Conservation Genetics 3: 441443, 2002. 2002 Kluwer Academic Publishers. Printed in the Netherlands.

441

Polymorphic microsatellite markers for blue mussels (Mytilus spp.)

Pablo Presa*, Montse P rez & Angel P. Diz e
University of Vigo, Faculty of Sciences, Department of Biochemistry, Genetics and Immunology, 36200 Vigo, Spain ( Author for correspondence: E-mail: pressa@uvigo.es; Fax: +34.986.812567)
Received 23 November 2001; accepted 4 February 2002

Key words: cross-species amplication, genetic conservation, microsatellites, Mytilus spp.

Blue mussels of the genus Mytilus (M. edulis Linnaeus 1758; M. galloprovincialis Lamarck 1819; M. trossulus Gould 1850) are widely distributed in Southern and Northern hemispheres. This ecological plasticity together with the existence of interspecic hybridization in overlapping regions (Skibinski et al. 1978) makes them an interesting model for studies of population dynamics in marine habitats. Genetic marker surveys on Mytilus spp. have shown the genetic uniqueness of each species (McDonald and Koehn 1988). Several molecular markers have been developed over the last three decades to describe genetic polymorphisms in mussels. However most of them have a number of disadvantages for use as population markers, relating to data interpretation, technical difculties, genotype discrimination, and restricted amount of polymorphism (Ohresser et al. 1997). In order to analyze intraspecic phenomena related to both natural genetic substructuring and anthropogenic changes, it is useful to develop highly informative markers, such as microsatellites. A partial genomic library was constructed with M. galloprovincialis DNA extracted from mantle tissue following a standard phenol:chloroform protocol (Sambrook et al. 1989). The DNA was digested with Mbo I and electrophoresed in preparative lowmelting agarose gels. Fragments between 200 and 700 bp were size-selected by reverse electrophoresis on a DEAE cellulose membrane and were recovered from the membrane using a standard salt method (Sambrook et al. 1989). Subsequent ligation into pUC18/BamHI and transformation in E.coli MRFKan Supercompetent Cells followed the instructions of the PCR-ScriptTM Amp SK(+) Cloning Kit (Stratagene). Recombinant colonies were transferred to positively charged nylon membranes (Innogenetics), incubated

at 37 C overnight in agar plates, ink-labeled, and plate-lter replicated. The library was screened independently with (TG)10, (TC)10, (GC)10 and (AT)10 oligonucleotide probes 3-end labelled with the DIGoligonucleotide Tailing Kit (Innogenetics). Replica lters were four-fold hybridized with 10 pmoles per probe both at 45 C and 55 C following the recommendations of the DIG-DNA Labelling and Detection Kit (Innogenetics). Positive recombinant pUC18 plasmids were sequenced on both strands with the BigDye Terminator method in an ABIprism 377 automatic DNA sequencer (Applied Biosystems). PCR primers were selected in the microsatellites anking regions with the programme Oligo 4.05 (Rychlik and Rhoads 1989). PCR amplication conditions for seven microsatellites on the three Mytilus species were determined using a Mastercycler Gradient thermocycler (Eppendorf). Approximately 1 L of total DNA extracted from mantle tissue, following a standard Chelex method, was used as template in a PCR reaction of 25 L. The concentrations of the reaction compounds were as follows: 0.5 U Taq Polymerase in 1X reaction buffer (Promega), 15 pmol of each primer, 100 M of each dNTP and MgCl2 ranging from 1.0 to 1.8 mM (Table 1). Amplication consisted of one cycle at 95 C for 5 min, followed by 35 cycles at the annealing temperature (Table 1) for 40 s, 72 C for 50 s and 95 C for 1 min followed by a nal extension step at 72 C for 15 min. The screening of polymorphisms was carried out on one mussel sample of each, M. galloprovincialis (Ria de Vigo, NW Spain), M. edulis (Dungarvan, SE Ireland) and M. trossulus (Hanko, S Finland). The PCR products were visualized in 2% agarose gels and electrophoresed in 6% acrylamide : bisacrylamide gels (19 : 1), followed by silver staining and gel xation

442
Table 1. Primer sequences, amplication characteristics, and gene diversity of seven microsatellite loci genotyped on n individuals of M. galloprovincialis. Observed heterozygosity (HO ) as well as allele richness (Rs , Petit et al. 1998) and the mean number of alleles per locus (Na ) were calculated with the programme FSTAT 2.9.3 (Goudet 1995). Fit of genotypic data to Hardy-Weinberg expectations were checked with the global probability test (Guo and Thompson 1992). The heterozygosity excess (*** = p < 0.001) Fis was computed with the U test of the programme GENEPOP Version 3.3 (Raymond and Rousset 1995) Locus (n) Mg1 (61) Mg2 (58) Mg3 (82) Mg4 (12) Mg5 (16) Mg6 (36) Mg7 (43) Repeat motif (TG)n . . . (AT)n (CT)n (TG)n (TG)n (TTTG)n (AAT)n (TA)n . . . (TG)n Forward and reverse primer sequences (53) ATCAGAATGGCAAAGAAAAA ACTATGATGGCTGAGAGGATA GGGATCGTTCAATAAGTTC AAATTTTACTGAATAAATAAATCG AAACTAAAAACTTCATCTAATCCC AAGCAATCCAAAGTGAGAGG CCTTACTATGCGTCGTTCAA TGACCAACACTCCAAAAATC ACTTCTCCGGTAACATAATA AGTCTTTCCCCTATGATGA GGGAAAGACTGCCTAACAAT CTCTTACATAGAAAATGGTTCG TAAGTTATTGATAGTTCGTTCC CAAAACCAGTGTCATACATAG Temp. ( C) 56 55 60 55 60 61 60 MgCl2 (mM) 1.4 1.8 1.8 1.0 1.2 1.0 1.0 Size (bp) 168208 84138 143151 91129 140158 214236 196230 Na Rs Ho Fis GenBank accession AF445370 AF445371 AF445372 AF445373 AF445374 AF445374 AF445375

11 13 5 10 8 6 14

3.46 3.34 2.04 3.50 2.98 3.15 3.25

0.55 0.65 0.64 0.75 0.69 0.81 0.67

0.40*** 0.26*** 0.18ns 0.07ns 0.14ns 0.04ns 0.21ns

(Promega). Allele sizes were characterized using a synthetic molecular ladder sequenced from the M13 phage. Seven primer pairs were screened following the conditions given in Table 1. All loci showed apparent co-dominance and were assumed to follow Mendelian inheritance. Estimators of intraspecic genetic diversity i.e. allele richness per locus (Rs sd = 3.11 0.50), observed heterozygosity (Ho sd = 0.66 0.11), and mean number of alleles per locus (Na sd = 9.57 3.41) are given in Table 1. Genotype frequencies conformed to Hardy-Weinberg expectations for ve loci and showed signicant heterozygote deciency for two loci (Table 1, p = 0.05 for the global distribution of Fis values, Wilcoxon signedrank test). A signicant excess of homozygotes has been commonly reported in bivalves (e.g. Volkaert and Zouros 1989), and may be related to factors such as recent admixture or selective forces on linked loci. Two out of 21 pairwise tests performed for linkage disequilibrium (Fishers exact test, GENEPOP 3.3) revealed a signicant association between the pairs of loci Mg5 Mg6 (P = 0.0079) and Mg1 Mg2 (P = 0.0047). The amplication of seven M. galloprovincialis microsatellites in M. edulis (Na sd = 5.57 1.72) and M. trossulus (Na sd = 5.14 2.48) (Table 2)

suggests a cross-species conservation of primer sequences and their potential application in other mussels for which other DNA markers have not been successfully amplied, such as M. coruscus (Inoue et al. 1995). The seven microsatellite primer pairs provided here represent the most powerful genetic tool available for management and conservation studies in Mytilus species. These microsatellites can be scored on early developmental stages, which are particularly ideal for monitoring the movement of larvae in wild or experimental populations (Manuel et al. 1996), and to assess the amount and partitioning of genetic diversity to dene conservation units within species (Waples 1991).

Acknowledgements This research was supported in part by the Xunta de Galicia Grant XUGA30102A98 and by the Spanish Ministerio de Ciencia y Tecnologa Grant BIO20013659. We thank Marta Vzquez for technical assistance in cloning and Risto Vinl for providing samples.

443
Table 2. Allele polymorphism and PCR conditions from cross-species amplication in the genus Mytilus using M. galloprovincialis microsatellite primers Locus Temp. ( C) Mg1 Mg2 Mg3 Mg4 Mg5 Mg6 Mg7 56 55 60 53 60 60 54 MgCl2 (mM) 1.4 1.8 1.8 1.1 1.1 1.1 1.1 Mytilus edulis Sample Allele size size (bp) 9 11 17 9 10 5 4 178184 8498 145151 91131 134150 220238 198218 Mytilus trossulus Sample Allele size size (bp) 9 13 22 9 22 11 2 176186 8688 145158 113131 136158 214232 198210

No. of alleles 8 3 4 7 6 6 5

Temp. ( C) 56 54 60 53 58 58 52

MgCl2 (mM) 1.4 1.8 1.8 1.1 1.3 1.3 1.1

No. of alleles 6 2 4 7 8 7 2

References
Goudet J (1995) FSTAT (vers. 2.9.3), a computer program to calculate F-statistics. J. Hered., 86, 485486. Guo SW, Thompson EA (1992) Performing the exact test of HardyWeinberg proportions for multiple alleles. Biometrics, 48, 361 372. Inoue K, Waite JH, Matsuoka M, Odo S, Harayama S (1995) Interspecic variation in adhesive protein sequences of Mytilus edulis, M. Galloprovincialis, and M. Trossulus. Biol. Bull., 189, 370375. Manuel JL, Burbridge S, Kenchington EL, Ball M, Odor RK (1996) Veligers from two populations of scallop Placopecten magellanicus exhibit different vertical distributions in the same mesocosm. J. Shellsh Res., 15, 251257. McDonald JH, Koehn RK (1988) The mussels Mytilus galloprovincialis and M. Trossulus on the Pacic coast of North America. Mar. Biol., 99, 111118. Ohresser M, Borsa P, Delsert C (1997) Intron-length polymorphism at the actin gene locus mac-1, a genetic marker for population studies in the marine mussels Mytilus galloprovincialis Lmk. and M. Edulis L. Mol. Mar. Biol. Biotechnol., 6, 123130.

Petit RJ, El Mousadik A, Pons O (1998) Identiying populations for conservation on the basis of genetic markers. Conserv. Biol., 12, 844855. Raymond M, Rousset F (1995) GENEPOP (version 3.3), population genetics software for exact tests and ecumenicism. J. Heredity, 86, 248249. Rychlik W, Rhoads RE (1989) A computer program for choosing optimal oligonucleotides for lter hybridization, sequencing and in vitro amplication of DNA. Nucleic Acids Res., 17, 8543 8551. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. A laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press, New York. Skibinski DOF, Ahmad M, Beardmore JA (1978) Genetic evidence for naturally occurring hybrids between Mytilus edulis and Mytilus galloprovincialis. Evolution, 32, 354364. Volckaert F, Zouros E (1989) Allozyme and physiological variation in the scallop Placopecten magellanicus and a general model for the effects of heterozygosity on tness in marine molluscs. Mar. Biol., 103, 5161. Waples RS (1991) Pacic salmon, Oncorhynchus spp., and the denition of species under the Endangered Species Act. Mar. Fish. Rev., 53, 1122.