adipogenic gene expression. Although adipogenic gene expression in myoblasts from aged animals was activated, myogenic gene expression was not effectively repressed. This was unexpected, as PPARg and C/EBPa have been shown to inhibit myogenic differentiation by downregulating the bHLH family of transcription factors that is functionally separate from their ability to stimulate adipogenesis (Hu et al., 1995). Furthermore, in osteoblastic progenitors, PPARg2 downregulates the osteoblast-specic transcription factor Osf2/ Cbfa1, thereby inhibiting osteoblastic differentiation and promoting adipogenic differentiation (Lecka-Czernik et al., 1999). It is possible that signaling pathways in myoblasts inhibit specic functions of PPARg and/or C/EBPa. For example, mitogen-activated protein kinase (MAPK) activation appears to promote myogenic differentiation (Sarbassov and Peterson, 1998), whereas

adipogenesis is inhibited through MAPK-mediated phosphorylation of PPARg (Jaiswal et al., 2000; Hu et al., 1996; Han et al., 2000). That PPARg2 appears hyperphosphorylated in myoblasts from younger animals supports this idea. However, it was recently reported that phosphorylation of PPARs by protein kinase A enhanced activity (Lazennec et al., 2000), suggesting that the site of phosphorylation within the protein must be considered. The Wnt signaling pathway has been reported to repress adipogenesis in myoblasts through inhibition of the expression of PPARg and C/EBPa, likely mediated by Wnt10b (Ross et al., 2000). We found an inverse relationship between Wnt-10b mRNA, free bcatenin, and adipogenesis, consistent with the idea that the Wnt signaling pathway inhibits terminal adipocyte gene expression. However, if this is the case, Wnt-10b regulates PPARg and C/ EBPa activity posttranslationally in these cells. It seems equally likely that in aged myoblasts, activation of PPARg and C/EBPa activity leads to downregulation of Wnt-10b, permitting adipogenesis to proceed. Although the mechanism of action of the Wnt pathway is unclear, the fact that Wnt-10b mRNA is overexpressed in muscle tissue derived from younger compared with older animals, suggests that downregulating the pathway with age may provide a permissive environment for adipogenic gene expression in differentiated muscle bers, as well as in satellite cells from older animals. In conclusion, our data suggest that a balance exists between differentiation programs in myoblasts, controlled by the relative abundance and activity of an array of myogenic and adipogenic transcription factors, and that this balance appears shifted with age. Whether this shift contributes to the increased adiposity in muscle with age remains to be determined. Given the parallels between changes reported here and those that occur in bone marrow stroma with age, it is possible that over time, mesenchymal stem cell populations are gradually replaced with cells with increased adipogenic potential or that activation of an adipogenic gene program is common to aging mesenchymal cells.

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661

659

Acknowledgements We thank Elena Moerman for excellent technical assistance and Dr Edward D. Bearden for statistical analysis. This work was supported by grants to C.A. Peterson from the National Institutes on Aging (AG00724 and AG13009), to R.E.M. from the National Cancer Institute (CA78845) and to T.A. Rando from the Department of Veterans Affairs and the American Federation for Aging Research. References
Allen, R.E., McAllister, P.K., Masak, K.C., 1980. Myogenic potential of satellite cells in skeletal muscle of old rats. Mech. Ageing Dev. 13, 105 109. Beauchamp, J.R., Morgan, J.E., Pagel, C.N., Partridge, T.A., 1999. Dynamics of myoblast transplantation reveal a discrete minority of precursors with stem cell-like properties as the myogenic source. J. Cell Biol. 144, 1113 1122. Beresford, J.N., Bennet, J.H., Devlin, C., Leboy, P.S., Owen, M.E., 1992. Evidence for an inverse relationship between the differentiation of adipocytic and osteogenic cells in rat marrow stromal cell cultures. J. Cell Sci. 102, 341 351. Bischoff, R., 1994. Myology. In: Engel, A.G., Franzini-Armstrong, C. (Eds.), The Satellite Cell and Muscle Regeneration. McGraw Hill, New York, pp. 97 118. Camp, H.S., Li, O., Wise, S.C., Hong, Y.H., Frankowski, C.L., Shen, X., Vanbogelen, R., Leff, T., 2000. Differential activation of peroxisome proliferator-activated receptorgamma by troglitazone and rosigliatazone. Diabetes 49, 539 547. Carlson, B.M., Faulkner, J.A., 1983. The regeneration of skeletal muscle bers following injury: a review. Med. Sci. Sports Exer. 15, 187 198. Chen, F., Law, S., OMalley, B.W., 1993. Identication of two mPPAR related receptors and evidence for the existence of ve subfamily members. Biochem. Biophys. Res. Commun. 196, 671 677. Cossu, G., Borello, U., 1999. Wnt signaling and the activation of myogenesis in mammals. EMBO J. 18, 6867 6872. Darr, K.C., Schultz, E., 1987. Exercise-induced satellite cell activation in growing and mature skeletal muscle. J. Appl. Physiol. 63, 1816 1821. Decary, S., Mouly, V., Hamida, C.B., Sautet, A., Barbet, J.P., Butler-Browne, G.S., 1997. Replicative potential and telomere length in human skeletal muscle: implications for satellite cell-mediated gene therapy. Hum. Gene Ther. 8, 1429 1438. Dodson, M.V., Allen, R.E., 1987. Interaction of multiplication stimulating activity/rat insulin-like growth factor II with skeletal muscle satellite cells during ageing. Mech. Ageing Dev. 39, 121 128.

Dupont-Versteegden, E.E., Murphy, R.J.L., Houle, J.D., Gurley, C.M., Peterson, C.A., 2000. Mechanisms leading to restoration of muscle size with exercise and transplantation after spinal cord injury. Am. J. Physiol. 279, C1677 C1684. George-Weinstein, M., Foster, R.F., Gerhart, J.V., Kaufman, S.J., 1993. In vitro and in vivo expression of alpha 7 integrin and desmin dene the primary and secondary myogenic lineages. Dev. Biol. 156, 209 229. Gimble, J.M., Robinson, C.E., Wu, X., Kelly, K.A., Rodriguez, B.R., Kliewer, S.A., Lehmann, J.M., Morris, D.C., 1996. Peroxisome proliferator-activated receptorgamma activation by thiazolidinediones induces adipogenesis in bone marrow stromal cells. Mol. Pharmacol. 50, 1087 1094. Grimaldi, P.A., Teboul, L., Inadera, D., Gaillard, E., Amri, Z., 1997. Trans-differentiation of myoblasts to adipoblasts: triggering effects of fatty acids and thiazolidinediones. Prostaglandins Leukotrienes Essential Fatty Acids 57, 71 75. Grounds, M.D., Yablonka-Reuveni, Z., 1993. Molecular and cell biology of skeletal muscle regeneration. In: Partridge, T. (Ed.), Molecular and Cell Biology of Muscular Dystrophy. Chapman & Hall, London, pp. 210 256. Gussoni, E., Soneoka, Y., Strickland, C.D., Buzney, E.A., Khan, M.K., Flint, A.F., Kunkel, L.M., Mulligan, R.C., 1999. Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature 401, 390 394. Han, J., Hajjar, D.P., Tauras, J.M., Feng, J., Gotto, A.M., Nicholson, A.C., 2000. Transforming growth factor-b1 (TGF-b1) and TGF-b2 decrease expression of CD36, the type B scavenger receptor, through mitogen-activated protein kinase phosphorylation of peroxisome proliferatoractivated receptor-g. J. Biol. Chem. 275, 1241 1246. Holm, C., Kirchgessner, T.G., Svenson, K.L., Fredikson, G., Nilsson, S., Miller, C.G., Shively, J.E., Heinzmann, C., Sparkes, R.S., Mohandas, T., et al., 1988. Hormone-sensitive lipase: sequence, expresion, and chromosomal localization to 19 cent-q13.3. Science 241, 1503 1506. Hoppler, S., Brown, J.D., Moon, R.T., 1996. Expression of a dominant-negative Wnt blocks induction of MyoD in Xenopus embryos. Genes Dev. 10, 2805 2817. Hu, E., Tontonoz, P., Spiegelman, B.M., 1995. Transdifferentiation of myoblasts by the adipogenic transcription factors PPAR gamma and C/EBP alpha. Proc. Natl. Acad. Sci. USA 92, 9856 9860. Hu, E., Kim, J.B., Sarraf, P., Spiegelman, B.M., 1996. Inhibition of adipogenesis through MAP kinase-mediated phosphorylation of PPARgamma. Science 274, 2100 2103. Hughes, S.M., Taylor, J.M., Tapscott, S.J., Gurley, C.M., Carter, W.J., Peterson, C.A., 1993. Selective accumulation of MyoD and myogenin mRNAs in fast and slow adult skeletal muscle is controlled by innervation and hormones. Development 118, 1137 1147. Jackson, K.A., Mi, T., Goodell, M.A., 1999. Hematopoietic potential of stem cells isolated from murine skeletal muscle. Proc. Natl. Acad. Sci. USA 96, 14482 14486.

660

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661 Lowell, B.B., 1999. PPARgamma: an essential regulator of adipogenesis and modulator of fat cell function. Cell 99, 239 242. Mandrup, S., Lane, M.D., 1997. Regulating adipogenesis. J. Biol. Chem. 272, 5367 5370. Marsh, D.R., Criswell, D.S., Carson, J.A., Booth, F.W., 1997. Myogenic regulatory factors during regeneration of skeletal muscle in young, adult and old rats. J. Appl. Physiol. 83, 1270 1275. McGehee, R.E., Ron, D., Brasier, A.R., Habener, J.F., 1993. Differentiation-specic element: a cis-acting developmental switch required for the sustained transcriptional expression of the angiotensinogen gene during hormonal-induced differentiation of 3T3-L1 broblasts to adipocytes. Mol. Endocrinol. 7, 551 560. Moore, S.G., Dawson, K.L., 1990. Red and yellow marrow in the femur: age-related changes in appearance at MR imaging. Radiology 175, 219 223. Mukherjee, R., Jow, L., Croston, G.E., Paterniti, J.R., 1996. Identication,characterization,and tissue distribution of human peroxisome proliferator-activated receptor (PPAR) isoforms PPARgamma2 versus PPARgamma1 and activation with retinoid X receptor agonists and antagonists. J. Biol. Chem. 272, 8071 8076. Musaro, A., Cusella de Angelis, M.G., Germani, A., Ciccarelli, C., Molinaro, M., Zani, B.M., 1995. Enhanced expression of myogenic regulatory genes in aging skeletal muscle. Exp. Cell Res. 221, 241 248. Pahor, M., Kritchevsky, S., 1998. Research hypotheses on muscle wasting, aging, loss of function and disability. J. Nutr. Health Aging 2, 97 100. Patel, Y.M., Lane, M.D., 2000. Mitotic clonal expansion during preadipocyte differentiation: calpain-mediated turnover of p27. J. Biol. Chem. 275, 17653 17660. Rando, T.A., Blau, H.M., 1994. Primary mouse myoblast purication, characterization, and transplantation for cellmediated gene therapy. J. Cell Biol. 125, 1275 1287. Renault, V., Piron-Hamelin, G., Forestier, C., DiDonna, S., Decary, S., Hentati, F., Saillant, G., Butler-Browne, G.S., Mouly, V., 2000. Skeletal muscle regeneration and the mitotic clock. Exp. Gerontol. 35, 711 719. Ridgeway, A.G., Petropoulos, H., Wilton, S., Skerjanc, I.S., 2000. Wnt signaling regulates the function of MyoD and myogenin. J. Biol. Chem. 275, 32398 32405. Robey, P.G., Bianco, P., 1999. Cellular mechanisms of age-related bone loss. In: Rosen, C., Bilezikan, J.P. (Eds.), The Aging Skeleton. Academic Press, San Diego, CA Ref Type: Serial (Book, Monograph). Rosenblatt, J.D., Yong, D., Parry, D.J., 1994. Satellite cell activity is required for hypertrophy of overloaded adult rat muscle. Muscle Nerve 17, 608 613. Ross, S.E., Hemati, N., Longo, K.A., Bennett, C.N., Lucas, P.C., Erickson, R.L., MacDougald, O.A., 2000. Inhibition of adipogenisis by Wnt signaling. Science 289, 950 953. Sabourin, L.A., Rudnicki, M.A., 2000. The molecular regulation of myogenesis. Clin. Genet. 57, 16 25.

Jaiswal, R.K., Jaiswal, N., Bruder, S., Mbalaviele, G., Marshak, D.R., Pittengers, M.F., 2000. Adult human mesenchymal stem cell differentiation to the osteogenic or adipogenic lineage is regulated by mitogen-activated protein kinase. J. Biol. Chem. 275, 9645 9652. Jilka, R.L., Weinstein, R.S., Takahashi, K., Partt, A.M., Manolagas, S.C., 1996. Linkage of decreased bone mass with impaired osteoblastogenesis in a murine model of accelerated senescence. J. Clin. Invest. 97, 1732 1740. Johnson, S.E., Allen, R.E., 1993. Proliferating cell nuclear antigen (PCNA) is expressed in activated rat skeletal muscle satellite cells. J. Cell. Physiol. 154, 39 43. Kajkenova, O., Lecka-Czernik, B., Gubrij, I., Hauser, S.P., Takahashi, K., Partt, A.M., Jilka, R.L., Manolagas, S.C., Lipschitz, D.A., 1997. Increased adipogenesis and myelopoiesis in the bone marrow of SAMP6, a murine model of defective osteoblastogenesis and low turnover osteopenia. J. Bone Min. Res. 12, 1772 1779. Katagiri, T., Yamaguchi, A., Komaki, M.E.A., 1994. Bone morphogenetic protein-2 converts the differentiation pathway of C2C12 myoblasts into the osteoblast lineage. J. Cell Biol. 127, 1755 1766. Kikuchi, A., 2000. Regulation of b-catenin signaling in the Wnt pathway. Biochem. Biophys. Res. Comm. 268, 243 248. Kiyokawa, H., Richon, V.M., Rifkind, R.A., Marks, P.A., 1994. Supression of cyclin-dependent kinase 4 during induced differentiation of erythroleukemia cells. Mol. Cell Biol. 11, 7195 7203. Lapsys, N.M., Kriketos, A.D., Lim-Fraser, M., Poynten, A.M., Lowy, A., Furler, S.M., Chisholm, D.J., Cooney, G.J., 2000. Expression of genes involved in lipid metabolism correlate with peroxisome proliferator-activated receptor gamma expression in human skeletal muscle. J. Clin. Endocrinol. Metab. 85, 4293 4297. Lassar, A.B., Skapek, S.X., Novitch, B., 1994. Regulatory mechanisms that coordinate skeletal muscle differentiation and cell cycle withdrawal. Curr. Opin. Cell Biol. 6, 788 794. Lazennec, G., Canaple, L., Saugy, D., Wahli, W., 2000. Activation of peroxisome proliferator-activated receptors (PPARs) by their ligands and protein kinase A activators. Mol. Endocrinol. 14, 1962 1975. Lecka-Czernik, B., Gubril, I., Moerman, E.J., Kajkenova, O., Lipschitz, D.A., Manolagas, S.C., Jilka, R.L., 1999. Inhibition of Osf2/Cbfa1 expression and terminal osteobast differentiation by PPARgamma2. J. Cell Biochem. 74, 357371. Lee, J.Y., Qu-Petersen, Z., Cao, B., Kimura, S., Jankowski, R., Cummins, J., Usas, A., Gates, C., Robbins, P., Wernig, A., Huard, J., 2000. Clonal isolation of muscle-derived cells capable of enhancing muscle regeneration and bone healing. J. Cell Biol. 150, 1085 1100. Loftus, T.M., Lane, M.D., 1997. Modulating the transcriptional control of adipogenesis. Cur. Opin. Gen. Dev. 7, 603608.

J.M. Taylor-Jones et al. / Mechanisms of Ageing and De6elopment 123 (2002) 649661 Sarbassov, D.D., Peterson, C.A., 1998. Insulin receptor substrate-1 and phosphatidylinosital 3-kinase regulate extracellular signal-regulated kinase-dependent and -independent signaling pathways during myogenic differentiation. Mol. Endocrinol. 12, 1870 1878. Sarbassov, D.D., Stefanova, R., Grigoriev, V.G., Peterson, C.A., 1995. Role of insulin-like growth factors and myogenin in the altered program of proliferation and differentiation in NFB4 mutant muscle cell line. Proc. Natl. Acad. Sci. USA 92, 10874 10878. Schultz, E., Lipton, B.H., 1982. Skeletal muscle satellite cells: changes in proliferation potential as a function of age. Mech. Ageing Dev. 20, 377 383. Seale, P., Sabourin, L.A., Girgis-Gabardo, A., Mansouri, A., Gruss, P., Rudnicki, M.A., 2000. Pax7 is required for the specication of myogenic satellite cells. Cell 102, 777 786. Snow, M.H., 1977. The effect of aging on satellite cells is skeletal muscles of mice and rats. Cell Tissue Res. 185, 399 408. Teboul, L., Gaillard, D., Staccini, L., Inadera, H., Ez-Zoubir, A., Grimaldi, P.A., 1995. Thiazolidinediones and fatty

661

acids convert myogenic cells into adipose-like cells. J. Biol. Chem. 270, 28183 28187. Tontonoz, P., Hu, E., Graves, R.A., Budavari, A.I., Spiegelman, B.M., 1994a. mPPARg2: tissue specic regulator of an adipocyte enhancer. Genes Dev. 8, 1224 1234. Tontonoz, P., Hu, E., Spiegelman, B.M., 1994b. Stimulation of adipogenesis in broblasts by PPARg2, a lipid-activated transcription factor. Cell 79, 1147 1156. Webster, C., Blau, H.M., 1990. Accelerated age-related decline in replicative life-span of Duchenne muscular dystrophy myoblasts: implications for cell and gene therapy. Som. Cell Mol. Gen. 16, 557 565. Young, C.S., Kitamura, M., Hardy, S., Kitajewksi, J., 1998. Wnt-1 induces growth, cytosolic beta-catenin, and Tcf/Lef transcriptional activation in Rat-1 broblasts. Mol. Cell. Biol. 18, 2474 2485. Zhu, Y., Qi, C., Korenberg, J.R., Chen, X.N., Noya, D., Rao, M.S., Reddy, J.K., 1995. Structural organization of mouse peroxisome proliferator-activated receptor gamma(mPPAR) gene: alternative promoter use and different splicing yield two mPPARgamma isoforms. Proc. Natl. Acad. Sci. USA 92, 7921 7925.