Anda di halaman 1dari 22

Aula 2

:
Fluxo
da
Ação Gênica
Ação gênica:

Replicaç
ão
Transcriç
Transcriç ão
ão Reversa

Replicaç
ão do
RNA Traduçã
o

Proteína
Ação gênica:

GENÓTIP
O

FENÓTIP
O
Linguagem Genética:
 Informação genética
seqüência de nucleotídeos relacionada à
expressão de um fenótipo qualquer

Código Genético
modo pelo qual os nucleotídeos e os
aminoácidos se relacionam

 GENE: sequência de nucleotídeos organizada,
contendo elementos de iniciação, terminação,
íntrons e exons, de modo que após a
transcrição e a tradução produzem uma
sequência protéica funcional.
Linguagem Genética:
 Sinais genéticos
 seqüências especiais de nucleotídeos
sinais de transmissão da informação genética:
 origem de replicação - oriC
 região do centrômero (segregação dos cromossomos)

 Sinais de expressão da informação genética
regiões promotoras – TATA boxes
regiões de regulação – códons de término

 Ossinais genéticos não são universais, variam
com o tipo de organismos considerados
Transcrição:

Ver animação CD
 Maturação de mRNAs

 adiçãodo capacete G
(RNA primário)

 adição do poli – A e
retirada dos íntrons:
“splicing” (RNA
maduro)
“Splicing” do gene de ovoalbumina

1 a 7 = íntrons A a G = éxons

CAP G

Clivagem dos Poli A
íntrons

RNA maduro
Transcrito primário
 procariotos

DNA
Transcrito primário
 eucariotos
Papel adaptador dos tRNAs:
Código Genético:
 Decifração - NIREMBERG et al. (1961)

 Códons de 3 nucleotídeos (letras) do RNAm que
determina cada aminoácido da sequência protéica a
ser sintetizada.
 Existem 64 combinações de bases possíveis
 Existe + de um códon para o mesmo aa (degeneração)

 Anti-códon: é a sequência de pareamento de
nucleotídeos do RNAt que se combina com o RNAm
trazendo o aa específico para cada códon.
Descrição das degenerações
 mutações nos
códons O Código Genético
 alterações nas
3ªs letras não
gera substituções

 alterações nas
1ªs letras geram Códons de
substituições de Terminação
aa com
propriedades
físico-químicas
semelhantes

 alterações nas
2ªs letras geram
substituições de
aa não
relacionados Códon de
iniciação
Propriedades:
 Código não universal
 exceções à universalidade:
códon UAG
 procariotos – códon de termino
 eucariotos – codifica para triptofano

códon CUN
 procariotos – codifica para treonina
 eucariotos – codifica para leucina
Propriedades:
 códons especiais

 AUG – codifica para fMET – o aa iniciador

 UAG, UAA, UGA – códons de término para
procariotos
Propriedades:
 perda de fase (frameshift): quando há modificação na sequência de leitura do DNA pela
inserção ou deleção de pb.

 deleções ou inserções de bases
ex:

normal – AUGGCUUCUGCGCAGAUUAGGCAC ...
mutant – AUGGCUU CUGCGGCAGAUUAGGCAC ...
A

Inserção
A
Perda de Fase (Frameshift)
Fases de leitura
Variação Genética
Se todos os membros de uma espécie têm o mesmo conjunto de
genes, como pode haver variação genética?
R.: Pela presença de ALELOS, que são formas diferentes do
mesmo gene, encontrados na mesma posição cromossômica.
 Tipos de variação genética:
a) descontínua: uma característica encontrada numa população
em 2 ou mais formas distintas e separadas (fenótipos). Estes
fenótipos em geral são codificados pelos alelos de um gene
(polimorfismo). Exemplo : albinismo
b) Contínua: mostra uma gama não interrompida de fenótipos na
população (curva de distribuição em forma de sino). Ocorre
com característica mensuráveis como altura, peso, podendo
sofrer a influência do ambiente e não só a genética.