Anda di halaman 1dari 16

Strategic Intervention Material

JULIE ANN MAZON BONSUBRE


AGUSAN DEL SUR NATIONAL HIGH SCHOOL

Least Mastered Competency: Understand the chromosomal basis of inheritance and the role of DNA as a blue print of life

Subtask: Describe DNA and RNA Use the RNA Codon table and identify codes for Amino Acid Code, Decode, and Read the Genetic code

The Message from Within: Decoding Genetic Mystery


Roses are red, Violets are blue Candies are sweet but not as sweet as you Have you ever asked why flowers have different color? What would it be like for you if all flowers are red? Is it not beautiful to be unique? But what made these flower different yet so similar? All these beautiful variation is governed by the same natural law. It is controlled by a substance man came to know as GENES. Imagine how this substance made you unique. Have you ever wondered how genes do its work? This Material will help you break the message from within. It is designed to help you read the message written in the DNA the CODE of life and its blueprint in the RNA. Before you can Decode the mystery of the genes you have to master first the language of the genes. Are you ready junior detectives? Crack the code by mastering the following:
1. 2. 3. Describe DNA and RNA Use the RNA Codon table and identify codes for Amino Acid Code, Decode, and Read the Genetic code

DNA or RNA siblings: Quite a pair!

Junior detectives, your task starts now. Your first assignment is to identify the similarities and differences between the main players of this puzzleDNA and RNA. Look at the its picture and spot the difference. Write your answer in the table provided for you.

DNA

RNA

Table 1.Characteristics of DNA and RNA Characteristics


Number of strands Location in the cell Base Pairs Sugar
Task: Discuss the similarities and/ or differences between DNA and RNA chains. Write your Answer on the space provided below

DNA

RNA

Crack Up the Code!


Task: Using the Codon table, identify the amino acids with the following code: (write your answer on the opposite side of the codes) UAU AAA GGG UCG CGG ACG UAA AUG AUU

CCC
ACU CGC ACC

GCA
AGC UCU CAA

CAG
GAG AGA UGA

Table 2: Codon Table

Nitrogenous Bases A = Adenine T = Thymine

C = Cytosine
G = Guanine U = Uracil (RNA only)

Coding and Decoding Genetic Message

Task:
You are going to code a message and send it to your co-agent (your classmate) to decode. You will, on the other hand, translate your classmates coded message. Follow the direction in the ladder to code a message for your partner and crack a message from your partner.

Note: refer to the codon table when coding or decoding

Directions: Following the steps to code and decode message written using the genetic code Step 6
Step 5

Using your code, translate thank you

Step 4

Lastly, submit your code with a 50-word letter telling your teacher how you find your activity

Step 3

Send your message and write reply for the message that you will receive

Step 2

Write a message for your partner (a couple of sentence long using the code)

Write your symbol in your journal to be used when coding or decoding message
Step 1
START HERE

Agree with your partner what word will be assigned for a specific codon for your code (eg. ACU means I and UUU means You).

DO or DIE: Judgment time


Agent on training, its time for skill evaluation. Get ready!

Direction: using the following codes, translate the following coded messages. Good luck.

UAG = Stop (period) CCG = is CGC = water AUG = (Start) CCU = subject CGG = every AAA = Your CGA = drink CGU = day AAC = mother AAG = wears . . . AAU = dresses ACG = funny . . . ACC = have . . .ACU = dog ACA = breath . . . AGA = the . . . AGG = are AGU = Beatles . . .AGC = best . . . AUA = rock AUC = band . . .AUU = an . . . CAA = old CAC = rubber . . . CAG = breaks . CAU = pulled CCA = when . . . CCC = Biology . . . CUA = I CUC = love . . . CUG = roll . . . CUU = music GAA = all . . . GAC = demented ..GAG = puppies GAU = and . . . GCA = so . . . GCC = much GCG = fun . . . GCU = education . . . GGA = door GGC = to . . . GGG = future . . . GGU = father GUA = a . . . GUC = dress . . . GUG = brother GUU = nothing . . . UAA = we . . . UAC = in UAU = this . . . UCA = together . . . UCC = must UCG = be . . . UCU = informed . . . UGA = around UGC = you . . . UGG = read . . . UGU = little UUA = DNA . . . UUC = code . . . UUG = for UUU = life

DNA Segments 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 ATGAAAAACAAGGTACACATCTAG ATGAAAAACAATTGCACGTAG ATGTAAACCACTACATAG ATGAGAAGTAGGAGAAGCATAATCTAG ATGATTCAACACATCCAGCCACATTAG ATGCCCCCGAGAAGCCCTTAG ATGCGACGCCGGCGTTAG ATGCTACTCATAGATCTGCTTTAG ATGTAAAGGGAAGACGAGTAG ATGCCCCCGGCAGCCGCGTAG ATGGCTCCGAGAGGAGGCAGAGGGTAG ATGAAAGGTAAGGTAGTCTAG ATGAAAGTGAAGGTTTAG ATGTAAAGGGAATACTATTCATAG ATGTAATCCTCGTCTCGGCGTTAG ATGATAGATCTGCTTCCGAGAAGCTAG ATGCCCCCGGAATGATGCTAG ATGTGGGTATGTCGGCGTTAG ATGTTACCGAGATTCTTGTTTTAG ATGTTATCCTCGTGGTTGTTTTAG

Message

Genetic Code Activity RNA Codes for Twenty AminoAcids


Direction: Using the table complete the tasks for Enrichment

1.

Using the mRNA triplet code units and the assigned English letter equivalents, translate the following message:

AUG/AGA/GGU/AAA/UAA/AUG/CCU/UGG/UAA/AU G/UGU/CAU/AUG/UAA/AUG/ACU/ GUU/AGA/AUG/UAA/AUG/GUU/AUU/UAA/AUG/ GAU/CCU/AUU/AUG/UAA!


2. Now, using the mRNA triplet code units, write your own

code message and send it to another student to decode. You in turn need to translate a message from one of your classmates.

The Woodrow Wilson National Fellowship Foundation webmaster@woodrow.org CN 5281, Princeton NJ 08543-5281 Tel:(609)452-7007 Fax:(609)452-0066 Dreistadt, Roy. 1968. An analysis of the use of analogies and metaphors in science. Journal of Psychology 68: 97-116. Glynn, Shawn. 1988. The teaching-with-analogies model: explaining concepts in expository texts. K.D. Muth ed. Children's Comprehension of Narrative and Expository Text. Newark, DE: International Reading Assn. Minsky, Marvin. 1985. The Society of Minds. New York: Simon and Schuster. Newby, Timothy and Stepich, Donald. 1987. Learning abstract concepts: the use of analogies as mediational strategy. Journal of Instructional Development 10(2):20-26.

Junior Detectivesafter passing the evaluation, you have now mastered one of the most valued skills We excel thru practice, dont settle for anything less than excellent! You have now cracked the code, Mission Accomplished! Until our next mission. Congratulations!