Nitrogenous Bases
Nucleosides
Nucleotides
Nucleosides with a phosphate at 5 carbon
Phosphodiester Bond
DNA Polymerase
Methods:
1. Chain termination or dideoxy method
F. Sanger
Pyrosequencing
4 Steps:
1. Denaturation
2. Primer attachment and extension of bases 3. Termination
4. Gel electrophoresis
1 4
Gel electrophoresis
Dideoxy Method
Run four separate reactions each with different ddNTPs Run on a gel in four separate lanes Read the gel from the bottom up
Shotgun Sequencing
Used to sequence whole genomes Steps: DNA is broken up randomly into smaller fragments Dideoxy method produces reads Look for overlap of reads
Sequence AGCATGCTGCAGTCATGCT------First Shotgun Sequence -------------------TAGGCTA AGCATG-------------------Second Shotgun Sequence ------CTGCAGTCATGCTTAGGCTA AGCATGCTGCAGTCATGCTTAGGCTA Reconstruction Strand
Accurate Parallel processing Easily automated Eliminates the need for labeled primers and
Pyrosequencing
Basic idea:
Visible light is generated and is proportional to the
number of incorporated nucleotides 1pmol DNA = 6*1011 ATP = 6*109 photons at 560nm
DNA Polymerase I from E.coli. pyrophospate
Pyrosequencing
1st Method
Solid Phase Immobilized DNA 3 enzymes Wash step to remove nucleotides after each addition
Pyrosequencing
2nd Method
Liquid Phase 3 enzymes + apyrase (nucleotide degradation enzyme)
Eliminates need for washing step
In the well of a microtiter plate: primed DNA template 4 enzymes Nucleotides are added stepwise Nucleotide-degrading enzyme degrade previous nucleotides
Pyrosequencing Method:
Pyrosequencing Results:
Pyrosequencing Disadvantages
Smaller sequences Nonlinear light response after more than 5-6 identical nucleotides
Summary
DNA sequencing is a common procedure Dideoxy method
chunks
Pyrosequencing
Sequence by synthesis Accurate and fast
References
Applied Biosystems Automated DNA Sequence Chemistry Guide. (2000)
Garrett & Grisham. (2007) Biochemistry. Thomson and Brooks/Cole. 3rd ed. Pgs 337340.
Maxam, A. & Gilbert, W. (1977) A new method for sequencing DNA. Proc. Natl. Acad. Sci. 74, 560-564.
Ronaghi, M. (2001) Pyrosequencing sheds light on DNA sequencing. Genome Res. 11, 3-11.
Sanger, F., Nicklen, S., & Coulson, A.R. (1977) DNA Sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. 94, 5463-5467.
Shendure, J. & Ji, H. (2008) Next-generation DNA Sequencing. Nature Biotech. 26, 1135-1145
Venter, C, et al. (2001) The sequence of the human genome. Science. 291, 1304.