Anda di halaman 1dari 8

LAPORAN PROYEK GENETIKA MOLEKULER MIKROBA

PROYEK ke-02: POLYMERASE CHAIN REACTION, ELEKTROFORESIS GEL AGAROSA DAN UJI AKURASI MIKROPIPET

Nama NIM

: Yahdini Qornin Mardiyah : 10409009

Kelompok : 06 Tanggal Percobaan : 22 September 2011 Tanggal Pengumpulan : 29 September 2011 Nama Asisten : Abian Adyasa Ananggadipa

PROGRAM STUDI MIKROBIOLOGI SEKOLAH ILMU DAN TEKNOLOGI HAYATI INSTITUT TEKNOLOGI BANDUNG 2011

1. PENDAHULUAN Polymerase chain reaction merupakan suatu teknik perbanyakan/amplifikasi potongan DNA secara in vitro pada daerah spesifik yang dibatasi oleh dua buah primer. Cara kerja PCR antara lain: 1. denaturasi DNA, yaitu pemutusan ikatan hydrogen antara basa nitrogen pada rantai DNA sehingga ds DNA terurai menjadi ss DNA. Terjadi pada suhu 90-95oC. 2. annealing, yaitu primer menuju daerah spesifik yang komplemen dengan urutan primer, lalu terbentuk ikatan H kemudian DNA polymerase pun berikatan. Terjadi pada suhu 54oC 3. elongasi, yaitu primer mengalami pemanjangan pada sisi 3 dengan penambahan dNTP yang komplemen dengan templat oleh DNA polymerase. Terjadi pada suhu 72 oC. (Vierstraete,1999) Hasil dari reaksi PCR dipisahkan menggunakan proses elektroforesis gel agarose. Elektroforesis gel agarosa merupakan metode untuk memisahkan molekul DNA berdasarkan ukuran molekulnya. Metode ini menggunakan aliran muatan karena DNA yang bermuatan negatif akan bergerak ke arah kutub positif. setelah terpisah berdasarkan ukurannya, DNA diwarnai oleh EtBr lalu diamati menggunakan laminar UV (Bowen, 2000). Dalam percobaan ini digunakan mikropipet untuk menakar dan memindahkan larutan dalam volume yang kecil. Ketepatan mikropipet dalam mengambil larutan sangat berpengaruh pada keberjalanan reaksi karena ketidak tepatan takaran bisa membuat reaksi tidak berjalan sebagaimana seharusnya. Oleh karena itu pengukuran akurasi dan presisi dibutuhkan untuk mengetahui kualitas alat mikropipet yang digunakan. 2. METODE KERJA 1. Polymerase chain Reaction Ke dalam tabung PCR dimasukkan 17.8L aquadeion, 2.5L buffer, 0.5L dNTPs, 0.6L SP6, 0.6L T7, 2.5L sampel DNA dan 0.5L Taq polymerase secara berturut-turut menggunakan mikropipet sehingga didapatkan larutan PCR dalam tabung Eppendorf. Bila ada rentang waktu sebelum dimasukkan ke dalam termocycle, tabung Eppendorf dimasukkan ke dalam box berisi es. Larutan PCR disentrifugasi menggunakan collection tube dengan kecepatan 7000 rpm, lalu dimasukkan ke dalam kolom pada termocycle. Setelah itu mesin termocycle diatur agar dilakukan 25 siklus dan diatur sesuai dengan suhu dan waktu yang ditentukan, yaitu: 950 2 940 30 64.5 45 000
Gambar 1: suhu dan waktu pada proses PCR

720 2

720 7 40

Setelah kerja mesin PCR selesai, tabung Eppendorf dipindahkan ke dalam box berisi es lalu dianalisis lebih lanjut menggunakan elektroforesis sel agarosa.

2. Elekroforesis Gel Agarosa Bahan gel agarosa ditambahkan TAE 1x sebanyak 100 mL, kemudian dididihkan hingga semua agarosa terlarut lalu didinginkan di dalam water bath suhu 55oC. Setelah itu agarosa dituangkan ke dalam cetakan yang sudah berisi comb sehingga terbentuk 11 sumur. Setelah gel agarosa mengeras, comb diangkat secara hati-hati agar tidak merusak gel. Kemudian gel diangkat dan dimasukkan ke dalam gel box , ditambahkan loading buffer, serta dipasangkan elektroda positif dan negatif. DNA hasil PCR ditambahkan 0.2mL loading buffer yang mengandung bromphenol blue, kemudian divortex dan diletakkan di dalam sumur gel menggunakan mikropipet. Pada gel terdapat 11 sumur yang terdiri dari hasil PCR kelompok 1-8 dan ladder. Setelah semua sumur terisi, alat elektroforesis dihubungkan dengan sumber listrik hingga loading buffer mencapai ujung gel. Kemudian gel direndam dengn EtBr dan diamati adanya pita yang terbentuk menggunakan illuminator UV. 3. Uji akurasi Mikropipet Lima buah tabung Effendorf kosong masing-masing ditimbang menggunakan neraca digital dan dicatat massanya. Kemudian dimasukkan 500 L gliserol menggunakan mikropipet. Setelah itu masing-masing tabung Effendorf berisi gliserol ditimbang lagi menggunakan neraca digital dan dicatat massanya. Lalu volume gliserol yang ditambahkan, persen error dan standar deviasinya dihitung. 3. HASIL DAN PEMBAHASAN Hasil dari setiap tahapan kerja, diperkuat dengan referensi yang diperlukan 1. Polymerase Chain Reaction dan Elektroforesis Gel Agarose Proses PCR diawali dengan membuat larutan PCR dengan komposisi sebagai berikut: (a) DNA template yang berisi fragmen target yang akan diamplifikasi. Pada percobaan ini kami mengunakan plasmid yang berupa vektor pGEMT-Easy (3015 bp) yang telah disisipi oleh fragmen sebesar 1300 bp. (b) Taq polimerase yaitu enzim yang melakukan penggandaan DNA seperti halnya proses replikasi DNA pada eukariot. Enzim ini diisolasi dari bakteri Thermus aquaticus yang bersifat thermofil sehingga enzim polymerasenya tidak terdenaturasi walaupun berada pada suhu tinggi. (c) Primer berupa oligonukleotida yang dapat menginisiasi reaksi penggandaan DNA dengan menempel pada fragmen DNA yang akan diamplifikasi. Pada percobaan ini kami menggunakan primer SP6 dan T7 sehingga didapatkan produk PCR sebesar 1300 bp karena memiliki daerah pengenalan di vektor pGEMT-Easy SP6 : ATTTAGGTGACACTATAGAATACTCAAGC (Tm : 60.90C) T7 : TGTAATACGACTCACTATAGGGCGA (Tm : 64.30C) (d) dNTP (deoxynucleoside triphosphate) : sebagai building blocks untuk penyusun DNA yang baru, yang tersusun atas dATP, dTTP, dGTP dan dCTP. (e) Buffer : menstabilkan DNA polimerase sehingga reaksi dapat berjalan optimum (f) air deion : untuk melarutkan larutan lain dan membuat volume menjadi 25L (Bloom,2011)

Setelah itu larutan PCR disentrifugasi pada collection tube dengan kecepatan 7000rpm agar tidak ada cairan yang menempel pada dinding tabung dan larutan tercampur rata menjadi homogen. Kemudian dimasukkan ke dalam kolom pada mesin PCR dan diatur suhu, waktu dan siklusnya sesuai dengan grafik di bawah ini: 940 2 940 30 580 45
Gambar 2: suhu dan waktu pada proses PCR

720 2

720 7 40

Hal yang terjadi pada PCR adalah sebagai berikut: awalnya tejadi pre-denaturasi pada suhu 940 C selama 2 menit untuk mengaktivasi enzim Taq polymerase,kemudian tahap denaturasi pada suhu 940 C selama 30 detik untuk mengurai dsDNA menjadi ssDNa. Setelah itu terjadi tahapan yang bersiklus selama 25 kali yaitu annealing pada suhu 580 C selama 45 detik lalu tahapan pre-elongasi pada suhu 720 C selama 2 menit dan terakhir tahap elongasi pada 720 C selama 7 menit. Kemudian terjadi penurunan suhu hingga suhu normal. Larutan hasil PCR harus disimpan pada suhu rendah agar enzim Taq polymerase tidak aktif mengkatalisis reaksi replikasi DNA (Davidson,2007). Proses yang terjadi pada reaksi PCR lebih jelasnya diterangkan pada gambar 3 yaitu awalnya DNA terdenaturasi, primer menempel pada masing-masing rantai DNA dan rantai DNA baru disintesis berdasarkan primer pada masing-masing template. Kemudian DNA terdenaturasi lagi dan primer menempel pada masing-masing DNA lalu mensintesis rantai DNA baru hingga terjadi 25 siklus. Hasil amplifikasi bagian DNA yang dinginkan mulai terbentuk ketika siklus ke 3 karena pada siklus pertama dan kedua masih terdapat bagian DNA lain selain yang diamplifikasi.

Gambar 3: proses yang terjadi pada proses PCR

Selanjutnya dilakukan elektroforesis gel agarose terhadap hasil reaksi PCR. Pada proses elektroforesis digunakan larutan TAE untuk melarutkan bahan gel agarosa. TAE merupakan buffer yang dapat menjaga kestabilan pH (Sambrook,1989). Pada percobaan ini kami membuat 11 sumur yang diisi oleh hasil PCR kelompok 1-8, dan ladder. Ladder merupakan pembanding berupa sampel DNA yang telah diketahui pasangan basanya, keterangannya dapat dilihat pada gambar 4. Larutan hasil PCR ditambahkan loading buffer yang mengandung bromphenol karena bromphenol merupakan pewarna yang menandakan DNA sudah mencapai ujung gel.
Gambar 4: keterangan 1kb ladder

Setelah alat elektroforesis dihubungkan dengan arus listrik, pada gel akan terbentuk kutub positif dan negatif, akibatnya DNA bergerak ke arah kutub positif karena pada pH netral DNA memiliki gugus phosphat (Bowen,2000). Pergerakan tersebut dapat dilihat dengan adanya warna biru yang berasal dari DNA yang diwarnai oleh bromphenol pada loading buffer. Setelah loading buffer mencapai ujung gel, arus listrik dimatikan lalu gel direndam oleh EtBr. EtBr merupakan pewarna flouresence yang dapat mewarnai asam nukelat, sehingga pengamatan hasil akhir elektroforesis harus dilihat dalam illuminator UV agar pendaran dari flourescence dapat terlihat. Pemakaian EtBr dilakukan di akhir untuk meminimalisasi kontak praktikan dengan larutan ini karena EtBr bersifat karsinogenik (Bowen, 2000) Proses PCR dan elektrolisis dilanjutkan dengan pengamatan menggunakan illuminator UV. Berikut ini adalah foto hasil pengamatan: 1 2 3 3 L 4 (-) 4 5 6 7 8

2500 bp 2000 bp 1500 bp 1000 bp

Gambar 5: foto hasil pengamatan menggunakan illuminator UV

Pada gambar 5 terlihat sebelas sumur dengan sumur berisi ladder dan hasil PCR kelompok satu sampai delapan. Hasil kelompok 6 terlihat bahwa pada sumur terdapat tiga pita, artinya terdapat tiga jenis fragmen DNA yang terpisahkan. Pita tersebut berada pada kisaran 2500 bp, antara 1000-1500 bp dan antara 500-1000bp. Pita paling

atas merupakan DNA yang fragmennya paling panjang, yaitu 2500 bp. Pita paling atas tersebut merupakan plasmid dCT, yang merupakan vektor pGEMT-Easy disisipi fragmen insert sebesar 1300bp. Secara diagramatis, pola fragmen insert tersebut adalah sebagai berikut :

Gambar 6: pola fragmen insert plasmid

Adanya pita kedua dan ketiga terjadi akibat adanya dua jenis fragmen DNA dengan jumlah pasang basa yang berbeda karena inisiasi replikasi DNA pada proses PCR dilakukan oleh promoter SP6 yang menempel pada suatu tempat pada plasmid sedangkan promoter T7 menempel pada dua daerah pada plasmid. Sehingga didapatkan dua jenis fragmen DNA yaitu 1300 bp dan 875 bp yang sesuai dengan foto kelompok 6 pada gambar 5. Pada elektroforesis gel agarosa, fragmen yang memiliki pasang basa lebih kecil akan mudah melewati celah-celah pada gel agarosa sehingga akan lebih cepat berada pada ujung gel. Pita yang berada di tengah memiliki lebar yang lebih tebal daripada pita lainnya, artinya fragmen tersebut merupakan fragmen yang paling banyak jumlahnya daripada fragmen lain. Pada percobaan ini kami memvariasikan suhu annealing pada proses PCR. Suhu annealing kelompok 6 adalah 580C. suhu ini lebih rendah dari suhu maksimal SP6 yaitu 60.90C dan T7 yaitu 64.30C dan lebih tinggi dari suhu annealing yang baku dipakai yaitu 54oC. Suhu annealing yang tidak sesuai dengan suhu optimum dapat mengakibatkan kemungkinan primer tidak menempel pada daerah yang tepat pada DNA akibatnya fragmen DNA yang diamplifikasi akan berbeda dengan yang diinginkan. Namun pada percobaan yang kami lakukan hasil fraemen DNA yang diamplifikasi sesuai dengan yang diinginkan karena primer menempel pada daerah yang sesuai dengan target amplifikasi. 2. Uji Kalibrasi Mikropipet Tabel Hasil Uji Kalibrasi untuk volume 500L gliserol (massa jenis= 1261kg/m3) menggunakan mikropipet 100-1000L

Tube 1 2 3 4 5

Berat kosong tube Berat tube + gliserol 0.99 1.58 0.99 1.53 0,98 1.83 0.99 1.83 0.99 1.88 Rata-rata volume gliserol

Volume gliserol (L) 467 436 674 666 703 589.2

Volume gliserol dihitung menggunakan rumus: = Nilai error: % Error = Standar deviasi: [ ]2 = 126.93 1 X - nilai sebenarnya 589.2 500 100% = 100% = 25.8% nilai sebenarnya 500

Standar deviasi =

Pada percobaan ini kami menggunakan mikropipet untuk mengambil sampel larutan dalam volume yang sangat kecil. Ketidaktepatan takaran dalam memasukkan larutan berpengaruh pada hasil reaksi secara keseluruhan. Oleh karena itu menentukan akurasi dan presisi dari mikropipet yang digunakan merupakan hal yang penting. Akurasi adalah seberapa dekat nilai sampel yang dihitung dengan standar sebenarnya, sedangkan presisi adalah kedekatan nilai dari sekelompok data dari pengukuran berulang yang identik dengan kuantitas yang sama. Perbedaan antara akurasi dan presisi dapat diperjelas oleh ilustrasi berikut:

Pada pengukuran akurasi kami menggunakan parameter persen error, sedangkan pengukuran presisi kami menggunakan parameter standar deviasi. Dari percobaan dan perhitungan yang kami lakukan, didapatkan bahwa persen error mikropipet yang digunakan adalah 25.6% sedangkan standar deviasinya 126.93.

Standar kelayakan mikropipet adalah sebagai berikut : Untuk akurasi : % ERROR <0.8%@375-1000 l, %error mikropipet= 25.6%, maka mikropipet yang digunakan tidak akurat karena nilai errornya lebih besar dari 0.8% Untuk presisi: STANDAR DEVIASI <1.3 l@1000 l, standar deviasi mikropipet= 126.93, maka mikropipet yang digunakan tidak presisi karena nilai standar deviasinya lebih besar dari 1.3 l
4. KESIMPULAN 1. Hasil PCR dan elektroforesis kelompok 6 menunjukkan hasil amplifikasi yang sesuai dengan yang diharapkan karena pada hasil elektroforesis terdapat fragmen DNA dengan 1300 bp dan 875 bp yang sesuai dengan primer SP6 dan T7 yang digunakan. 2. Hasil uji akurasi menunjukkan persen error mikropipet adalah 17.84 % dan standar deviasinya 161,42, sehingga dapat diketahui bahwa mikropipet yang kami gunakan tidak akurat dan presisi 5. REFERENSI Bloom,Mark V. 2011. PCR. http://www.accessexcellence.org/RC/CT/polymerase_chain_reaction.php diakses 28 september 2011 pukul11:11 Bowen, R.2000. Agarose Gel Electrophoresis of DNA. http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/agardna.html diakses 28 september 2011 pukul 11:27 Davidson, NC. 2007. How To Do PCR. http://www.bio.davidson.edu/courses/Molbio/Protocols/pcr.html diakses 28 september 2011 pukul 20:27 Sambrook, Fritsch, and Maniatis. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Volume 3. Cold Spring Harbor Laboratory Press: New York apendices B.11 and B.23 Vierstraete, Andy. 1999. Principle of PCR. http://users.ugent.be/~avierstr/principles/pcr.html diakses 28 september 2011 pukul 11:23