ARTICLE IN PRESS

Systematic and Applied Microbiology 29 (2006) 145155 www.elsevier.de/syapm

Antibiotic susceptibility patterns and resistance genes of starter cultures and probiotic bacteria used in food
Sabine Kastnera, Vincent Perretenb, Helen Bleulera, Gabriel Hugenschmidta, Christophe Lacroixa, Leo Meilea,
Laboratory of Food Biotechnology, Institute of Food Science and Nutrition, Swiss Federal Institute of Technology (ETH), ETH-Zentrum, CH-8092 Zurich, Switzerland b Institute of Veterinary Bacteriology, University of Bern, CH-3012 Bern, Switzerland Received 13 July 2005
a

Abstract
A survey of starter and probiotic cultures was carried out to determine the current antibiotic resistance situation in microbial food additives in Switzerland. Two hundred isolates from 90 different sources were typed by molecular and other methods to belong to the genera Lactobacillus (74 samples), Staphylococcus (33 samples), Bidobacterium (6 samples), Pediococcus (5 samples), or were categorized as lactococci or streptococci (82 samples). They were screened for phenotypic resistances to 20 antibiotics by the disk diffusion method. Twenty-seven isolates exhibiting resistances that are not an intrinsic feature of the respective genera were further analyzed by microarray hybridization as a tool to trace back phenotypic resistances to specic genetic determinants. Their presence was nally veried by PCR amplication or Southern hybridization. These studies resulted in the detection of the tetracycline resistance gene tet(K) in 5 Staphylococcus isolates used as meat starter cultures, the tetracycline resistance gene tet(W) in the probiotic cultures Bidobacterium lactis DSM 10140 and Lactobacillus reuteri SD 2112 (residing on a plasmid), and the lincosamide resistance gene lnu(A) (formerly linA) in L. reuteri SD 2112. r 2005 Elsevier GmbH. All rights reserved.
Keywords: Starter culture; Antibiotic resistance gene; Probiotics; Food safety

Introduction
Antibiotic resistance in pathogenic bacteria has been an increasing medical problem for decades [29], but during the last few years, attention has been called to the fact that resistance determinants are widespread also among isolates from non-clinical settings. Staphylococci, but also enterococci and other lactic acid bacteria
Corresponding author. Tel.: +41 44 632 33 62; fax: +41 44 632 14 03. E-mail address: leo.meile@ilw.agrl.ethz.ch (L. Meile).

(LAB) which are omnipresent members of the intestinal ora have been isolated both from food and intestinal samples and were found to carry antibiotic resistance determinants [6,12,15,20,39]. These only occasionally opportunistic pathogenic genera are not generally the aim of antibiotic treatment. However, the extensive use of antibiotics for therapeutic and prophylactic purposes and for growth promotion in animal husbandry has led to a continuous selective pressure. Furthermore, acquired resistance determinants spread among different species and even genera which include potential and obligate pathogens [14,47]. This is especially favored in

0723-2020/$ - see front matter r 2005 Elsevier GmbH. All rights reserved. doi:10.1016/j.syapm.2005.07.009

ARTICLE IN PRESS
146 S. Kastner et al. / Systematic and Applied Microbiology 29 (2006) 145155

settings that allow the close association of densely packed microorganisms such as the intestine of humans and animals [42]. This raises the question of antibiotic resistances among desired foodborne bacteria such as starter and probiotic cultures. Unless eliminated from the nal product, they reach the consumers intestinal tract in high viable numbers, probiotics being specically designed for this purpose. Their safety should be veried not only with respect to virulence factors and other potential disease-causing traits [7], but also concerning their capability of acquiring and disseminating resistance determinants. In this context and regarding microbial feed additives, guidelines were set up in 2003 by the Scientic Committee on Animal Nutrition (SCAN) of the European Union. At the same place, similar regulations for microorganisms added to human foods were demanded (http://europa.eu.int/comm/food/ fs/sc/scan/out108_en.pdf) but not yet implemented. So far, antimicrobial susceptibility of cultures used for these purposes was addressed by several studies, mostly by examining phenotypes [23,45,46,52]. A genetic resistance analysis of two lactobacilli was also performed, but conned to three van genes [26]. The objective of the present study was a safety assessment of bacterial isolates from starter cultures and microbial food additives by combining phenotypic screening, microarray-based genome screening, and PCR. Testing of resistance phenotypes is useful for rough screenings and the detection of novel resistance determinants. However, it is always dependent on bacterial growth, does not distinguish between acquired and intrinsic resistances, and methods and breakpoints are not standardized for food isolates [21]. But genetic tools such as the simultaneous screening for many different prominent resistance genes by microarray hybridization [9,33,40,49,50] combined with PCR and gene sequencing provides reliable data on the presence of certain known antibiotic resistance genes. On the whole, this study sheds light on the current resistance situation in food-associated microorganisms in Switzerland and will provide a basis for further experiments concerning gene transferability.

Other sources were commercially available starter cultures and microbial additives for the milk and meat processing industry. These cultures as well as reference strains were kindly provided by different manufacturers or culture collections.

Isolation of bacteria from food and commercial starter culture mixtures

Pure state preparations of presumed starter or probiotic cultures were obtained as described by Miescher Schwenninger and Meile [32]. Serial dilutions of homogenized foodstuffs and commercial liquid or lyophilized cultures were followed by plating on selective solid media and nal incubation at 37 1C. Lactobacilli and pediococci were selected under anaerobic conditions on MRS agar plates containing MRS broth with Tween 80 (Biolife) and 1.5% agar (Difco). Bidobacteria were isolated on anaerobically incubated RB agar plates ([19], prepared without sodium caseinate and under aerobic conditions). Lactococci and streptococci were accumulated on M17 plates containing M17 broth (Biolife) and 1.5% (w/v) agar (Difco) under aerobic conditions. Finally, staphylococci were isolated aerobically on Baird-Parker agar plates (Biolife) supplemented with 5% (v/v) egg yolk tellurite emulsion (Biolife). Incubation time was 12 days for staphylococci and 23 days for all others. We considered colonies that were present in numbers of 105108/g food as belonging to either natural or industrially added starter cultures (Tables 1 and 2). Up to 6 morphologically distinct colonies per plate were selected and categorized as rods or cocci by light microscopy. They were subcultivated twice on the appropriate agar plates to obtain pure cultures. Liquid media used were MRS for lactobacilli and pediococci, BHI (Difco) for staphylococci, M17 for other cocci, and MRS supplemented with 0.05% (w/v) cysteine hydrochloride (Sigma) for bidobacteria. For storage, liquid over-night-cultures were frozen with 33% glycerol (Fluka) at 80 1C.

Materials and methods

Sources of bacterial isolates
To investigate antibiotic resistance determinants in the microbial ora of fermented ready-to-eat food, bacterial isolates were obtained from raw meat sausages and sour-milk products. Food samples were bought in various shops in Zurich (Switzerland) in months 4 and 5 of 2004 and served as one source of bacterial isolates.

Isolation of DNA
DNA for PCR and microarray hybridization was obtained by a lysis procedure of 3 single colonies at 60 1C using proteinase K and Tween 20 [40]. Alternatively, isolation with guanidium thiocyanate and extraction with phenolchloroform was applied [40]. For Southern transfer to nylon membranes followed by chemiluminescent hybridization, DNA was isolated according to Anderson and McKay [5].

ARTICLE IN PRESS
S. Kastner et al. / Systematic and Applied Microbiology 29 (2006) 145155 147

Table 1.

Origin of bacterial isolates and single strains Role or purpose of bacteria Isolation or propagation medium MRS M17 BP MRS M17 RB Number of isolates (n 200) 10 6 8 22 29 5 24 This study Reference

Source/strain

7 sausages (Salami and Salsiz type)

Meat starter culture

This study

27 sour milk products from 18 different Swiss trademarks

Sour milk starter culture or probiotic additive

This study

28 liquid preparations of single or mixed cultures, commercially available

27 cheese starter cultures

MRS

1 yoghurt starter culture 19 single or mixed cultures delivered as freeze-dried powder, commercially available Meat starter culture

M17 MRS M17 MRS

32 1 2 14

This study This study

M17 BP Bidobacterium lactis DSM 10140 Lactobacillus reuteri SD 2112 (ATCC 55730) Lactobacillus rhamnosus strain GG (ATCC 53103) Lactobacillus delbrueckii 10091 Lactobacillus plantarum Isolate Gb Lactobacillus sakei DSM 6333 Lactobacillus sp. Isolate 36 Lactobacillus sp. Isolate 42
a b

14 25 1 1 1 1 1 1 1 1 [30] [10] [17] ALPa M. Sievers, HSWb DSMZ M. Sievers, HSWb M. Sievers, HSWb

Probiotic strain Probiotic strain Probiotic strain Cheese starter strain Meat starter strain Meat starter strain Meat starter strain Meat starter strain

RB MRS MRS MRS MRS MRS MRS MRS

Agroscope Liebefeld-Posieux (CH). University of Applied Sciences Waedenswil (CH).

Table 2. Strain

Reference strains Characteristics Reference/origin [43] DSMZa DSMZa [15] ETH-Zb [36] [44] [44] [22] [38] [40] DSMZa

Bidobacterium longum NCC 2705 Lactobacillus delbrueckii ssp. lactis DSM 20072T Lactobacillus delbrueckii ssp. bulgaricus DSM 20081T Lactobacillus fermentum ROT 1 Lactobacillus reuteri strain 293 Lactococcus lactis ssp. lactis biovar. diacetylactis Bu2-60 Escherichia coli/pCSC1 Escherichia coli/pCSC3 Enterococcus faecalis JH2-2 Staphylococcus aureus RN 4220 Staphylococcus warneri Staphylococcus xylosus DSM 20266T
a b

Contains vatE on pLME300 Tetracycline sensitive Contains tet(W) on pCSC1 Contains tet(W) on pCSC3 Free of plasmids Contains tet(K) Contains lnu(A)

German Collection of Microorganisms and Cell Cultures, Braunschweig. ETH-Z Collection of Microorganisms of the Food Biotechnology Laboratory, ETH Zurich.

ARTICLE IN PRESS
148 S. Kastner et al. / Systematic and Applied Microbiology 29 (2006) 145155

E. faecalis JH2-2

S. xylosus DSM 20266

Positive control

L. lactis Bu2-60 280

95 1C for 30 s, 55 1C for 30 s, 72 1C for 1 min; 35 95 1C for 15 s, 56 1C for 30 s,

PCR cycles and conditionsa

35 62 1C for 30 s, 35 60 1C for 30 s, 72 1C 95 1C 72 1C 95 1C for for for for 30 s; 15 s, 30 s; 15 s,

Primer pair

ENT1 ENT2 sta640 rv

bak11 w lcc280 rv bak11 w lm3

tuf (Enterococcus)

Identication of bidobacteria by restriction analysis

16S rDNA fragments of bidobacteria amplied by PCR with primers lm26 and lm3 (Table 3) were puried using the GFX PCR DNA and gel band purication kit (Amersham Biosciences). Restriction analysis was performed with 400 ng DNA by the enzyme AluI

(Staphylococcus) 16S rDNA (Lactococcus) 16S rDNA

16S rDNA

(Bidobacterium)

Target gene

lm26

The 16S rDNA of 4 Staphylococcus isolates and 1 Pediococcus was amplied by PCR with primers bak4 (50 -AGGAGGTGATCCARCCGCA-30 , [14]) and bak11w (Table 3). Initial heating at 95 1C for 5 min was followed by 40 cycles of the following sequence: 95 1C for 15 s, 60 1C for 30 s, and 72 1C for 2 min. Final extension took place at 72 1C for 7 min. The amplied fragment was puried using the GFX PCR DNA and gel band purication kit (Amersham Biosciences) and sequenced by Microsynth, Balgach (Switzerland) with sequencing primers eub338 (50 -ACTCCTACGGGAGGCAGC-30 [3,18]) and uni1392r (50 -TGACGGGCGGTGTGTAC-30 [27]). Alignment by BioEdit software produced continuous sequences of almost 1000 base pairs which were compared to known 16S rDNA sequences in the NCBI database (http://www.ncbi.nlm. nih.gov/BLAST) and the Ribosomal Database Project (http://rdp.cme.msu.edu/html).

Initial heating was always performed at 95 1C for 5 min, nal elongation at 72 1C for 7 min.

Identication of cocci by partial sequencing of 16S rDNA

TACTGACAAACCATTCATGATG AACTTCGTCACCAACGCGAAC CCAGTCTTATAGGTAGGTTA

GATTCTGGCTCAGGATGAACG

AGTTTGATCMTGGCTCAG ATGTATCATCGCCTTGGT AGTTTGATCMTGGCTCAG CGGGTGCTICCCACTTTCATG

Sequence of primers 50 -30

72 1C for 2 min; 40

To identify coccal isolates at genus level, specic PCR assays were performed using primers presented in Table 3. The primer pair lcc280rv and bak11w represents a tool for the distinction of lactococci from staphylococci, lactobacilli, enterococci, and pediococci. With another PCR approach using primers sta640rv and bak11w, staphylococci was distinguished from the above-mentioned genera except for enterococci. Differentiation between staphylococci and enterococci was thus achieved by an additional PCR assay with Enterococcus-specic primers ENT1 and ENT2 which led to no amplication of staphylococcal DNA. Bidobacteria were identied by PCR amplication with primers lm3 and lm26 [24]. All PCRs were performed in a thermocycler equipped with heated lids (Personal Cycler, Biometra). Reaction volumes were 50 ml containing approximately 1050 ng of DNA, 50 pmol of each primer (Microsynth), 10 nmol of each deoxynucleotide, 2.5 U Taq-Polymerase and 1 Polymerase buffer (all Amersham Biosciences). Ten-microliter aliquots of the PCR products were visualized by agarose gel electrophoresis.

Reference

Amplicon length (bp)

This study

112

140

1417

[16] This study [16] [24]

[25]

B. lactis DSM 10140

Identication of cocci and bidobacteria at genus level by PCR

Table 3. Oligonucleotide primers for specic PCR amplication of the Enterococcus elongation factor EF-Tu gene tuf and the 16S rDNA of staphylococci, lactococci, and bidobacteria

ARTICLE IN PRESS
S. Kastner et al. / Systematic and Applied Microbiology 29 (2006) 145155 149

(Roche) and interpreted according to Germond et al. [13].

hybridization were created using a tet(W) PCR amplicon (Table 4) and DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche).

Identication of lactobacilli by API tests

Putative lactobacilli were identied at species level by the API 50 CH System and 50 CHL medium (bioMerieux). According to the manufacturers instructions, the following verications were performed prior to the assay that cultures were pure rods growing anaerobically on MRS medium, and did not react with H2O2 (indicating that they were catalase-negative). The API test was performed as suggested by the manufacturer and evaluated after 2 days of incubation at 37 1C with the identication software provided by bioMerieux.

Verication of antibiotic resistance genes by PCR and partial sequencing

The antibiotic resistance genes aph(2)-Id, lnu(A) (formerly linA), mefA, tet(K), vatC and vatE were amplied by PCR as outlined above and specied in Table 4. Amplication of the genes mefE, tet(W), and vanE was carried out according to references shown in Table 4, but with DNA obtained as described in this study. In addition, the lnu(A) 324 base pair amplicon from Lactobacillus reuteri SD 2112 was sequenced using BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA) and analyzed on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems). The sequences were edited using the program Sequencher (Genecode, Ann Arbor, MI).

Screening for phenotypic antibiotic resistances by disc diffusion tests

Antibiotic susceptibility of bacterial isolates was roughly determined by the disk diffusion method. Tests were performed with 20 discs (bioMerieux, Oxoid) containing the following concentrations of antibiotics: 30 mg cefotaxime, 2 mg clindamycin, 15 mg erythromycin, 300 mg nitrofurantoin, 5 mg ooxacin, 1 mg oxacillin, 10 mg penicillin G, 10 mg streptomycin, 30 mg tetracycline, 10 mg tobramycin, 30 mg vancomycin, 30 mg chloramphenicol, 10 mg fusidic acid, 120 mg gentamicin, 30 mg kanamycin, 15 mg lincomycin, 10 mg methicillin, 30 mg nalidixic acid, 30 mg novobiocin, and 5 mg rifampicin, respectively. Agar plates were inoculated and incubated according to NCCLS guidelines [35] for the application of E-tests. These guidelines were modied for lactococci and streptococci, where Mueller-Hinton agar was replaced by M17 agar. For bidobacteria, MRS agar supplemented with 0.05% (w/v) cysteine was used and incubated anaerobically. Inhibition zones were measured accurate to a millimeter and interpreted as suggested by Acar and Goldstein [1].

Results
Isolation and identication of bacteria
Presumptive starter and probiotic bacteria were isolated on selective media from 34 fermented foods and 47 commercial culture mixtures. This produced a total of 192 pure isolates in addition to 8 single strain cultures (Table 1). Lactobacilli and lactococci or streptococci (isolates on MRS and M17 medium), accounting for 161 pure cultures, were most abundant among isolates from all sources. Five milk products designated as probiotic also yielded Bidobacterium lactis strains whereas 4 sausages and 18 meat starter cultures additionally contained Staphylococcus and/or Pediococcus species as was determined by PCR and 16S rDNA sequencing. Table 5 shows 27 resistant isolates that were used for further experiments. In most cases, identied isolates belonged to the desired ora of fermented meat and milk products and complied with specications provided by the manufacturer. Only a minority of commercial cultures did not yield viable counts of the species indicated or contained additional cultures.

Microarray and membrane hybridization techniques

Bacterial isolates with clear/distinguishable phenotypic antibiotic resistance proles were screened for 90 different known antibiotic resistance genes on the microarray spotted with specic oligonucleotides (Clondiag), following the protocol recently described by Perreten et al. [40]. This involved randomly primed amplication of DNA followed by 2 subsequent polymerization reactions and enzymatic biotin-labeling, hybridization of labeled DNA onto the array, and data analysis using IconoClust software (Clondiag). DNA isolated from selected strains was transferred by Southern blotting onto nylon membranes. Probes for detection of the tet(W) gene by chemiluminescent

Phenotypic antibiotic resistances

Since there are no approved standards for testing phenotypic antibiotic susceptibility in most food isolates, we resorted to published guidelines using inhibition zone size of disk diffusion tests as an indication for the borderline between susceptible and resistant isolates [1]. Up to 15 phenotypic resistances were determined in

150

Table 4. Oligonucleotide primers for PCR detection of the aminoglycoside resistance gene aph(200 )-Id, the lincosamide resistance gene lnu(A), the macrolide efux genes mefA and mefE, the tetracycline resistance genes tet(K) and tet(W), the glycopeptide resistance gene vanE and the streptogramin A resistance genes vatC and vatE PCR cycles and conditionsa 641 323 1400 1191 348 168 513 392 490 Amplicon length (bp) Reference Positive control [48] [28] [34] [37] [14] [4] [11] [2] [51] E. faecalis DSM 12956 S. warneri S. salivarius Sp6 None S. aureus RN 4220 E. coli pCSC1 None None L. fermentum ROT 1

Target gene Primer pair Sequence of primers 50 -30

aph(200 )-Id

lnu(A)

MefA

MefE

tet(K)

ARTICLE IN PRESS

tet(W)

VanE

VatC

S. Kastner et al. / Systematic and Applied Microbiology 29 (2006) 145155

VatE

GMhl-Id-1 GMhl-Id-2 lina1 lina2 mefAfw mefArv mefE-f mefE-r TetK-FW1 TetK-RV2 tetW-FW tetW-RV VANE1 VANE2 vatc1 vatc2 satG1 satG2

GTGGTTTTTACAGGAATGCCATC CCCTCTTCATACCAATCCATATAACC GGTGGCTGGGGGGTAGATGTATTAACTGG GCTTCTTTTGAAATACATGGTATTTTTCGATC CTATGACAGCCTCAATGCG ACCGATTCTATCAGCAAAG ATGGAAAAATACAACAATTGGAAACGA TTATTTTAAATCTAATTTTCTAACCTC TTATGGTGGTTGTAGCTAGAAA AAAGGGTTAGAAACTCTTGAAA GAGAGCCTGCTATATGCCAGC GGGCGTATCCACAATGTTAAC TGTGGTATCGGAGCTGCAG GTCGATTCTCGCTAATCC GAAATGGTTGGGAGAAGCATACC CAGCAATCGCGCCCGTTTG CTATACCTGACGCAAATGC GGTTCAAATCTTGGTCCG

95 1C 72 1C 95 1C 60 1C 95 1C 72 1C 95 1C 72 1C 95 1C 72 1C 95 1C 72 1C 95 1C 72 1C 95 1C 72 1C 95 1C 72 1C

for for for for for for for for for for for for for for for for for for

1 min, 55 1C for 1 min, 2 min; 30 30 s, 55 1C for 30 s, 4 min; 25 40 s, 52 1C for 40 s, 2 min; 35 40 s, 52 1C for 40 s, 2 min; 35 1 min, 55 1C for 1 min, 2 min; 30 30 s, 64 1C for 30 s, 30 s; 30 30 s, 521C for 30 s, 3030 30 s, 64 1C for 30 s, 30 s; 30 40 s, 52 1C for 40 s, 1 min; 35

Initial heating was performed at 95 1C for 5 min (10 min for lnu(A)), nal elongation at 72 1C for 7 min.

Table 5.
Genus and species Phenotypic resistances (disk diffusion test)a Resistance genes detected by microchip hybridization None None None n.d. n.d. None n.d. n.d. n.d. None None None None None vanEc tet(K) tet(K) tet(K) tet(K) none none none tet(K) tet(K) tet(W) FDr Kr NAr FMr NNr OXr Sr VAr CTXr CCr FDr Kr MYr, b METr NAr FMr OFXr OXr Pr Sr TEr NNr VAr vanEc, vatEc, mefc tet(W), lnu(A) n.d. n.d. n.d. tet(W) tet(W) n.d. tet(W) tet(W) tet(W) n.d. n.d. n.d. n.d. n.d. None tet(K) tet(K) tet(K) None n.d. n.d. n.d. tet(K) tet(K) tet(W) none Tet(W), lnu(A) Resistance genes detected by PCR

Bacterial isolates and antibiotic resistances detected by disk diffusion tests, microchip hybridization and PCR

Origin of isolate, isolation medium

cfu/g food or culture preparation

Sausage (M17) Sausage (MRS) Sausage (MRS) Bidobacterium lactis Bidobacterium lactis n.d. Bidobacterium lactis Bidobacterium lactis Bidobacterium lactis n.d. Lactobacillus acidophilus Lactobacillus helveticus Lactobacillus helveticus Lactobacillus sp. Lactococcus sp. Staphylococcus xylosus Staphylococcus xylosus Staphylococcus xylosus Pediococcus pentosaceus Lactobacillus pentosus Staphylococcus sp. Staphylococcus sp. Staphylococcus xylosus Staphylococcus sp. Bidobacterium lactis Lactobacillus rhamnosus Lactobacillus reuteri

2 107 8.6 107 107 Lactococcus sp. Lactobacillus curvatus Lactobacillus curvatus

Yoghurt (RB) Yoghurt (RB) Yoghurt (M17) Yoghurt (RB) Yoghurt (RB) Soft cheese (RB) Vitaldrink (M17) Vitaldrink (M17) Cheese starter (MRS) Cheese starter (MRS) Cheese starter (MRS) Yoghurt starter (M17) Meat starter (BP) Meat starter (BP) Meat starter (BP) Meat starter (M17)

4 104 3 105 8 108 1.5 107 1.5 107 2 104 4 108 2 108 3 108 5 108 1.4 109 n.d. 2.8 109 7.5 109 7.5 107 2 1011

ARTICLE IN PRESS

Meat starter (MRS)

7.5 109

S. Kastner et al. / Systematic and Applied Microbiology 29 (2006) 145155

5.3 1010 2.2 1010 1010 9.7 109 n.d.

Cb FMr OFXr OXr RDr Sr TEr, b NNr VAr FDr Kr OFXr OXr Sr TEr NNr VAr CTXr FDr CNr Kr, b FMr, b OFXr OXr Sr TEr NNr VAr CNr Kr NAr OFXr Sr NNr TEr, d CNr Kr NAr OFXr Sr NNr TEr, d FDr Kr NAr Sr NNr CNr Kr NAr OFXr Sr NNr TEr, d CNr Kr NAr OFXr Sr NNr TEr, d CNr Kr NAr OFXr Sr NNr TEr, d FDr Kr NAr FMr OXr Sr NNr Kr NAr FMr Sr NNr FDr, b Kr, b FMr OFXr Sr TEr NNr FDr, b Kr FMr OFXr Sr TEr NNr FDr Kr FMr OXr Pr Sr NNr VAr Kr NAr FMr Sr NNr CTXr NAr Pr TEr NAr Pr TEr NAr Pr TEr CTXr CCr FMr OFXr OXr RDr TEr NNr VAr CCr Kr MYr OFXr OXr Pr Sr TEr, b NNr VAr CTXr CCr Er, b NAr Pr TEr, b VAr NAr Pr Sr VAr TEr NAr Pr TEr CNr Kr NAr OFXr Sr NNr TEr, d

Meat starter (BP) Meat starter (BP) Meat starter (M17) Meat starter (BP) Bidobacterium lactis DSM 10140 Lactobacillus rhamnosus strain GG (ATCC 53103) Lactobacillus reuteri SD 2112

n.d.

n.d.

Resistant. a CTX, cefotaxime; CC, clindamycin; E, erythromycin; FM, nitrofurantoin; OFX, ooxacin; OX, oxacillin; P, penicillin G; S, streptomycin; TE, tetracycline; NN, tobramycin; VA, vancomycin; C, chloramphenicol; FD, fusidic acid; CN, gentamicin; K, kanamycin; MY, lincomycin; MET, methicillin; NA, nalidixic acid; NV, novobiocin; RD, rifampicin. b No clear inhibition zone or only single colonies resistant. c Ambiguous hybridization results. d Conrmed by E-test [31].

151

ARTICLE IN PRESS
152 S. Kastner et al. / Systematic and Applied Microbiology 29 (2006) 145155

one strain (L. reuteri SD 2112, Table 5). The average number of phenotypic antibiotic resistances was 56 in lactobacilli (74 samples), 23 in staphylococci (33 samples), 67 in bidobacteria (6 samples, all belonging to the B. lactis species), 7 in pediococci (5 samples), and 3 in lactococci and streptococci (82 samples). This includes both types of resistances, intrinsic and acquired.

Antibiotic resistance genes

Twenty-seven isolates were selected exhibiting phenotypic resistances that are not a general feature of the respective genera. The DNA of these isolates was subjected to genetic screening for 90 known resistance genes by microarray hybridization. Clear positive signals, listed in Table 5, were produced by the tetracycline resistance genes tet(K) in 5 staphylococci and tet(W) in B. lactis DSM 10140 (Fig. 1) and L. reuteri SD 2112. Since we found no other tetracycline resistance genes in the latter strains by the microarray approach we assume that their tetracycline resistance phenotypes are caused by the tet(W) determinant. Gel electrophoresis and hybridization experiments with DNA isolated from L. reuteri SD 2112 originating from 2 different sources conrmed the presence of a stable plasmid (more than 10 kb in size) containing the tet(W) gene (Fig. 2). One strain had been obtained by the ATCC in the 1990s (Fig. 2, lane 3) whereas the other one was isolated from a commercial tablet in 2004 (Fig. 2, lane 4). Conjugation experiments by lter mating using L. reuteri SD 2112 as donor strain and E. faecalis JH2-2 (Table 2) and L. lactis Bu2-60 (Table 2) failed, so far, to show transferability of the tet(W) gene. DNA isolated from resistant strains was amplied by PCR with primers specic for the respective antibiotic resistance genes, and gel electrophoresis showed amplicons of the expected size that corresponded to those

Fig. 2. Southern hybridization analysis of DNA from Lactobacillus reuteri SD 2112 and L. reuteri strain 293. (a) 0.6% agarose gel stained with ethidium bromide. (b) Chemiluminescent detection of membrane-bound DNA that hybridized with a DIG-labeled probe of the tet(W) gene. Lanes: 1, cccDNA size standard; 2, L. reuteri strain 293; 3, L. reuteri SD 2112 (source: ATCC); 4, L. reuteri SD 2112 (source: commercial product); chr: chromosomal DNA.

amplied from positive control strains. After conrming the tet(W) gene in B. lactis DSM 10140 by PCR and by dot blot hybridization (data not shown), 5 B. lactis isolates from probiotic milk products were shown to yield the PCR amplicon similar in size to that of strain DSM 10140 and that of the approved tet(W)-positive reference strain E. coli/pCSC1 (Table 2). Also in L. reuteri SD 2112, the lincosamide resistance gene lnu(A) was detected. The sequence of the 324 base pair lnu(A) fragment amplied from L. reuteri SD 2112 turned out to be 96%identical to a stretch of the published linA sequence of Staphylococcus haemolyticus [8]. The DNA of some isolates produced (measured in 3 independent repetitions) weak and not well-dened signals when hybridized onto the microarray, so that the presence of the respective genes was doubtful. For example, this was the case for the genes vanE, vatE, and mef in a Lactobacillus and a Lactococcus strain. In these cases, no amplicon was obtained by PCR amplication with gene-specic primers.

Fig. 1. Microarrays hybridized with genomic DNA of (a) Bidobacterium lactis DSM 10140 and (b) Lactobacillus reuteri SD 2112. Spots 1 and 2: tet(W), 3 and 4: lnu(A), C: position control reaction. The layout of array (b) and the description of the genes were published by Perreten et al. [40]; (a) shows a follow-up model containing 4 reaction spots per gene.

Discussion
Reduced susceptibility to certain antibiotics is not an unusual feature of food isolated microorganisms

ARTICLE IN PRESS
S. Kastner et al. / Systematic and Applied Microbiology 29 (2006) 145155 153

including starter and probiotic cultures [12,23,46,52]. Many of these resistances are due to complex intrinsic features such as cell wall structure or metabolic properties. This is one reason that most phenotypic resistances detected in this study could not be traced back to specic genes by microarray hybridization. Besides, a resistance mechanism and the genes responsible may not be known or the respective probes are missing on the microarray. The microarray approach allowed however a more comprehensive study than methods focusing on single genes [26]. Uncertain results due to unspecic hybridization could be rejected or conrmed by additional assays. For example, the tetracycline resistance genes tet(K) and tet(W) and the lincosamide resistance gene lnu(A) could be detected and were conrmed by PCR amplication. The tet(W) gene was also be veried by Southern hybridization analysis of DNA isolated from L. reuteri SD 2112. The presence of these genes is not considered intrinsic, which is slightly alarming since they were found in commercially applied starters and probiotic cultures which are consumed at high dosages comparable to other resistant strains representing contaminants isolated from food (47). Such acquired resistances are probably consumed daily and therefore should be monitored most closely when observing the development of antibiotic resistance in commensal bacteria. The tet(K) gene codes for a tetracycline efux protein and was found in several Staphylococcus xylosus meat starter strains in this study; it has also already been located on a 4.4-kb plasmid in a food isolate of the same species [38]. The tet(W) gene mediates ribosomal protection against tetracycline. Over the last few years, it has been isolated from at least 17 new bacterial genera and is now considered to have the largest host range among the tetracycline resistance genes [41]. Its association with conjugative transposons [41] and its frequency among the intestinal and oral ora of humans and animals strongly suggest its transferability. This study detected the presence of tet(W) in B. lactis [30] and L. reuteri strain SD 2112 [10] which are derived from species which are inhabitants of the same microbiota as other tet(W)-bearing species. The gene lnu(A) or its homologues have rarely been detected after the original description of two variants linA and linA0 in staphylococci [8] where it can occur on plasmids [38]. In the present study, it was found for the rst time in a Lactobacillus isolate and was responsible for lincomycin and clindamycin resistance. To conclude, results from the present study suggest that bacterial strains isolated during the antibiotic era and later on established as starter or probiotic cultures might carry and possibly spread antibiotic resistance determinants. Older cultures established some decades ago may have had less contact with bacteria harboring

transferable antibiotic resistance determinants and have never been subjected to antibiotic pressure. This seems to be the case with the cultures distributed by the Swiss manufacturer ALP; 56 isolates from these cultures were virtually free of exceptional phenotypic resistances, and no known resistance genes were found by microarray hybridization. Research is only in the initial stages of understanding the mechanisms of antibiotic resistance transfer. However, results of the present study suggest that strains should be tested for the presence of transferable resistance genes before being used as commercial starters and probiotic cultures. The intestinal ora of man and animal may provide an excellent reservoir for these genes, and contaminations with fecal bacteria and the genes they carry might easily occur.

Acknowledgment
This study was supported by the Swiss National Science Foundation, National Research Program 49 (Antibiotic Resistance), Project No. 4049-63242.

References
[1] J.F. Acar, F.W. Goldstein, Disk susceptibility test, In: V. Lorian (Ed.), Antibiotics in Laboratory Medicine, third ed, Williams & Wilkins, Baltimore, Maryland (USA), 1991, pp. 1752. [2] J. Allignet, N. Liassine, N. El Solh, Characterization of a staphylococcal plasmid related to pUB110 and carrying two novel genes, vatC and vgbB, encoding resistance to streptogramins A and B and similar antibiotics, Antimicrob. Agents Chemother. 42 (1998) 17941798. [3] R.I. Amann, B.J. Binder, R.J. Olson, S.W. Chisholm, R. Devereux, D.A. Stahl, Combination of 16S rRNAtargeted oligonucleotide probes with ow cytometry for analyzing mixed microbial populations, Appl. Environ. Microbiol. 56 (1990) 19191925. [4] R.I. Aminov, N. Garrigues-Jeanjean, R.I. Mackie, Molecular ecology of tetracycline resistance: development and validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins, Appl. Environ. Microbiol. 67 (2001) 2232. [5] D.G. Anderson, L.L. McKay, Simple and rapid method for isolating large plasmid DNA from lactic streptococci, Appl. Environ. Microbiol. 46 (1983) 549552. [6] N. Ben Omar, A. Castro, R. Lucas, H. Abriouel, N.M.K. Yousif, C. Franz, W.H. Holzapfel, R. Perez-Pulido, M. Martinez-Canamero, A. Galvez, Functional and safety aspects of enterococci isolated from different Spanish foods, Syst. Appl. Microbiol. 27 (2004) 118130. [7] S.P. Borriello, W.P. Hammes, W. Holzapfel, P. Marteau, J. Schrezenmeir, M. Vaara, V. Valtonen, Safety of probiotics that contain lactobacilli or bidobacteria, Clin. Infect. Dis. 36 (2003) 775780.

ARTICLE IN PRESS
154 S. Kastner et al. / Systematic and Applied Microbiology 29 (2006) 145155

[8] A. Brisson-Noel, P. Courvalin, Nucleotide sequence of gene linA encoding resistance to lincosamides in Staphylococcus haemolyticus, Gene 43 (1986) 247253. [9] D.R. Call, M.K. Bakko, M.J. Krug, M.C. Roberts, Identifying antimicrobial resistance genes with DNA microarrays, Antimicrob. Agents Chemother. 47 (2003) 32903295. [10] I.A. Casas, F.W. Edens, W.J. Dobrogosz, Lactobacillus reuteri: an effective probiotic for poultry, other animals and humans, In: S. Salminen, A. von Wright (Eds.), Lactic Acid Bacteria, Marcel Dekker, New York, 1997, pp. 475518. [11] M. Fines, B. Perichon, P. Reynolds, D.F. Sahm, P. Courvalin, VanE, a new type of acquired glycopeptide resistance in Enterococcus faecalis BM4405, Antimicrob. Agents Chemother. 43 (1999) 21612164. [12] A.B. Florez, S. Delgado, B. Mayo, Antimicrobial susceptibility of lactic acid bacteria isolated from a cheese environment, Can. J. Microbiol. 51 (2005) 5158. [13] J.E. Germond, O. Mamin, B. Mollet, Species specic identication of nine human Bidobacterium spp. in feces, Syst. Appl. Microbiol. 25 (2002) 536543. [14] D. Gevers, G. Huys, J. Swings, In vitro conjugal transfer of tetracycline resistance from Lactobacillus isolates to other Gram-positive bacteria, FEMS Microbiol. Lett. 225 (2003) 125130. [15] K.Y. Gfeller, M. Roth, L. Meile, M. Teuber, Sequence and genetic organization of the 19.3-kb erythromycinand dalfopristin-resistance plasmid pLME300 from Lactobacillus fermentum ROT1, Plasmid 50 (2003) 190201. [16] D. Goldenberger, A. Kunzli, P. Vogt, R. Zbinden, M. Altwegg, Molecular diagnosis of bacterial endocarditis by broad-range PCR amplication and direct sequencing, J. Clin. Microbiol. 35 (1997) 27332739. [17] B.R. Goldin, S.L. Gorbach, M. Saxelin, S. Barakat, L. Gualtieri, S. Salminen, Survival of Lactobacillus species (strain GG) in human gastrointestinal tract, Dig. Dis. Sci. 37 (1992) 121128. [18] K. Greisen, M. Loeffelholz, A. Purohit, D. Leong, PCR primers and probes for the 16 s rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal uid, J. Clin. Microbiol. 32 (1994) 335351. [19] R. Hartemink, B.J. Kok, G.H. Weenk, F.M. Rombouts, Rafnose-Bidobacterium (RB) agar, a new selective medium for bidobacteria, J. Microbiol. Meth. 27 (1996) 3343. [20] G. Huys, K. DHaene, J.M. Collard, J. Swings, Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from food, Appl. Environ. Microbiol. 70 (2004) 15551562. [21] G. Huys, K. DHaene, J. Swings, Inuence of the culture medium on antibiotic susceptibility testing of foodassociated lactic acid bacteria with the agar overlay disc diffusion method, Lett. Appl. Microbiol. 34 (2002) 402406. [22] A.E. Jacob, S.J. Hobbs, Conjugal transfer of plasmidborne multiple antibiotic-resistance in Streptococcus faecalis var. zymogenes, J. Bacteriol. 117 (1974) 360372. [23] A.K. Katla, H. Kruse, G. Johnsen, H. Herikstad, Antimicrobial susceptibility of starter culture bacteria

[24]

[25]

[26]

[27]

[28]

[29] [30]

[31]

[32]

[33]

[34] [35]

[36]

[37]

used in Norwegian dairy products, Int. J. Food Microbiol. 67 (2001) 147152. P. Kaufmann, A. Pfefferkorn, M. Teuber, L. Meile, Identication and quantication of Bidobacterium species isolated from food with genus-specic 16S rRNAtargeted probes by colony hybridization and PCR, Appl. Environ. Microbiol. 63 (1997) 12681273. D.B. Ke, M. Boissinot, A. Huletsky, F.J. Picard, J. Frenette, M. Ouellette, P.H. Roy, M.G. Bergeron, Evidence for horizontal gene transfer in evolution of elongation factor Tu in enterococci, J. Bacteriol. 182 (2000) 69136920. G. Klein, C. Hallmann, I.A. Casas, J. Abad, J. Louwers, G. Reuter, Exclusion of vanA, vanB and vanC type glycopeptide resistance in strains of Lactobacillus reuteri and Lactobacillus rhamnosus used as probiotics by polymerase chain reaction and hybridization methods, J. Appl. Microbiol. 89 (2000) 815824. D.J. Lane, 16S/23S rRNA sequencing, In: E. Stackebrandt, M. Goodfellow (Eds.), Nucleic Acid Techniques in Bacterial Systematics, Wiley, New York, 1991, pp. 115176. G. Lina, A. Quaglia, M.E. Reverdy, R. Leclercq, F. Vandenesch, J. Etienne, Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci, Antimicrob. Agents Chemother. 43 (1999) 10621066. D. Mazel, J. Davies, Antibiotic resistance in microbes, Cell. Mol. Life Sci. 56 (1999) 742754. L. Meile, W. Ludwig, U. Rueger, C. Gut, P. Kaufmann, G. Dasen, S. Wenger, M. Teuber, Bidobacterium lactis sp. nov, a moderately oxygen tolerant species isolated from fermented milk, Syst. Appl. Microbiol. 20 (1997) 5764. L. Meile, B. Niederer, A. Baumann, S. Miescher Schwenninger, Mikroorganismen als Lebensmittelzusatze: Starterkulturen, Schutzkulturen und Probiotika, Mitt. Lebensm. Hyg. 96 (2005) 314. S. Miescher Schwenninger, L. Meile, A mixed culture of Propionibacterium jensenii and Lactobacillus paracasei subsp. paracasei inhibits food spoilage yeasts, Syst. Appl. Microbiol. 27 (2004) 229237. S. Monecke, I. Leube, R. Ehricht, Simple and robust array-based methods for the parallel detection of resistance genes of Staphylococcus aureus, Genome Lett. 2 (2003) 116128. P.R. Murray, Manual of Clinical Microbiology, ASM Press, Washington, DC, 1999. NCCLS, Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically, fourth ed, vol. 17, No. 2. Approved standard M7A4, fourth ed, vol. 17, No. 2, National Committee for Clinical Laboratory Standards (www.nccls.org), 1997. H. Neve, A. Geis, M. Teuber, Conjugal transfer and characterization of bacteriocin plasmids in group-N (lactic-acid) streptococci, J. Bacteriol. 157 (1984) 833838. T. Ono, S. Shiota, K. Hirota, K. Nemeto, T. Tsuchiya, Y. Miyake, Susceptibilities of oral and nasal isolates of Streptococcus mitis and Streptococcus oralis to macrolides

ARTICLE IN PRESS
S. Kastner et al. / Systematic and Applied Microbiology 29 (2006) 145155 155

[38]

[39]

[40]

[41] [42]

[43]

[44]

[45]

and PCR detection of resistance genes, Antimicrob. Agents Chemother. 44 (2000) 10781080. V. Perreten, N. Giampa, U. Schuler-Schmid, M. Teuber, Antibiotic resistance genes in coagulase-negative staphylococci isolated from food, Syst. Appl. Microbiol. 21 (1998) 113120. V. Perreten, F. Schwarz, L. Cresta, M. Boeglin, G. Dasen, M. Teuber, Antibiotic resistance spread in food, Nature 389 (1997) 801802. V. Perreten, L. Vorlet-Fawer, P. Slickers, R. Ehricht, P. Kuhnert, J. Frey, Microarray-based detection of 90 antibiotic resistance genes of Gram-positive bacteria, J. Clin. Microbiol. 43 (2005) 22912302. M.C. Roberts, Update on acquired tetracycline resistance genes, FEMS Microbiol. Lett. 245 (2005) 195203. A.A. Salyers, A. Gupta, Y. Wang, Human intestinal bacteria as reservoirs for antibiotic resistance genes, Trends Microbiol. 12 (2004) 412416. M.A. Schell, M. Karmirantzou, B. Snel, D. Vilanova, B. Berger, G. Pessi, M.C. Zwahlen, F. Desiere, P. Bork, M. Delley, R.D. Pridmore, F. Arigoni, The genome sequence of Bidobacterium longum reects its adaptation to the human gastrointestinal tract, Proc. Natl. Acad. Sci. USA 99 (2002) 1442214427. C. Schurch, Development of a novel DNA transforma tion system for bidobacteria, Dissertation No. 14676, Institute of Food Science and Nutrition, Laboratory of Food Microbiology, ETH, Zurich, 2002. T. Sozzi, M.B. Smiley, Antibiotic resistances of yogurt starter cultures Streptococcus thermophilus and Lactoba-

[46]

[47] [48]

[49]

[50]

[51]

[52]

cillus bulgaricus, Appl. Environ. Microbiol. 40 (1980) 862865. R. Temmerman, B. Pot, G. Huys, J. Swings, Identication and antibiotic susceptibility of bacterial isolates from probiotic products, Int. J. Food Microbiol. 81 (2003) 110. M. Teuber, Spread of antibiotic resistance with foodborne pathogens, Cell. Mol. Life Sci. 56 (1999) 755763. S.B. Vakulenko, S.M. Donabedian, A.M. Voskresenskiy, M.J. Zervos, S.A. Lerner, J.W. Chow, Multiplex PCR for detection of aminoglycoside resistance genes in enterococci, Antimicrob. Agents Chemother. 47 (2003) 14231426. A.H.A.M. van Hoek, I.M.J. Scholtens, A. Cloeckaert, H.J.M. Aarts, Detection of antibiotic resistance genes in different Salmonella serovars by oligonucleotide microarray analysis, J. Microbiol. Meth. 62 (2005) 1323. D. Volokhov, V. Chizhikov, K. Chumakov, A. Rasooly, Microarray analysis of erythromycin resistance determinants, J. Appl. Microbiol. 95 (2003) 787798. G. Werner, W. Witte, Characterization of a new enterococcal gene, satG, encoding a putative acetyltransferase conferring resistance to streptogramin A compounds, Antimicrob. Agents Chemother. 43 (1999) 18131814. J.S. Zhou, C.J. Pillidge, P.K. Gopal, H.S. Gill, Antibiotic susceptibility proles of new probiotic Lactobacillus and Bidobacterium strains, Int. J. Food Microbiol. 98 (2005) 211217.