Anda di halaman 1dari 15

PRAKTIKUM BIOMOLEKULER ANALISIS DNA DNA merupakan suatu unit terkecil dari makhluk hidup yang merupakan pembawa

sifat keturunan. Analisa DNA banyak digunakan untuk karakterisasi sifat genetik pada level molekuler yang secara langsung mencerminkan sifat genotip (materi genetik) yang dimiliki oleh organisme tertentu. Analisis DNA ini terdiri dari tiga tahap yaitu ekstraksi DNA, PCR, dan elektroforesis. I. EKSTRAKSI DNA

Ekstraksi DNA memiliki prinsip memisahkan DNA kromosom atau DNA genom dari komponen-komponen sel lain. Sumber DNA bisa dari tanaman, kultur mikroorganise, atau sel manusia(Alves 2001). Ada tiga langkah utama dalam ekstraksi DNA, yaitu perusakan dinding sel (lisis), pemisahan DNA dari bahan padat seperti selulosa dan protein, serta pemurnian DNA (SURZYCKI, 2000). Prinsip kerja dari ekstraksi DNA / DNA Extraction
1. Preparasi sel/jaringan Darah yang digunakan leukositnya, eritrosit dilisiskan dan

dibuang. Secepatnya diekstraksi untuk mendapat hasil optimal,leukosit disimpan

sebaiknya pada suhu 4 derajat C, penyimpanan yang lama (> 1 bulan) akan menurunkan hasil ekstraksi, volume 3 5 ml whole blood. Jaringan yang diambil secepatnya diekstraksi. Penyimpanan jaringan pada suhu -80 derajat. Jaringan yang disimpan dalam paraffin blok sulit untuk diekstraksi.
2. Lisis membran sel/organella (nukleus) Senyawa yang digunakan untuk melisiskan

membran yaitu Phenol : senyawa yang sangat kuat untuk melisiskan membran, tetapi toksik. Selain itu digunakan Guanidine isothicyanate : tidak toksik, digunakan sebagai pengganti phenol
3. Denaturasi senyawa organik Untuk medenaturisasi protein yang ada digunakan

senyawa Kloroform : paling banyak digunakan karena prosedur sederhana, murah, mudah diperoleh. Selain kloroform juga digunakan Proteinase K untuk denaturasi protein tetapi perlu inkubasi .
4. Presipitasi DNA Digunakan senyawa Isopropanol dengan volume 1:1, atau Ethanol

absolut dan sodium asetat 1:10


5. Pencucian/washing Pencucian sisa senyawa mengunakan Ethanol 70%

Metode-metode yang digunakan dalam ekstraksi DNA


a. Phenol:chloroform

Mengunakan senyawa Phenol-choloroform-isoamyl alcohol, Metode standard untuk ekstraksi DNA, Akhir-akhir ini ditinggalkan, karena sifat toksik phenol b. Salting Out Menggunakan garam konsentrasi tinggi (NaCl 6 M), untuk medenaturisasi protein menggunakan Proteinase K untuk denaturasi protein c. Guanidine isothiocyanate Metode ini lebih cepat dibanding dua metode sebelumnya, Thiocyanate bersifat toksik, untuk lisis dinding sel , Memerlukan chloroform untuk denaturasi protein. d. Silica Gel Silica gel dapat mengikat DNA dengan perantaraan garam/buffer tertentu (NaI), Cepat, tetapi recovery DNA kurang. Pengukuran kualitas DNA Kualitas DNA yaitu utuh, tidak putus-putus, konsentrasinya tinggi dan tidak banyak terkontaminasi protein. Menentukan kualitas DNA dengan Spektrofotometer pada panjang gelombang 260 nm (protein 280 nm; DNA baik apabila pengukuran pada 260:280 = 1,7 1,9).

Satu OD = 50 ng DNA. Dilihat dengan elektroforesis, band yang tebal secara kualitatif menunjukkan DNA yang bagus Penyimpanan DNA DNA disimpan dalam TE buffer (tris-hydroxymethyl amino methanaEDTA), Disimpan 80 derajat bisa tahan bertahun-tahun. Untuk kerja, sebaiknya disiapkan DNA yang sudah diencerkan menjadi 100 ng/mikroliter. Freezing thawing berulang dapat meyebabkan kerusakan DNA.
II.

PCR (POLIMERASE CHAIN REACTION) A. Definisi PCR Polymerase chain reaction (PCR) adalah suatu proses pembentukan cetakan DNA secara berulang kali dengan menggunakan prosedur dan waktu yang tertentu (Wolfe1993: 137). PCR menggunakan teknik amplifikasi (perbanyakan) secara spesifik pada suatusegmen DNA secara in vitro dengan menggunakan DNA polimerase, cetakan (template), DNA genom, dan primer oligonukleotida yang akan menempel pada segmen yang akan diamplifikasi (Davis et al. 1994: 114). Prinsip dasar dari teknik PCR tersebut merupakan adanya enzim DNA polimerase yang digunakan untuk membuat cetakan dari segmen DNA yang diinginkan (Wolfe 1993: 137). Prinsip kerja PCR adalah menggandakan potongan DNA tertentu dari seluruh untaian DNA, baik yang berasal dari DNA sel inti (nukleus) maupun organel sel seperti DNA mitokondria (mtDNA) atau Ribosom (rDNA). Untuk mendapat potongan DNA, diperlukan Primer yang berfungsi untuk menandai dimana ujung DNA yang akan digandakan. Primer biasanya berpasangan, yaitu Primer forward untuk menandai ujung depan untai DNA dan Primer Reverse untuk menandai dari ujung belakang. Karena DNA terdiri dari 2 untai pilinanganda (double strand), maka DNA Primer forward bekerja pada strand yang satu sementara Primer Reverse bekerja pada untai pilinan yang satunya.

B. Komponen PCR Komponen PCR selain DNA template yang akan digandakan dan enzim DNA polymerase,komponen lain yang dibutuhkan adalah: a.Enzim DNA Polymerase Dalam sejarahnya, PCR dilakukan dengan menggunakan Klenow fragment DNA polymerase I selama reaksi polimerisasinya. Enzim ini ternyata tidak aktif secara termalselama proses denaturasi, sehingga harus menambahkan enzim di setiap siklusnya. Selain itu,enzim ini hanya bisa dipakai untuk perpanjangan 200 bp. Selain itu, oleh karena suhuannealing yang rendah dan extension yang hanya bisa dilakukan pada 37oC (suhu kerja Klenow fragment), hasilnya menjadi kurang spesifik. Untuk mengatasi kekurangan tersebut,dalam perkembangannya kemudian dipakai enzim Taq polymerase yang memiliki keaktifan dalam suhu tinggi. Oleh karenanya, penambahan enzim tidak perlu dilakukan di setiap siklusnya, dan proses PCR dapat dilakukan dalam satu mesin. Pemakaian Taq polymerase dalam konsentrasi yang terlalu besar akan mengakibatkan munculnya background produk non-spesifik. Sebaliknya, bila konsentrasi Taq polymerase terlalu rendah, maka proses amplifikasi berlangsung secara in-efisien, dan produk amplifikasi yang diperoleh akan mempunyai konsentrasi yang relatif rendah. b. Primer Primer adalah sepasang DNA utas tunggal atau oligonukleotida pendek yang menginisiasi sekaligus membatasi reaksi pemanjangan rantai atau polimerisasi DNA. Jadi jangan membayangkan kalau PCR mampu menggandakan seluruh DNA bakteri E. coli yang panjangnya kira-kira 3 juta bp itu. PCR hanya mampu menggandakan DNA pada daerah tertentu sepanjang maksimum 10000 bp saja, dan dengan teknik tertentu bisa sampai 40000 bp. Primer dirancang untuk memiliki sekuen yang komplemen dengan DNA template, jadi dirancang agar menempel mengapit daerah tertentu yang kita inginkan. c. d NTP(deoxynucleoside triphosphate) dNTP building blocks sebagai batu bata penyusun DNA yang baru. dNTP terdiri atas 4 macam sesuai dengan basa penyusun DNA, yaitu dATP, dCTP, dGTP dan dTTP. d.Buffer Buffer yang biasanya terdiri atas bahan-bahan kimia untuk mengkondisikan reaksi agar berjalan optimum dan menstabilkan enzim DNA polymerase e.Ion Logam

Ion logam bivalen, umumnya Mg++, fungsinya sebagai kofaktor bagi enzim DNA polymerase. Tanpa ion ini enzim DNA polymerase tidak dapat bekerja. Ion logam monovalen, kalsium (K+).
C. Siklus reaksi PCR

Siklus reaksi PCR terdiri atas tiga tahap, yaitu:


1. Tahap peleburan (melting) atau denaturasi. Pada tahap ini (berlangsung pada

suhu tinggi, 9496 C) ikatan hidrogen DNA terputus (denaturasi) dan DNA menjadi berberkas tunggal. Biasanya pada tahap awal PCR tahap ini dilakukan agak lama (sampai 5 menit) untuk memastikan semua berkas DNA terpisah. Pemisahan ini menyebabkan DNA tidak stabil dan siap menjadi templat ("patokan") bagi primer. Durasi tahap ini 12 menit. 2. Tahap penempelan atau annealing. Primer menempel pada bagian DNA templat yang komplementer urutan basanya. Ini dilakukan pada suhu antara 4560 C. Penempelan ini bersifat spesifik. Suhu yang tidak tepat menyebabkan tidak terjadinya penempelan atau primer menempel di sembarang tempat. Durasi tahap ini 12 menit.
3. Tahap pemanjangan atau elongasi. Suhu untuk proses ini tergantung dari jenis

DNA polimerase. Dengan Taq-polimerase, proses ini biasanya dilakukan pada suhu 76 C. Durasi tahap ini biasanya 1 menit. Lepas tahap 3, siklus diulang kembali mulai tahap 1. Akibat denaturasi dan renaturasi, beberapa berkas baru (berwarna hijau) menjadi templat bagi primer lain. Akhirnya terdapat berkas DNA yang panjangnya dibatasi oleh primer yang dipakai. Jumlah DNA yang dihasilkan berlimpah karena penambahan terjadi secara eksponensial (Prasetyoputri, 2005). .Berikut adalah gambar dari siklus tahapan PCR tersebut:

Selain ketiga proses tersebut biasanya PCR didahului dan diakhiri oleh tahapan berikut:
a. Pradenaturasi

Proses ini biasa dilakukan selama 1-9 menit di awal reaksi untuk memastikan kesempurnaan denaturasi dan mengaktifasi DNA Polymerase (jenis hot-start alias baru aktif kalau dipanaskan terlebih dahulu).
b. Final Elongasi

Biasanya dilakukan pada suhu optimum enzim (70-72oC) selama 5-15 menit untuk memastikan bahwa setiap utas tunggal yang tersisa sudah diperpanjang secara sempurna.Proses ini dilakukan setelah siklus PCR terakhir. PCR dilakukan dengan menggunakan mesin Thermal Cycler yang dapat menaikkan dan menurunkan suhu dalam waktu cepat sesuai kebutuhan siklus PCR. Pada awalnya orang menggunakan tiga penangas air (water bath) untuk melakukan denaturasi, annealing dan ekstensi secara manual, berpindah dari satu suhu ke suhu lainnya menggunakan tangan. D. Aplikasi PCR Aplikasi teknik PCR antara lain: a) Isolasi Gen DNA makhluk hidup memiliki ukuran yang sangat besar, DNA manusia saja panjangnya sekitar 3 miliar basa, dan di dalamnya mengandung ribuan gen. Fungsi utama DNA adalah sebagai sandi genetik, yaitu sebagai panduan sel dalam memproduksi protein, DNA ditranskrip menghasilkan RNA, RNA kemudian diterjemahkan untuk menghasilkan rantai asam amino protein. Berkat teknologi rekayasa genetik, gen penghasil insulin dari DNA genome manusiadapat diisolasi, lalu disisipkan ke sel bakteri (dalam hal ini E. coli) agar bakteri dapat memproduksi insulin. Hasilnya insulin yang sama persis dengan yang dihasilkan dalam tubuh manusia, dan sekarang insulin tinggal diekstrak dari bakteri, lebih cepat, mudah, dan tentunya lebih murah ketimbang cara konvensional yang harus mengorbankan sapi atau babi. Untuk mengisolasi gen, diperlukan DNA pencari atau dikenal dengan nama probe yang memiliki urutan basa nukleotida sama dengan gen yang kita inginkan. Probe ini bisa dibuat dengan teknik PCR menggunakan primer yang sesuai dengan gen tersebut.

b) DNA Sequencing

Urutan basa suatu DNA dapat ditentukan dengan teknik DNA Sequencing, metodeyang umum digunakan saat ini adalah metode Sanger (chain termination method) yang sudah dimodifikasi menggunakan dye-dideoxy terminator, dimana proses awalnya adalah reaksi PCR dengan pereaksi yang agak berbeda, yaitu hanya menggunakan satu primer (PCR biasa menggunakan 2 primer) dan adanya tambahan di deoxynucleotide yang dilabel fluorescent. Karena warna fluorescent untuk setiap basa berbeda, maka urutan basa suatu DNA yang tidak diketahui bisa ditentukan.
c) Forensik

Identifikasi seseorang yang terlibat kejahatan (baik pelaku maupun korban), atau korban kecelakaan/bencana kadang sulit dilakukan. Jika identifikasi secara fisik sulit atau tidak mungkin lagi dilakukan, maka pengujian DNA adalah pilihan yang tepat. DNA dapat diambil dari bagian tubuh manapun, kemudian dilakukan analisa PCR untuk mengamplifikasi bagian-bagian tertentu DNA yang disebut fingerprints alias DNA sidik jari, yaitu bagian yang unik bagi setiap orang. Hasilnya dibandingkan dengan DNA sidik jari keluarganya yang memiliki pertalian darah, misalnya ibu atau bapak kandung. Jika memiliki kecocokan yang sangat tinggi maka bisa dipastikan identitas orang yang dimaksud. Konon banyak kalangan tertentu yang memanfaatkan pengujian ini untuk menelusuri orang tua sesungguhnya dari seorang anak jika sang orang tua merasa ragu. d) Diagnosa Penyakit Penyakit Influenza A (H1N1) yang sebelumnya disebut flu babi sedang mewabah saat ini, bahkan satu fase lagi dari fase pandemi. Penyakit berbahaya seperti ini memerlukan diagnosa yang cepat dan akurat. PCR merupakan teknik yang sering digunakan. Teknologi saat ini memungkinkan diagnosa dalam hitungan jam dengan hasil akurat. Disebut akurat karena PCR mengamplifikasi daerah tertentu DNA yang merupakan ciri khas virus Influenza A (H1N1) yang tidak dimiliki oleh virus atau makhluk lainnya III. ELEKTROFORESIS Elektroforesis DNA merupakan teknik untuk memisahkan sampel DNA berdasarkan atas ukuran (berat molekul) dan struktur fisik molekulnya. Gel yang biasa digunakan antara lain

agarosa. Elektroforesis gel agarosa dapat dilakukan untuk memisahkan sampel DNA dengan ukuran dari beberapa ratus hingga 20.000 pasang basa (bp) (Dwidjoseputro 1998). Molekul DNA bermuatan negatif sehingga di dalam medan listrik akan bermigrasi melalui matriks gel menuju kutub positif (anode). Makin besar ukuran molekulnya, makin rendah laju migrasinya. Berat molekul suatu fragmen DNA dapat diperkirakan dengan membandingkan laju migrasinya dengan laju migrasi fragmen-fragmen molekul DNA standar (DNA marker) yang telah diketahui ukurannya. Visulisasi DNA selanjutnya dilakukan di bawah paparan sinar ultraviolet setelah terlebih dahulu gel dalam pembuatannya ditambahkan larutan etidium bromid. Cara lain untuk melihat visualisasi DNA adalah gel direndam di dalam larutan etidium bromid sebelum dipaparkan di atas sinar ultraviolet (Dwidjoseputro 1998). Teknik elektroforesis gel makin berkembang dan disempurnakan, hingga 12 tahun kemudian ditemukan gel poliakrilamida (PAGE = Polyacrilamide Gel Electrophoresis) yang terbentuk melalui proses polimerisasi akrilamida dan bis-akrilamida. PAGE ini sanggup memisahkan campuran DNA/RNA atau protein dengan ukuran lebih besar. Meskipun aplikasi elektroforesis makin berkembang luas, namun ternyata teknik ini masih menyerah jika digunakan untuk memisahkan DNA dengan ukuran yang super besar, misalnya DNA kromosom. Campuran DNA kromosom tidak dapat dipisahkan meskipun ukuran mereka berbeda-beda. Adapun prosedur kerja dalam melakukan elektroforesis DNA menggunakan teknik elektroforesis gel agarosa sebagai berikut : Bahan dan Alat 1. DNA marker, misalnya DNA yang dipotong dengan HindIII 2. Sampel DNA, misalnya : 3. DNA kromosom bakteri, 4. DNA plasmid hasil isolasi (uncut) 5. DNA plasmid hasil restriksi (cut)
6. Agarosa

7. Larutan buffer TAE 50x (242 g tris-base; 57,1 g asam asetat glacial; 100 ml EDTA 0,5 M pH 8; dilarutkan dalam akuades hingga 1000 ml) 8. Akuades 9. Gelas Ukur 1000 ml 10. Labu Erlenmeyer 50 ml

11. Tabung mikrosentrifuga 12. Sarung tangan 13. Seperangkat mikropipet beserta tipnya (Bio-Rad dan Axygen Scientific) 14. Kertas parafilm 15. seperangkat alat elektroforesis 16. Loading dye 6x (0,25% bromophenol blue; 0,25% xylene cyalol; 15% ficoll tipe 4000; EDTA 120 mM) 17. larutan Etidium Bromid (EtBr) 18. UV transluminator 19. Kaca mata UV
20. kamera digital

Cara Kerja
1. Buat 250 ml larutan buffer TAE 1x dengan cara mencamnpurkan 5 ml TAE 50x ke

dalam 245 ml akuades. 2. Buat gel agarosa 1% dengan cara menimbang agarosa 0,2 g untuk dilarutkan ke dalam bufer TAE 1x hingga volume 20 ml. Larutan agarosa dididihkan hingga larut sempurna. 3. Siapkan baki gel agarosa, lekatkan selotip di tiap ujung baki gel agarosa (pastikan bahwa selotip melekat kuat dan tidak ada lubang pada masing-masing ujung baki) 4. Pasang sisir elektroforesis di salah satu ujung baki gel agarosa dengan posisi hampir menyentuh dasar baki
5. Periksalah suhu larutan agarosa dengan cara menempelkan erlenmeyer ke tangan, jika

suhunya sudah turun hingga sekitar 50-60 0C, tambahkan 1 l etidium bromid (PERINGATAN KERAS!!, gunakan sarung tangan karena bersifat karsinogenik). 6. Larutan agarosa dihomogenkan sebentar, kemudian tuangkan larutan ke dalam baki gel agarosa, biarkan hingga larutan berubah menjadi gel yang padat. 7. ambil sisir dengan hati-hati, lepaskan selotip dari ujung-ujung baki. 8. masukkan baki yang telah berisi gel agarosa ke dalam tangki elektroforesis yang telah diisi dengan larutan bufer TAE 1x (pastikan bahwa gel terendam seluruhnya dalam TAE). 9. siapkan sekitar 5 cm kertas parafilm di dekat tangki elektroforesis. 10. masukkan 10 l sampel DNA dan 2 l loading dye 6x ke dalam sumuran gel agarosa dengan cara mencampurkan kedua bahan tersebut terlebih dahulu secara merata pada kertas parafilm menggunakan mikropipet.

11. buatlah catatan mengenai nomor sumuran dan jenis sampel DNA yang dimasukkan. 12. hubungkan kabel dari sumber arus ke tangki elektroforesis (pastikan bahwa kabel yang tersambung ke kutub negatif berada di dekat sumuran; jika tidak demikian, ubahlah posisi baki/gel ke arah sebaliknya). 13. nyalakan sumber arus, aturlah volatase dan waktu running hingga diperoleh angka 70 V dan 45 menit dengan cara menekan tombol yang sesuai pada sumber arus. 14. jalankan elektroforesis (lakukan running) dengan cara menekan tombol run pada sumber arus.
15. elektroforesis akan berhenti apabila waktu yang ditetapkan sudah habis, yang ditandai

oleh adanya bunyi alarm. Matikan sumber arus dan angkatlah baki dari tangki elektroforesis. 16. keluarkan gel dan letakkan di atas UV transluminator (letakkan selubung kaca hitam di atas UV transluminator). 17. nyalakan UV transluminator, amati pita-pita DNA yang tervisualisasi. Hasil Pita-pita DNA hasil elektroforesis dengan nomor sumuran dan jenis sampelnya. Perkirakan ukuran masing-masing fragmen/pita dengan membandingkannya dengan posisi migrasi pada DNA marker. Metode ini didasarkan pada pergerakan molekul bermuatan dalam media penyangga matriks stabil, di bawah pengaruh medan listrik. Media yang umum digunakan adalah sel agarosa atau poliakrilamid. Elektroforesis gel agarosa digunakan untuk memisahkan fragmen DNA yang berukuran lebih besar dari 100 pb dan dijalankan secara horizontal, sedangkan elektroforesis poliakrilamid dapat memisahkan 1 pb dan dijalankan secara vertical. Elektroforesis poliakrilamid biasanya digunakan untuk menentukan DNA (sekuensing). Larutan yang bermuatan negatif dimasukkan ke dalam sumur-sumur yang terdapat pada gel agarosa dan diletakkan di kutub negatif, apabila dialiri arus listrik dengan menggunakan larutan buffer yang sesuai maka DNA akan bergerak ke kutub positif. Laju migrasi DNA dalam medan listrik berbanding terbalik dengan massa DNA. Migrasi DNA terutama ditentukan oleh ukuran panjang dan bentuk DNA. Fragmen DNA yang berukuran kecil akan bermigrasi lebih cepat dibandingkan yang berukuran besar, sehingga elektroforesis mampu memisahkan fragmen DNA berdasarkan ukuran panjangnya. Untuk visualisasi maka ditambahkan larutan etidium bromida yang akan masuk diantara ikatan hydrogen pada DNA, sehingga pita fragmen

DNA akan kelihatan dibawah lammpu UV. Panjang amplikon bisa diperkirakan dengan membandingkannya dengan pita DNA standar. Karena pita-pita atau puncak-puncak protein terlalu rapat cenderung saling tumpahtindih, metode pemisahan satu dimensi, seperti elektroforesis gel poliakrilamida SDS atau kromatografi, hanya mampu menguraikan protein dalam jumlah yang relatif kecil (umumnya kurang dari 50). Sehingga digunakan elektroforesis gel dua dimensi yang menggabungkan dua prosedur pemisahan yang berbeda. metode ini dapat menguraikan lebih dari 1000 macam protein melalui pemetaan dua dimensi. 3. Pulse-Field Gel Electrophoresis (PFGE) Pertengahan 1980-an, Schwartz dan Cantor memberitahukan ide cerdasnya untuk memisahkan campuran DNA berukuran super besar menggunakan teknik yang dinamakan Pulse-field Gradient Gel Electrophoresis (PFGE), yang menggunakan pulsa-pulsa pendek medan listrik tegak lurus yang arahnya berganti-ganti. Teknik PFGE kini digunakan secara luas oleh para ahli biologi dalam studi genotyping berskala masif, juga analisa epidemiologi molekular pada patogen. Keempat teknik di atas merupakan pintu masuk bagi penelitian-penelitian lainnya dalam bidang biologi molekular yang kini berkembang sangat pesat. Sulit dibayangkan sebuah laboratorium biologi molekular dapat menghasilkan sesuatu tanpa teknik elektroforesis. Tanpa elektroforesis, DNA/RNA yang sedang kita teliti akan bercampur dengan kontaminan yang tidak kita inginkan, sulit pula membayangkan cara mengetahui ukuran DNA/RNA/protein yang lebih praktis selain dengan elektroforesis, bahkan teknik DNA sequencing modern sekalipun sangat bergantung pada teknik elektroforesis ini. Elektroforesis digunakan untuk meneliti DNA dalam berbagai bidang, misalnya : 1. Di bidang kepolisian teknik ini digunakan nuntuk pemeriksaan DNA, setiap orang memiliki karakteristik khusus, misalnya sidik jari. Sehingga membantu polisi dalam mengungkap sebuah kasus. 2. Dalam kegiatan biologi molekuler, elektroforesis merupakan salah satu cara untuk memvisualisasikan keberadaan DNA, plasmid, dan produk PCR. 3. Memudahkan identifikasi protein yang terdapat pada sebuah DNA. Sumber:

Modul Praktikum Biomolekuler FK Unsri 2012 http://id.shvoong.com/exact-sciences/bioengineering-and-biotechnology/2111537-ekstraksidna-dna-extraction/#ixzz1zXZTmF3m http://ml.scribd.com/doc/88146377/Elektroforesis-Gel-Agarosa http://nurulbio91.blogspot.com/2011/12/laporan-praktikum-genetika-mbi-013.html

TUGAS PRAKTIKUM

BIOINFORMATIKA

Disusun Oleh:
CLARA ADELIA WIJAYA
PDU REGULER 2011 NIM 04111001020

PENDIDIKAN DOKTER UMUM FAKULTAS KEDOKTERAN UNIVERSITAS SRIWIJAYA TAHUN 2012

Homo sapiens chromosome 10, GRCh37.p5

Primer3 Output
No mispriming library specified Using 1-based sequence positions OLIGO start len tm LEFT PRIMER 305 20 60.00 GTTGCTGAGGAGGTTGCTTC RIGHT PRIMER 490 20 59.93 ATGGATTGTGGCTTTCCAAG SEQUENCE SIZE: 1050 INCLUDED REGION SIZE: 1050

gc% 55.00 45.00

any 3.00 4.00

3' seq 1.00 3.00

PRODUCT SIZE: 186, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 2.00 1 GGGGAAGTTCCTAGAATAATGGGCGAAGAAAAGGAATGATATATTTCTAAAAGTTACTGA 61 ATTTAGCTAGCTAGCCCAAGAAAAGCCCATGTGTGCTATTCTTTATTGTGCAGAAAAATT 121 CGTTTCTGTCACCATTGTGTTATCATCAGATTAAGCTGTCGAGTCAGATGGATGCTGTGG 181 TTGTGCGGGGTGCGGGCCGATCAGCACACTCCCAGTGCCTCTGCAGGCCGTCAGCCTCCA 241 GCCCAGGCCAGCCTGAGAGGCAGGCGACGTGGGAAGGGAGGGGCTTCCCACCAGGACACA 301 GGAGGTTGCTGAGGAGGTTGCTTCCATGGTGCCACTTCTGAAATAAGAACTGTTCCTTGG >>>>>>>>>>>>>>>>>>>> 361 AAGGAATGCACAGGTTCTGAAGTTAGTGTTCTTAAAGTTCAACGTTATCTACCCTCTTGG 421 CCATAGTTGACCACCCTGTGGTCATCCTTGGCCCAGCAAGAGCACAGGCTCTTGGAAAGC <<<<<<<<<< 481 CACAATCCATGACCATATTCACAGCTGACCAACCATTTGCCAGGAGGCAGGACTTTCTGT <<<<<<<<<< 541 GCTAAAATGGGGATGTCCCAGGCAGACTGGGGTGGGTGGTCCCTGCCTCCCTCGGCTCTC 601 ATTCCAGGGTCCTCCTGGACATCACTGCTGTCACTTTGCCACTAGCTTGAGTCCACCTGG 661 GCCTTGAGGCAGAAGCAGTCGTTGAATTTTCTTTTTTTTTGGTTCTCCGGAAGCATGGGC 721 TTATAAGCCTTCCTGTTGTATTTTGCCATGAGTGTAATTAGAACATCTCCCAGAGCCTGG 781 GTCACTTCCCTTTAGCTGGACATGGCCCCCGCTGTCCTTGTCACATTTTTTGGATTGTTT

841 GTCACTCCAGAAAGCCTTCAGGGTCATGGTTCTCACTTCCTCAGACATTTTTCTCTTCTG 901 GGTGTGAGGATCTTTTGCTCATAAGACTTGCCTTCTTTGGGCCTGAGACGCTTCTCCCCC 961 AGCTGTGGAGATCATGACAGTTGCAGCAGACGGCTTCTTGGAAAGGTAGAAGGCTCTGGT 1021 GTTGGCTGAGGAGAAGCAGCTCCGTGGTCT KEYS (in order of precedence): >>>>>> left primer <<<<<< right primer ADDITIONAL OLIGOS start len tm gc% any 3' seq

1 LEFT PRIMER 305 20 60.00 55.00 3.00 1.00 GTTGCTGAGGAGGTTGCTTC RIGHT PRIMER 519 20 60.15 50.00 6.00 2.00 CAAATGGTTGGTCAGCTGTG PRODUCT SIZE: 215, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 1.00 2 LEFT PRIMER 356 20 60.11 50.00 4.00 2.00 CTTGGAAGGAATGCACAGGT RIGHT PRIMER 490 20 59.93 45.00 4.00 3.00 ATGGATTGTGGCTTTCCAAG PRODUCT SIZE: 135, PAIR ANY COMPL: 7.00, PAIR 3' COMPL: 2.00 3 LEFT PRIMER 300 20 60.25 55.00 3.00 0.00 AGGAGGTTGCTGAGGAGGTT RIGHT PRIMER 490 20 59.93 45.00 4.00 3.00 ATGGATTGTGGCTTTCCAAG PRODUCT SIZE: 191, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 1.00 4 LEFT PRIMER 305 20 60.00 55.00 3.00 1.00 GTTGCTGAGGAGGTTGCTTC RIGHT PRIMER 494 20 60.33 50.00 4.00 0.00 GGTCATGGATTGTGGCTTTC PRODUCT SIZE: 190, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 0.00 Statistics con too in in no tm tm high high high sid many tar excl bad GC too too any 3' poly end ered Ns get reg GC% clamp low high compl compl X stab ok Left 8186 0 0 0 117 0 2006 4110 5 7 46 131 1764 Right 8063 0 0 0 26 0 1765 4341 2 6 43 141 1739 Pair Stats: considered 290, unacceptable product size 261, high any compl 1, high end compl 13, ok 15 primer3 release 1.1.4