Anda di halaman 1dari 55

INGENIERIA GENETICA

La manipulacin deliberada de la informacin gentica, con miras al anlisis gentico o al mejoramiento de una especie

Historia
1919: Karl Ereky, ingeniero hngaro, utiliza por primera vez la palabra biotecnologa. 1953 James Watson y Francis Crick describen la estructura doble hlice de la molcula de ADN. 1965: El bilogo norteamericano R. W. Holley ley por primera vez la informacin total de un gen de la levadura compuesta por 77 bases, lo que le vali el Premio Nobel. 1970: el cientfico estadounidense Har Gobind Khorana consigui reconstruir en el laboratorio todo un gen. 1973: Se desarrolla la tecnologa de recombinacin del ADN por Stanley Cohen, de la Universidad de Stanford, y Herbert W. Boyer, de la Universidad de California, San Francisco.

Historia
1976: Har Gobind Khorana sintetiza una molcula de cido nucleico compuesta por 206 bases. 1976: Robert Swanson y Dr. Herbert Boyer crean Genentech, la primera compaa de biotecnologa. 1982: Se produce insulina para humanos, la primera droga derivada de la biotecnologa. 1983: Se aprueban los alimentos transgnicos producidos por Calgene. Es la primera vez que se autorizan alimentos transgnicos en Estados Unidos. 2003 Cincuenta aos despus del descubrimiento de la estructura del ADN, se completa la secuencia del genoma humano. 2004: La ONU y el Gobierno de Chile organizan el Primer Foro Global de Biotecnologa, en la Ciudad de Concepcin, Chile (2 al 5 de marzo)

Ingeniera Gentica
Es la tecnologa de la manipulacin y transferencia del ADN de unos organismos a otros, que posibilita la creacin de nuevas especies, la correccin de defectos genticos y la fabricacin de numerosos compuestos.

Genes
Controlan todos los aspectos de la vida de cada organismo:
-Metabolismo -Forma -Desarrollo -Reproduccin -Constituyen el enlace esencial entre generaciones

-Pueden ser el origen de muchas enfermedades

French Anderson Pionero de la terapia gentica

ya existe toda base cientfica necesaria, pero no tendremos hasta dentro de 10 o 5 aos la eficiencia y seguridad para llevar a transferencias genticas de forma tica

Otro factor limitante: el banco de genes no tienen depositados a la espere de clientes todos los complejos conjuntos de genes que determinan la inteligencia, el buen comportamiento, higiene mental perfecta. Lo ideal de recurrir a la ingeniera gentica es que se utilice para prevenir o corregir enfermedades serias y no para tener un hijo mas inteligente, o para que sea alto y de ojos celestes. La ciencia sigue progresando a velocidad de un tren bala, llegando a menudo a una estacin determinada mucho antes de que haya podido analizarse y comprenderse a fondo todas las consecuencias derivadas de sus adelantos.
7

Ingeniera Gentica
En 1973 los investigadores Stanley Cohen y Herbert Boyer producen el primer organismo recombinando partes de su ADN en lo que se considera el comienzo de la ingeniera gentica.

Ingeniera Gentica
La Ingeniera Gentica se basa en la clonacin molecular. Un fragmento de DNA se recombina con un vector y se introduce en un hospedador adecuado. Los vectores de clonacin mas utilizados son los plasmidos y los bacterifagos.

- 1971 Kathleen Dannna y Daniel Nathans, marcaron el inicio de la era del DNA recombinante, con el aislamiento de una enzima de una bacteria y la

utilizacin de esta para cortar DNA vridico.

DNA recombinante

Creacin de nuevas combinaciones de segmentos o de molculas de DNA que no se encuentran juntas de manera natural

Unin de segmentos de DNA que


provienen de diferentes fuentes biolgicas.

Producir potencialmente gen

cantidades ilimitadas de un

NUCLEASAS

11

Nucleasas son enzimas que producen la rotura de los enlaces fosfodiester


de la cadena polinucleotdica de los cidos nucleicos. La vida media para el enlace fosfodiester en el DNA a pH 7 y 24 C se ha estimado en 130.000 aos. En las mismas condiciones, la vida media del ARN es de solamente 4 aos.
endonucleasas actan en posiciones internas de la cadena, reducindola a

fragmentos cada vez ms pequeos.

nucleasas

exonucleasas degradan los cidos nucleicos desde un extremo de la molcula. Algunas actan en la

direccin 5' 3'y otras en la direccin 3'>5',


eliminando nucletidos del extremo 5 o del 3 respectivamente

13

Las Endonucleasas o enzimas de restriccin son enzimas que hidrolizan los cidos nucleicos rompiendo enlaces internucletidos. -Son producidas por las bacterias, como un mecanismo de defensa contra las infecciones vridicas, donde actan como un mecanismo de defensa, para degradar material gentico extrao que entre en la clula. Las bacterias tienen la capacidad de metilar su DNA, lo cual sirve para distinguir entre el DNA extrao y el DNA propio. Las enzimas de restriccin no pueden cortar DNA metilado, de este modo solo afectan el DNA extranjero y no el DNA bacterial. - Se han identificado mas de 200 -Todas se unen a DNA - reconocen una secuencia especfica de nucleotidos denominada secuencia de reconocimiento. - tienen un patrn de corte especfico

-Palindromo: La rotura se produce en ambas hebras de DNA, debido a que la


lectura de la secuencia en ambas direcciones es la misma, ya que la mayora de las secuencias de reconocimiento contienen un tipo de simetra en el que la secuencia nucleotdica se lee igual en ambas cadenas del DNA en direccin 5- 3.

- Las endonucleasas de restriccin cortan el DNA generando, bien extremos 3 o 5 de unos cuatro nucletidos de longitud, denominados extremos cohesivos, o bien

extremos romos.
5- ATCGTTGCCTACAATTGAATTCCCAATAACCCTT -3 3- TAGCAACGGATGTTAACTTAAGGGTTATTGGGAA -5

La secuencia reconocida en este caso es GAATTC

17

Las endonucleasas se nombran a partir de las bacterias de las que son extradas, su nombre est dado segn el gnero y la especie de la bacteria de donde se aisl por primera vez esta enzima. La primera letra representa el gnero de la bacteria, las prximas dos indican la especie, una cuarta letra indica la cepa, y un nmero al final indica la cantidad de

enzimas que se han aislado de esa cepa. Ejemplo:


Eco RI E = gnero Escherichia co = especie coli R = cepa RV 13 I = primera endonucleasa aislada de esta cepa

18

Existen 3 tipos de enzimas de restriccin: 1. Tipo I y Tipo III:

- No permiten ejercer ningn control estricto sobre la posicin del corte respecto de la secuencia especifica de la molcula de DNA reconocida por la enzima. - Tienen actividad de restriccin (cortan) y modificacin (metilan). - Cortan a cierta distancia de la secuencia de reconocimiento, las Tipo I cortan lejos de la secuencia de reconocimiento, ya sea ro arriba o ro abajo. Las Tipo III cortan de 5-8 bases

antes o despus de la secuencia que reconocen.


- Necesitan ATP para moverse a travs de la molcula de DNA, desde el lugar de reconocimiento hasta el sitio del corte. - Son menos tiles.

2.

Tipo II:

- Slo tienen actividad de restriccin. - Cortan de manera consistente y predecible dentro de la secuencia que reconocen. - generan una serie reproducible de fragmentos cuyas secuencias son predecibles si se

conoce la secuencia de la molcula DNA diana


- Slo requieren Mg++ como cofactor, no necesitan ATP. - Se encuentra EcoRl

20

EcoRI fue una de las primeras enzimas de restriccin aisladas . Los fragmentos de DNA producidos por digestin por esta enzima, tienen

colas protuberantes de cadena sencilla (extremos cohesivos o pegajosos)


que pueden formar puentes de hidrogeno con colas complementarias de cadena sencilla de fragmentos de DNA que provengan de cualquier otra fuente. 5- ATCGTTGCCTACAATTGAATTCCCAATAACCCTT -3 3- TAGCAACGGATGTTAACTTAAGGGTTATTGGGAA -5

5- ATCGTTGCCTACAATTG 3- TAGCAACGGATGTTAACTTAA

AATTCCCAATAACCCTT -3 GGGTTATTGGGAA -5

Lo que permite la soldadura de fragmentos de DNA rotos por la misma endonucleasa de restriccin

Supongamos la secuencia reconocida por la endonucleasa de restriccin EcoRI, que es 5-GAATTC-3


En un DNA que contenga 30% de A, 30 % de T, 20 % de G y 20 % de C, la probabilidad de encontrar esta secuencia al azar sera de

0.2 x 0.3 x 0.3 x 0.3 x 0.3 x 0.2 = 0.000324 O lo que es lo mismo, aproximadamente una cada 3086 nucletidos

Aplicaciones de las enzimas de restriccin:

1.
2.

Hacer mapa de restriccin de un plsmido o bacterifago.


Fragmentar DNA genmico para separacin de electroforesis y

Southern Blot. 3. Generacin de fragmentos para ser usados como sondas marcadas en Southerny Northern blotting. 4. Generacin de fragmentos para ser subclonados en los vectores

apropiados, creacin de DNA recombinante.

23

Factores que son crticos al trabajar con enzimas de restriccin y que pueden afectar la actividad de las mismas: 1. Pureza del DNA la reaccin de enzimas es muy dependiente de la pureza,

contaminantes como protenas, fenol, cloroformo, etanol, altas concentraciones de sal, etc. inhiben la endonucleasa. 2. Temperatura y pH las enzimas son muy sensitivas a temperatura y pH en DNAsas Las DNAsas degradan el DNA en presencia de Mg+. Contaminantes con carga (-). DNA contaminado con otro DNA. Grados de metilacin algunas endonucleasas son inhibidas por metilacin. Tipo de molcula de DNA si el DNA no tiene la secuencia que es reconocida

lo que respecta a su estabilidad y actividad. 3. 4. 5. 6. 7.

por la enzima accesible, esta no puede cortar el material gentico (ej. si el DNA est superenrrollado el lugar de restriccin no va a estar accesible para la enzima).

24

Ligasas: unen molculas de DNA, sintetizando enlaces fosfodiester entre nucletidos ubicados en los extremos de dos molculas diferentes o en los dos extremos de una misma molcula.

25

26

27

28

Una enzima que sintetiza DNA se denomina DNA polimerasa y una que copia una molcula existente de DNA o de RNA se denomina DNA polimerasa dependiente del molde

31

Caractersticas de las DNA polimerasas

32

Comparacin de las DNA polimerasas

33

DNA polimerasa I

Esta enzima cuenta con tres actividades. Tiene


actividad polimerasa, de sntesis en direccin 5a 3. Una actividad 3a 5 exonucleasa, remocin de nucletidos errneos o conocida

como proofreading o revisora. Y finalmente,


una actividad 5a 3 exonucleasa, que a partir de un nick (rompimiento del enlace entre dos nucletidos vecinos) resintetiza una porcin de

DNA removiendo la ya existente. La ADN Pol l


no lleva a cabo el proceso de replicacin, es la encargada de la eliminacin de los cebadores y el "relleno" del espacio que dejan con ADN

(actividad exonucleasa 3' 5' y actividad


polimerasa 5' 3').
35

36

Fragmento Klenow

El fragmento de Klenow es un fragmento proteico de gran tamao


perteneciente a la enzima DNA polimerasa I, procedente de E. coli. Este fragmento puede separarse del resto de la enzima gracias a la proteasa subtilisina. La Subtilisina es una proteasa (una enzima que realiza la

digestin de las protenas, inicialmente se obtuvo de la bacteria Bacillus


subtilis
37

Fragmento Klenow

Debido a que la actividad exonucleasa 5' 3' de la DNA polimerasa I de E. coli la hace ineficaz para muchas aplicaciones, el fragmento Klenow, el cual carece de esta

actividad, puede resultar muy til en investigacin, debido a


que es extremadamente til para tareas basadas en: - Sntesis de DNA de doble cadena a partir de muestras de cadena simple - Relleno de extremos 3' de fragmentos de DNA - Digerir extremos 3' protuberantes - Preparacin de sonda de DNA radioactivas

39

DNA polimerasa T4

40

DNA polimerasa del fragmento T7

41

Taq DNA polimerasa

42

43

Usos de la Taq polimerasa:

44

Transcriptasa inversa, transcriptasa reversa o retrotranscriptasa es una enzima de tipo ADN-polimerasa, que tiene como funcin sintetizar ADN de doble cadena utilizando como molde ARN monocatenario. Enzima presente en los retrovirus.

46

47

48

RNA polimerasas DNA dependientes

49

50

51

Desoxinucleotidil transferasa terminal: es una DNA pol que realiza la sntesis de ADN utilizando slo una sola cadena de ADN - La mayora de las ADN polimerasas requieren de doble cadena de ADN como sustrato, en donde se utiliza el 5 ' 3' como un primer captulo y la cadena complementaria 3 ' 5' se utiliza como una plantilla.

Cataliza la adicin de nucletidos al extremo 3 'de una molcula de ADN. A diferencia de la mayora de las polimerasas de ADN no

requiere una plantilla El sustrato preferido de esta enzima es un


saliente 3 ', pero tambin puede aadir nucletidos a extremos romos. El cobalto es un cofactor necesario, sin embargo, la enzima cataliza la reaccin en Mg y Mn in vitro.
52

La enzima desoxinucleotidil transferasa terminal se utiliza para crear extremos de cadena sencilla mediante la adicin de colas de nucletidos. Si a uno de los DNA se le aade una cola de poli-dA, y al otro DNA se le aade una cola de poli-dT, se forman colas complementarias, y los fragmentos pueden unirse mediante puentes de hidrgeno. Entonces, por ligacin, pueden formarse

molculas recombinantes.

Las molculas de DNA recombinante pueden formarse a partir DNA cortado con enzimas que dejan extremos romos. En este mtodo se utiliza la enzima desoxinucleotidil transferasa terminal para crear colas complementarias mediante la adicin de fragmentos de poli-dA y de poli-dT. Estas colas sirven para unir el DNA de diferentes fuentes y para crear molculas de DNA recombinante, que son unidas covalentemente por tratamiento con la DNA ligasa.

53

Tras el tratamiento con una endonucleasa, Como se pueden examinar los fragmentos de DNA resultantes?

54

Separacin del DNA en diferentes longitudes

Electroforesis en gel de agarosa

55