Anda di halaman 1dari 53

Gua para Principiantes de Biologa Molecular Aplicada a la Acuicultura

Karl Andree
IRTA Sant Carles de la Rapita

Investigant el present, apropant el futur www.irta.es

Introduccin
Estructura del ADN y Terminologa Metodologa Bsica
Clonacin / Secuenciacin Marcadores Gnica Deteccin Gnica
Southern / northern blots Microarray PCR y RFLP

Expresin Gnica
qPCR (PCR a tiempo real) northern blots

PCR: Cmo y Porqu Funciona


Diferentes sabores de PCR Componenets del cocktailde PCR Importancia de la Cuantificacin de ADN Higiene en el Laboratorio

X-ray Crystalography 1953 Single DNA Crystal 1990s Scanning Tunneling Microscopy 2003

DNArt

Detalle de una litografa de Salvador Dal- 1960s

Pster del Festival de Cine de Los Angeles 2007

x 147 = 587!!!

Estructura del ADN


Hlice alfa de doble cadena en configuracin antiparalela.
3

5 5

Estructura del ADN


Extremo 5 - grupo fosfato Extremo 3 - grupo hidroxilo
Necesario para la extensin de la molcula de ADN.

Puentes de H en forma de cremallera


Las dos hebras se mantienen unidas por puentes de H. T/A = 2 enlaces G/C = 3 enlaces

Purinas: Adenina, Guanina


Anillo doble

Pirimidinas: Citosina, Timina


Anillo sencillo

Terminologa Bsica
Coding Strand (sentido) - la secuencia se muestra de izquierda a derecha de 5a 3 Non-coding Strand (antisentido) - la secuencia normalmente se representa de izquiera a derecha de 3 a 5, aunque puede mostrarse en sentido contrario
El ARNm se copia a partir de esta cadena de forma que la secuencia final del ARNm es la misma que la de la cadena codificante El ADNc se sintetiza a partir del ARNm, usando transcriptasa inversa, por tanto es un duplicado de la cadena no codificante 5- CAATGATGGTATGGAATTCCTGCAGGGGCCCTAG -3 3- GTTAC TACCATACCTTAAGGACGTCCCCGGGATC -5

Reverse Complement Strand (o Complement Strand) es la secuencia opuesta que se aparea a la cadena de referencia, mientras que la Reverse Strand es la misma secuencia que la cadena de referencia escrita con la polaridad opuesta
5- CTAGGGCCCCTGCAGGAATTCCATACCATCATTG -3

Taxonomy/Phylogeny
Collect Sequences from GenBank or EMBL
Do Computer Alignment of Sequences Design primers for YFG from consensus of alignment PCR Amplification of YFG Clone PCR products Sequence clones Edit sequences and add to alignment Phylogenetic Analysis Analyze & Compare Sequences to identify mutations, etc Design primers or probes Test primers/probes

Gene Detection/Expression
Collect Biological Samples
Extract DNA or RNA

Write Results Publish / Present Data


Become Rich & Famous!

BioInformatics Consortium: Design microarrays, Create transgenic animals, Whole genome comparisons, Etc...
Archive samples for later testing

Create Assay for Testing Hypothesis (Q-PCR, ISH, Microarray, etc)

Write Results Publish / Present Data

Clon
Def.: - una clula, producto celular u organismo que es genticamente idntico a la unidad o individuo del que procede. Los clones se pueden guardar en genotecas que representan la totalidad o una fraccin del genoma de un organismo. Las tcnicas de PCR o DNA splicing son mtodos para el aislamiento de fragmentos especficos de ADN clonado. Los plsmidos, los virus, y cromosomas artificiales (YACs, BACs) se usan como vectores para la duplicacin de ADN clonado y para asegurar un archivo estable de la secuencia. DNA splicing (mediante enzimas de restriccin) es un mtodo comn para la insercin de ADN clonado en un vector. tambin los vectores TA, basados en la actividad polimerasa no especfica de la polimerasa de ADN Taq, son comunes.

Enzimas de Restriccin
Aisladas a partir de bacterias que las usan como una forma de sistema inmunolgico molecular para destruir ADN vrico
El Premio Nobel de Medicina de 1978 fu concedido por su descubrimiento Inici la poca del ADN recombinante (la R en RFLP)

El nombre de cada enzima proviene del de la bacteria a partir de la que se aisla (ej. Sex AI Streptomyces exfoliata) Las enzimas ms comunes en biologa molecular son las que reconocen secuencias de nucletidos palindrmicas de 4-6 pb 5-G AATTC (ej. Eco RI 3-CTTAA G- 3 ) - 5 Cada enzima slo corta en su sitio de reconocimiento especfico
Restriction Fragment Length Polymorphism ..ms despus

Felicidades! Ya Tienes Clones!


Despus de la clonacin Secuenciacin La secuencia de ADN se puede emplear para:
Localizar regiones de ADN distintivas tales como: Secuencias microsatlite SNPs (single nucleotide polymorphisms) Sitios de restriccin or identificar YFG - Todo ello es til para disear sondas / cebadores (primers) para northern blots, southern blots, PCR o microarrays

Bibliotecas de Genes y Secuencias de ADN


Diferentes tipos de genotecas de ADN
genoteca genmica muchos clones, cada uno contiene un fragmento de ADN genmico de un organismo genoteca de cDNAADN complementario derivado de ARN
genoteca EST expressed sequence tag, a partir de una genoteca de cDNA

genoteca de microsatlites (ms despus.)

La secuenciacin puede ser de una cadena o de doble cadena


Secuencia consenso - Se secuencian ambas cadenas y el consenso consiste en aquellas bases que se leen por igual en ambas cadenas ESTs son ejemplos de lectura de una sola cadena CDS (coding sequence) ADN transcrito a proteina ORF (open reading frame) igual a CDS pero incluye porciones del gen que no son traducidas

Secuenciacin de ADN
Las secuencias de 5 ADN son generadas por mquinas
Las mquinas tambin cometen errores Lee ambas cadenas y comprueba visualmente tus datos! 3

Filogenia y Secuenciacin de ADN


Identificar la secuencia BLAST GenBank del NCBI
(Basic Local Alignment Search Tool) Usa la secuencia consenso

Alinear la secuencia - Clustal W Corregir manualmente


transicin vs. transversin Huecos extras

Anlisis Filogenticos
Neighbor Joining Maximum Parsimony Maximum Likelihood Bayesian Method

Alineamiento de Secuencias
Las secuencias consenso se analizan en un editor de alineamientos Todas las secuencias se alinean mecnicamente y se editan manualmente
BioEdit y otros freeware contienen Clustal W para alineamientos mecnicos hand alignments, o edicin manual, necesarios para la revisin de transversiones y transiciones con el fin de corregir los errores de alineamiento producidos por la mquina

I. Deteccin de Genes
Southern Blot & Northern Blot
Hoy qPCR prcticamente ha reemplazado a los northern blots

Microarray
puede detectar diferencias grandes de expresin gnica entre muestras a baja resolucin a menudo se usa para identificar genes de inters para experimentos de alta resolucin o estudios de expresin gnica con qPCR

PCR y Marcadores de Genes


muchos tipos: anidada (nested), RT (reverse transcription), cuantitativa (qPCR), inversa, etc Puede estar seguida por anlisis RFLP, secuenciacin o trasnferencia (blotting)

Southern y Northern Blots


Southern - ADN (Edwin Southern:1975) northern - ARN Ambos mtodos:
separacin electrofortica transferencia mediante absorcin a una membrana cargada para blotting Hibridacin de sonda marcada para la deteccin de YFG

Hibridacin In Situ (ISH)


Emplea tejidos enteros en lugar de cidos nucleicos separados en un gel

Microarrays - DNA Chips


Matrices de alta densidad para genoma completo
Dos matrices (chips) son suficientes para el genoma humano (70,000 ESTs /chip)

Usados para la identificacin de genes que se expresan de forma diferente Caro de desarrollar porque requiere:
Equipo especializado Conocimiento previo sobre todo el genoma, o una genoteca de ADNc completa

Diseo Experimental del Microarray


Purificacin del ARN de cada poblacin celular o grupo de tratamiento Obtencin de ADNc mediante transcripcin inversa usando marcaje fluorescente Hibridacin al chip que contiene 70,000 fragmentos de genes Inspeccin mediante excitacin por lser de tags fluorescentes y una cmara CCD de alta resolucin Anlisis asistido por ordenador de los resultados (eg: Bio-LIMS)
Biological Laboratory Information Management System

ADN Microsatlite
Secuencias de ADN altamente repetitivas descubiertas usando curvas Cot (Britten & Davidson 1960s)
Romper el ADN en fragmentos de 400 - 500 pb Calentar el ADN para desnaturalizarlo y obtener cadenas sencillas Enfriar lentamente y tomar muestras a distintos tiempos

Slo una inflexin en una curva Cot creada con ADN bacteriano no microsatlites! Debido a la alta incidencia de mutacin y la mutltiplicidad de los alelos

Mecanismo para la Diversificacin de Alelos: Slip-strand Mispairing


Antes: 9 copias
5 CAGCAGCAGCAGCAGCAGCAGCAGCAG 3 3 GTCGTCGTCG TCGTCG TCGTC GTCGTC 5

Despus: 13 copias
5 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG 3 3 GTCGTCGTCG TCGTCG TCGTC GTCGTC GTCGTCGTC GTC 5

Microsatlites
tambin llamados Simple Sequence Repeats (SSRs) o Variable Number Tandem Repeats (VNTRs), son loci polimrficos presentes en ADN nuclear y organelar que consisten en unidades repetidas de 1-4 pares de bases de longitud debido a la alta incidencia de mutacin y la mutltiplicidad de los alelos son tiles para realizar comparaciones genticas intra-especies de alta precisin los ensayos pueden resultar caros de desarrollar si no se conoce la sccuencia genmica constituyen una herramienta relativamente barata de usar para estudios de poblaciones o de paternidad Son tiles como marcadores en Quantitative Trait Loci (QTL) para reproduccin selectiva Forward Primer
0 - GAATTCCGGGGTCCTTCCCAGACACGTGTGTGTGTGTGAGTGTGTGTGTG -50 51- TGTGAGTGTGGTGGTTTGCCTTATTCAGTGGTGCCACTCCATCATGCGAG -100

Reverse Primer

Alelos Microsatlite
el tamao de los alelos es normalmente pequeo: 50500 pb la existencia de un nmero alto de alelos hace que sean muy tiles en estudios de poblaciones la tcnica analtica se basa en PCR fcilmente adaptable a la mayora de laboratorios, tambin puede ser subcontratada a travs de diversas compaias de biotecnologa

Repeat No.

primer A

primer B

6 9 5 7
1

9 7
2

6 7
3

6 5

Simple Sequence Repeat en Vibrio vulnificus Aislado de Ostras de la Baha Alfaques


El biotipo 1 de V. vulnificus se divide en los genotipos Clinical y Environmental Un SSR aparece al final de una regin genmica asociada con virulencia Existe una correlacin entre el bajo nmero de copias del SSR y el genotipo clinical La primera copia del SSR en todos los genotipos clinical es imperfecta sin dos bases Existe algn tipo de presin slectiva para conservar la repeticin imperfecta en las cepas clinical, aun cuando el nmero de copias cambia con el paso de generaciones SSR = (AGCGAGA) x n E- type C- type

Las secuencias gnicas pueden ser inferidas mediante el uso de enzimas de restriccin y sus secuencias de restriccin correspondientes Se comparan fragmentos de ADN procedentes del ADN genmico completo o fragmentos amplificados mediante PCR
se compara ADN cortado vs. ADN sin cortar, y se compara entre especies realizando digestiones con diferentes enzimas de restriccin

Restriction Fragment Length Polymorphism (RFLP)

Diferenciacin de Maja spp. M.b. contiene el sitio Ase I, pero no M.sq.

M.b. CO1 fragment: 680 bp Ase I = 210 bp + 470 bp

Ase I

Whole Genome RFLP


Limitado a virus y bacterias White Sturgeon Herpes Virus
WSHV 1 & WSHV 2
1g ADN para cada digestin Cortado con Hind III & Sst I

M WSHV1 WSHV2 M
Hind Sst Hind Sst

Estimacin del tamao genmico:


WSHV 1 =132,770 pb WSHV 2 =123,590 pb

ADN Ribosomico
TEM Imagen de transcripcin
De gra Int da ac do to

18S

5.8S
ITS-1 ITS-2

28S

18S

5.8S
ITS-1 ITS-2

28S

ETS

ETS

ETS

ADN Ribosomico
Large Subunit -30 proteins -24S rRNA -5.8S rRNA Small Subunit -20 proteins -18S rRNA

Small Subunit rRNA

18S

5.8S
ITS-1 ITS-2

28S

18S

5.8S
ITS-1 ITS-2

28S

ETS

ETS

ETS

Secuenciacin Mitocondrial
Heredado slo a travs de la linea materna
secuencias altamente conservadas, pero tambin alta tasa de mutacin dentro de linajes
AF42 AF43 AF40 AF39 AF38 AF36 AF30 AF28 AF25 AF12 AF8 AF1 Afallax AF51 AF22 AF3 AF15 AF16 AF18 AF19 AF20 AF27 AF49 AF2

http://mitofish.ori.u-tokyo.ac.jp/
base de datos de ADN mitocondrial para especies de peces

A. fallax

Alosa fallax del Ro Ebro


Demostrada la hibridacin con Alosa alosa usando secuenciacin ND1

AF6 AF14 AF31 AF29 AF33 AF7 AF9 AF26 AF24 AF32 AA13 Aalosa AA14 Aalosa AA12 Aalosa AA11 Aalosa AA10 Aalosa AA9 Aalosa AA8 Aalosa AA4 Aalosa AA2 Aalosa AA1 Aalosa AA3 Aalosa AA5 Aalosa AA7 Aalosa AF37 AA6 Aalosa AA15 Aalosa AF5 AF23 AF46 AF47

A. alosa

A. fallax morphometry A. alosa ND1 genotype


0.002

AF48 AF50 AF41 AF4 AF21 AF34 AF35 AF44 AF45

II. Expresin de Gnes


Medida del gen target y del gen control endgeno (house-keeping) para su comparacin Diferentes tipos de anlisis:
Cuantificacin absoluta Cuantificacin relativa Diferentes mtodos para clculos de espresin relativa:
R = 2 Ct Mtodo de la Curva Standard Relativa: R=
-actin Vasa

C1 M ZI ZII ZI M C1 ZII

(E T) CtT (E R) CtR

Centollo (Maja brachydactyla)


Expresin de vasa asociada con el inicio de la diferenciacin de la lnea de clulas germinales y el desarrollo gonadal La expresin vara desde la eclosin hasta la primera juvenil

Cycle number

ZI = zooea I ZII = zooea II

M = megalopa C1 = first crab

Expresin Gnica Relacionada con la Formacin del Esqueleto en Dorada


Relative gene expression.

La expresin relativa muestra varios genes bajo la influencia de los niveles de vitamina A en la dieta Muestras de larvas a los 18 dph 14 Comparacin de 3 dietas con 12 18 dph * concentraciones diferentes de 10 vitamina A y dieta normal 8
= R450 (dieta control normal) = R900 = R2250 = R4500 6 4 2 0 -2
AR R AR R
P AR P on op e e st st O O in nt o

Aumento de 11.5 veces en la expresin del receptor de cido retinoico alfa

in ct e

Aislamiento y Secuenciacin de ADN

Resumen
YFG

Estudios de historia vital: - identificacin de fases del desarrollo Filogentica / Sistemtica Decubrimiento / descripcin de genes Deteccin de mutaciones

Deteccin / expresin gnica


Deteccin de patgenos YFG Estudios de paternidad y de poblaciones
microsatlites, mitocondrial, genes ribosmicos, etc

Respuestas fisiolgicas (estrs, nutricin, estado del desarrollo, interacciones huesped/parsito, etc) Microarray detectar diferencias grandes de expresin gnica entre muestras a baja
resolucin

Expresin de gnes alta resolucin de estados de expresin gnica alterada Manipulacin de gnes RNAi, genes anti-sentido, mutagnesis dirigida, gene knock-outs usando animales transgnicos

Resources
GenBank NCBI (National Center for Biotechnology Information) http://www.ncbi.nlm.nih.gov/
tambin EMBL (European Molecular Biology Laboratory) & DDBJ (DNA Data Bank of Japan) Bsqueda y descarga de secuencias de ADN y proteinas Anlisis BLAST (Basic Local Alignment Search Tool) para comparacin de secuencias

New England Biolabs NEB http://www.neb.com/


mucha informacin sobre enzimas de restriccin

Barcode of Life Initiative - BOLI http://www.dnabarcodes.org/


Informacin sobre sistemtica molecular con enlaces muy tiles

Freeware for Windows http://molbiol-tools.ca/molecular_biology_freeware.htm


ejemplos: Bioedit anlisis de secuencias MEGA anlisis filogenticos Tree-Puzzle composicin de rboles filogenticos

Polymerase Chain Reaction


C

T T G C A A C G T T C A G T

95oC 55oC 72oC

Nmero de ciclo 0 1 2 3

Reaccin en Cadena de la Polimerasa (Polymerase Chain Reaction)


Amplificacin logartmica de un segmento especfico de ADN genmico
Dos subconjuntos de molculas se amplifican a diferentes velocidades Signal = amplificacin logartmica - obtenida a partir de molculas de nueva sntesis (molculas de tamao especfico formadas slo despus del segundo ciclo) Noise = amplificacin lineal - obtenida a partir de la muestra original (tamao variable)

Amplificacin Lineal y Logartmica


1000000000 100000000 10000000 1000000 100000

ADN de novo DNA original

Nmero de Copias 10000


1000 100 10 1 10 20 30 40

Nmero de Ciclos

Cuantificacin del ADN


Demasiado ADN puede tener un efecto inhibitorio La cantidad de ADN usada en la PCR depende de la secuencia target
Las secuencias ricas en G/C pueden ser ms difcil de amplificar Genes de alto nnero de copia requieren menos ADN
(eg. - genes ribosmicos, ADN mitocondrial)

El uso de espectrofotometra
A260 = 1 = 50 g/ml de AND genmico; o 0.1 < A260 < 1 A260 / A280 ~ 1.9
[DNA] = A260 x Dilucin x 50 g/ml

33 g/ml primers 40 g/ml RNA

Cuantificacin de ADN por Espectrofotometra


1.5

A260 / A280 value = 1.9 = Pure DNA


1

Absorbance
0.5

DNA P rotein

0 260 nm 280 nm

Wavelength

Componentes de PCR - Primers


ADN corto sinttico de cadena sencilla
llamados oligonucletidos, primers, o sondas segn la aplicacin

Esenciales para el inicio de la amplificacin Define los extremos finales para rondas de amplificacin sucesivas Los primers son:
De cadena sencilla normalmente 15 - 30 pb de longitud ~50 % G/C estabiliza la unin del primer Acabado en el extremo 3 con una G/C estabiliza el inicio de la polimerizacin

Existen muchos proveedores comerciales de primers, incluido SIGMA


Simplemente enva la secuencia que necesitas

Componentes de PCR - Primers (cont.)


Diseo del Primer : evita la autocomplementariedad
INTRA-molecular: formacin de hair pin & primer- dimer
5

GCTAGCATGACCTCGTGAATGGGCTAG 3

GCTAGCAT GACCTC GTGAATGGGCTAG 3

INTER-molecular: formacin de primer- dimer


5

GTGTATCATGACGTAGATTCGGGCCC 3

Componentes de PCR - Primers (cont.)


Temperatura de Desnaturalizacin del Primer (Primer Melting Temperature, Tm)
Temperatura a la que el primer se cae Se calcula as: [G/C] X 4 + [T/A] X 2 = Tm

Temperatura de desnaturalizacin vs. Temperatura de apareamiento


La temp. de apareamiento es de 5 a 15oC por debajo de la temp. de desnaturalizacin.

Hay que usar el espectrofotmetro para comprobar los stocks del primer
A260 = 1 = 33 g/ml [primer] = A260 x Dilucin x 33 g/ml

Efectos de la Concentracin - Primers


Titrate [DNA] Change [primer]
0.4 M 100 10 1 0.1 0.8 M 100 10 1 0.1

RT-PCR
Reverse Transcription PCR (PCR con Transcripcin inversa)
Requiere sntesis previa de ADN a partir de un ARN plantilla (template). La transcriptasa inversa es una ADN-polimerasa dependiente de ARN. La polimerizacin de ADN puede tener lugar en el mismo tubo de reaccin o separadamente.

La Higiene en el Laboratorio es MUY importante!


El ARN se degrada rpidamente por nucleasas que hay en tu piel, la poyata, partculas de polvo, etc.. La RNAsa A es muy estable y ubcua.
Usar reactivos libres de RNAsa en todos los pasos previos a la sntesis de ADN

RNAse - Away para limpiar gradillas, tubos, pipetas, etc...

PCR Cuantitativa (qPCR)


Con frecuencia llamada RT- PCR (aunque se puede confundir Real Time con Reverse Transcription PCR) Permite la cuantificacin de molculas de una secuencia especfica de ADN o ARN en una muestra
Expresin de gnes purificar ARN y convertirlo en ADNc tomar muestras biolgicas en nitrgeno lquido, hielo seco o RNAlater Deteccin de gnes purificar ARN o ADN segn el organismo tomar muestras en etanol par la purificacin de ADN

Se puede realizar usando colorante de unin a ADNds (SyberGreen), o formas diversas de sondas fluorognicas como Taqman. Probabilidad reducida de falsos positivos puesto que los tubos de ADN amplificado nunca se abren para realizar geles de agarosa. Los resultados se obtienen en menos tiempo - no hay geles de agarosa. Rango dinmico amplio - cuantificacin precisa con ms de 7 rdenes de magnitud.

qPCR con Colarante SYBER Green


Permite el anlisis de la curva de disociacin
Cebadores especficos para:
Pseudo-nitzschia fraudulenta P. multistriata P. pungens Protoceratium reticulatum
P. pungens P. multistriata Protoceratium P. fraudulenta False positive False positive

Anlisis cruzado usando ADN genmico:


P. calliantha P. delicatissima P. fraudulenta P. multistriata P. pungens Protoceratium reticulatum Alexandrium peruvianum

Deteccin por qPCR de Microalgas Txicas de Agua Marina de la Baha Alfaques


Cebadores especficos para el anlisis de Pseudo-nitzschia pungens en 16 muestras de agua
P. pungens Standards

Samples Standards Samples

False Positive

False Positive

Amplification Plot

Dissociation Curve

Ensayos de qPCR TaqMan


Utiliza dos cebadores y una sonda doblemente marcada para deteccin fluorescente
las dos marcas fluorescentes en la sonda se llaman detector y quencher
el quencher absorbe energa emitida via FRET (Fluorescence Resonant Energy Transfer) La sonda slo se une al ADN amplificado en una secuencia especfica

Se puede multiplexed usando diferentes marcas flurescentes

Altamente especfico y preciso sobre siete rdenes de magnitud Puedes disponer de un juego entero diseado para t si se conoce la secuencia
www.appliedbiosystems.com

El anlisis de las curvas de desnaturalizacin para la deteccin de falsos positivos no es posible con los ensayos Taqman Siempre que sea posible disea la sonda de manera que cubra una unin exon/exon para evitar la deteccin de ADN genmico

Componentes de TaqMan PCR


Taq ADN Polimerasa Primers Sonda marcado doblemente (Taqman probe) dNTPs Energa de excitacin transferida del fluorforo verde al rojo Tras la hidrlisis de la sonda mediante la actividad exonucleasa 5- 3 de la polimerasa de ADN Taq, el fluorfor verde emite luz
primer F

Denature

primer F

Anneal

primer F

Extend

Higiene en el Laboratorio de Diagnstico


Realiza cada operacin por separado y en reas separadas
Preparacin del cocktail Preparacin de la muestra de ADN Adicin del ADN a la PCR Ejecucin de la PCR Carga del gel de agarosa / documentacin del gel

Cambia de guantes entre tareas Siempre incluye un control de slo reactivo Asigna tareas especficas a las pipetas
Preparacin del cocktail Preparacin de ADN Carga del gel

Contaminacin

Rompe el ciclo!
Limpia gradillas & superficies entre usos La contaminacin de la PCR se autoperpetua

Amplificacin

A Beginners Guide to Molecular Biology for Aquaculture

Acknowledgements:
Carles Garcia Nacho Fernandez Carmen Lopez Guillermo Guerao Enric Gisbert Miguel Angel Lopez Guiomar Rotllant Ana Roque
Investigant el present, apropant el futur www.irta.es

Telescopio Espacial Hubble 2006: Nbula en Doble Hlice

Esta obra est bajo la licencia Reconocimiento-NoComercial-SinObraDerivada 2.5 Espaa de Creative Commons. Puede copiarla, distribuirla y comunicarla pblicamente siempre que especifique su autor y la institucin que la publica (IRTA); no la utilice para fines comerciales; y no haga con ella obra derivada. La licencia completa se puede consultar en http://creativecommons.org/licenses/by-nc-nd/2.5/es/deed.es.