Anda di halaman 1dari 53

INGENIERIA GENETICA:

DISEO Y CONSTRUCCION DE INICIADORES Y


SONDAS DE DNA
M. Sc. WILLIAN CAPA ROBLES
Escenarios frecuentes para el uso de los primers
o iniciadores


Secuencia de DNA conocida
- Diagnostico, genotipificacin
- Tener cuidado si es DNA o cDNA


Secuencia de DNA desconocida
- Se busca secuenciar el gen en cuestin
- Regiones conservadas en genes homlogos de organismos
cercanos
- Extremos amino o carboxilo terminal de la protena codificada es
conocida
Un partidor, cebador, iniciador o primer, es una cadena de cido nuclico o de
una molcula relacionada que sirve como punto de partida para la replicacin
del DNA con la DNA polimerasa.

Es una secuencia corta de cido nuclico que contiene un grupo 3'hidroxilo libre
que forma pares de bases complementarios a una hebra molde y acta como
punto de inicio para la adicin de nucletidos con el fin de copiar la hebra
molde.
La secuenciacin de DNA se usa
para determinar los nucletidos en
una cadena de DNA. Un mtodo
de secuenciacin llamado
secuenciacin didesoxi, conocido
tambin como mtodo de
terminacin de cadenas o mtodo
Sanger, usa un partidor como
marcador de inicio para la reaccin
de cadena.
Los primers se usan en la secuenciacin de DNA y la reaccin
en cadena de la polimerasa (PCR).
Cada ciclo de PCR implica tres
saltos de temperatura:
- La desnaturalizacin,
a 94C.
- La hibridacin de los
iniciadores con la
secuencia complementaria
(45-60C).
- La extensin, que ocurre
ptimamente a 74C para
la polimerasa Taq.

La temperatura de hibridacin
puede calcularse en base a la
temperatura de fusin (melting
temperature) o Tm del hbrido.

La temperatura de hibridacin
estar, por tanto, 1-3C por
debajo de la Tm

La eficacia y la sensibilidad del PCR depende enormemente de la
eficiencia de los iniciadores.
La capacidad de un oligonucletido para servir como un iniciador en
PCR es dependiente de factores tales como:

La cintica de la asociacin y disociacin de los dplex templados del
iniciador o cebador en el alineamiento y extensin
La estabilidad del dplex de los oligonucletidos coincidentes y su
localizacin
La eficiencia con la cual la polimerasa puede reconocer y extender un
dplex coincidente.
La mayora de los reviews en optimizacin PCR consideran diferentes
parmetros del PCR, aunque generalmente no discuten conceptos
bsicos de diseo de iniciadores o cebadores.
Un iniciador mal diseado puede resultar en una reaccin PCR que
no trabajara adecuadamente. La secuencia del iniciador
determina varias cosas tales como:
La longitud del producto
La temperatura de desnaturalizacin y ltimamente el
rendimiento.
Los iniciadores son nicos para una secuencia blanco que va a ser
amplificada y debera cumplir ciertos criterios tales como
longitud del iniciador, % GC, temperatura de alineamiento y
desnaturalizacin, estabilidad del extremo 5, especificidad del
extremo 3, etc.
Un iniciador mal diseado puede resultar en un poco o
ninguna formacin del producto debido a la amplificacin no
especifica y/o formacin de dmeros, los cuales pueden
llegar a ser competitivos como para suprimir la formacin
del producto.


Las secuencias de los iniciadores usados para amplificacin
PCR puede tener un mayor efecto en la especificidad y
sensibilidad de la reaccin.
Cuando se eligen los iniciadores para amplificacin PCR, se deben
tener algunos criterios:

Longitud del iniciador:

Tanto la especificidad y la temperatura y tiempo de alineacin son al
menos dependientes de la longitud del iniciador, este parmetro es
critico para el xito del PCR.

Los iniciadores de 18 -24 nucletidos en longitud son los mejores.

Los iniciadores deberan ser al menos de 18 nucletidos en longitud para
minimizar las posibilidades de encontrar problemas con sitios de
hibridacin secundaria en el vector o inserto.

Los iniciadores con longitud de una base especifica debera ser evitado.
Es especialmente importante evitar de 4 o mas Gs o Cs en una cadena.
Secuencias complementarias del iniciador:


Los iniciadores necesitan ser diseados con homologa
absolutamente - no intraprimer- no mas all de las 3 pb. Si un
iniciador tiene una regin de homologa as misma, puede
ocurrir un snap back.

Otro peligro relacionado es la homologa interprimer: la
homologa parcial en las regiones medias de dos iniciadores
puede interferir con la hibridacin. Si la homologa ocurre en el
extremo 3 de cualquiera de los iniciadores, entonces podra
ocurrir la formacin de dmeros.
Contenido GC, poli (A/T G/C)

40 60% GC (para tener buena Tm)
Sin poli (T/A-G/C)
Poli T, poli A o Poli T/A > unin ms dbil:
Se puede separar el complejo primer-templado
en esa zona (brecha).
Poli G, poli C o poli G/C > unin ms fuerte:
annealing no especfico.


Temperatura de fusin o de melting, Tm Es la temperatura en la cual
la mitad de las cadenas de DNA son sencillas y la otra mitad esta como
doble cadena. Tm es dependiente de la composicin del DNA; Un DNA
con un alto contenido de G+C tiene un Tm mas alto debido a que tiene
ms enlaces de H.

Clculos:
Menores de 13: Tm=(wA+xT) * 2 +(yG+zC) * 4
Mayores de 13: Tm=64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
Temperatura de melting o fusin (Tm):
Wallace et al. (1979)
Las temperaturas de melting optimas para los iniciadores en el
rango de 52-58C, generalmente producen los mejores resultados
que los iniciadores con temperaturas de melting mas bajas.



Los iniciadores con temperaturas de melting sobre 65C,
deberan evitarse debido a un potencial alineamiento secundario.
Es posible hacer reacciones de secuenciacin con alineamiento y
extensin a 60 C.
Tann: 5- 8 C ms baja que la de fusin
Temperatura de alineamiento
T
anneal
= T
m_primer
4C
Temperatura de alineamiento o temperatura de annealing,
T
anneal
es la temperatura en la cual los primers se alinean al
DNA templete. Es calculado de la Tm.
Contenido GC (Tm y Ta estn interrelacionados):


El % GC es una caracterstica importante del DNA y provee informacin
acerca de la fuerza de alineamiento. Los iniciadores deberan tener un
contenido de GC entre 45 y 60%.


Para los iniciadores con un GC de menos del 50%, podra ser necesario
extender la secuencia del iniciador mas all de las 18 bases para
mantener la temperatura de melting por encima del limite mas bajo
recomendado de 50C.


El contenido GC y la temperatura de melting y alineamiento son
estrictamente dependientes uno del otro.
Secuencia del extremo 3:

Es bien establecido que la posicin terminal 3 en los iniciadores PCR es
esencial para el control del cebado.

Los iniciadores deberan ser pegajosos en sus extremos 5 mas que en
sus extremos 3.

Un extremo 3 pegajoso indicado por un alto contenido GC podra alinear
potencialmente mltiples sitios del DNA templete.

Una G o C es deseable en el extremo 3 aunque la primera parte de
esta regla debera aplicarse. La abrazadera GC reduce las falsas bandas
secundarias.
Extremo 3
Evitar secuencias complementarias en 3
Primer dimer
5
3
5 3
5 3
5 3
5 3
5 3
Extremo 3.
Evitar ms de dos G y/o C en los ltimos
nucletidos.
G o C asegura la unin del primer al molde
en el extremo 3 (unin ms fuerte que
A/T) > Aumenta la eficiencia de la
reaccin.
Evitar una T en la ltima base del
extremo 3.
Evitar mismatches (desapareamientos)
en el extremo 3.
Los dmeros y falsos cebados causan resultados errneos:
Un iniciador podra plegarse a si mismo y
resultar en un evento de cebado
improductivo que disminuye la seal
promedio obtenida.

Las horquillas que se forman por debajo de
los 50C generalmente no son como tal un
problema. Los iniciadores no deberan
contener secuencia de nucletidos que
conduzcan a una molcula iniciadora a
alinearse a si misma o alinearse a otro
iniciador usado en reacciones PCR
(formacin de dmeros)
Los iniciadores no deberan contener secuencia complementarias
(palindromicas) dentro de ellas. Esto es que ellas no formen horquillas.
Especificidad:

La especificidad de los iniciadores es al menos dependiente del cebador.
Es evidente que hay oligos mucho mas de 24 bases que de 15 pares de
bases.

Sin embargo, los iniciadores deberan ser elegidos dado que una nica
secuencia dentro del DNA templete que es amplificado.

Un iniciador diseado con una secuencia altamente repetitiva resultara
en una mancha cuando amplificamos el DNA genmico. Sin embargo, el
mismo iniciador podra dar una banda simple si un nico clon es
amplificado de una librera genmica.
Primer candidate 1 5-TGCTAAGTTG-3
Primer candidate 2 5-CAGTCAACTGCTAC-3
T G C T A A G T T G
C A G T C A A C T G C T A C
Template DNA
5...TCAACTTAGCATGATCGGGTA...GTAGCAGTTGACTGTACAACTCAGCAA...3
NOT UNIQUE!
UNIQUE!
T G C T G A G T T G
Deber haber uno y slo un sitio diana en el DNA molde, donde el cebador
se une, lo que significa que la secuencia del cebador debe ser nico en la
plantilla de DNA.
Especificidad de un primer depende de la longitud (ms largo > menos
probabilidad de encontrar 2 secuencias iguales en el ADN templado).
Iniciadores degenerados:
Se usan cuando quiero amplificar un gen y solo conozco su
secuencia de aminocidos.
Se usan secuencias que estn conservadas para una familia
de protenas.
Se usa secuencia con menor cantidad de codones posibles.
Se realizan todos los primers posibles para unirlos a la
secuencia de inters.
Se incluyen sitios de restriccin para clonar posteriormente.

Los programas computacionales se han desarrollado
especficamente para el diseo de iniciadores degenerados.

Se pueden agregar degeneraciones en algunas posiciones del
primer:

a - Se incrementa el riesgo de amplificacin inespecfica.
b - Se disminuye la concentracin en la mezcla de cada uno de los
primers posibles.
c - No se recomienda utilizar ms de 64 primers diferentes en la
mezcla.
d - Cdigo IUPAC/IUB:
Cdigo IUPAC/IUB:

A adenina R A o G
C citosina W A o T
G guanina S C o G
T timidina en el ADN Y C o T
uracilo en el ARN K G o T
N A o C o G o T H A o C o T; no G
M A o C B C o G o T; no A
V A o C o G; no T D A o G o T; no C
Ejemplo de primers degenerados:

CTTCCTGAACTTGCTCTTCG
CTTCCTGAACTTGCTCTTCG
CTTCCTGAACTTGGTCTTCG
CTTCCTAAAATTGGTCTTCG
* * * * * * * * * * * * * * * * *
5 CTT CCT RAA MTT GST CTT CG 3 (primer sentido)
R: G, A
M: C, A
S: C, G
Ejemplo de primers degenerados:

ndice de degeneracin o degeneracin general:
Producto de la degeneracin en cada nucletido del primer
En el caso del ejemplo anterior:
ndice de degeneracin: 8.
Solamente 1/8 de los primers van a hibridizar exactamente con el
templado
Se pueden utilizar apareamiento de bases wobble
para evitar agregar demasiadas degeneraciones.
Son apareamientos entre bases diferentes de los
tradicionales Watson Crick

Ejemplos:
G:T
G:U

Apareamiento de bases Wobble
En el caso del ejemplo anterior, podemos reducir el ndice de 8 a 4
agregando un nucletido wobble (siempre cercanos al extremo 5):
5 CTT CCT RAA MTT GST CTT CG 3 (primer sentido)
R: G, A
M: C, A
S: C, G

5 CTT CCT GAA MTT GST CTT CG 3




Si tengo C o T en la hebra utilizada como templado:
En este caso elijo G en el primer, porque G puede hibridizar con C o con T

Si tengo A o G en la hebra utilizada como templado:
Elijo T en el primer, porque T puede hibridizar con A o con G
Otras recomendaciones:

La concentracin del iniciador en una reaccin de amplificacin debera
estar entre 0.1 y 0.5 m. Si fuera posible, una bsqueda web debera
ser conducida para el vector y las secuencias de DNA insertadas a fin
de verificar que el iniciador y especialmente que las 8-10 bases de
extremo 3 son nicos.

La Inosina debera ser incluido en la secuenciacin de iniciadores. Ellos
no trabajan y dan pobres resultados en el ciclo de secuenciacion.


Las caracteristicas de los iniciadores puede ser visualmente
inspeccionados por la presencia de elementos listados y un buen numero
de programas computacionales han sido desarrollados para su uso en la
seleccin de iniciadores o cebadores.
DISEO DE INICIADORES - BIOINFORMATICA
Los cientficos han desarrollado algoritmos y programas
computacionales para el diseo de INICIADORES
Marcacin de SONDAS
HIBRIDACION NORTHERN BLOT
LA PREPARACION DE LA SONDA ES CRITICA PARA LAS TECNICAS
DE HIBRIDIZACION MOLECULAR



EN LA HIBRIDIZACION:
LA SONDA Y EL ACIDO NUCLEICO A HIBRIDIZAR DEBEN ESTAR
COMO SIMPLE CADENA


SOUTHERN BLOT: DNA-DNA
NORTHERN BLOT: RNA-DNA
Adems de la cuantificacin de muestras, el formato de las sondas permiten
tambin la deteccin de mutaciones mediante la monitorizacin del cambio
de comportamiento que ocurre en las curvas de fusin de las sondas.
Una sonda es un fragmento de DNA (o raramente RNA) de
pequeo tamao (normalmente entre 100 y 1000 bases)
usado en biologa molecular como herramienta para detectar
la presencia de DNA o RNA de secuencia complementaria
parecida o igual.


En su uso, la sonda se une a la secuencia diana
monocatenaria (ADN
c
ARN) mediante un mecanismo de
hibridacin que forma una estructura bicatenaria, una de las
hebras pertenece a la sonda, y la otra a la secuencia diana.
La deteccin del mtodo depende de lo que se requiera:


a) Sensibilidad. Depende del fcil acceso que tenga la sonda marcada, la cantidad
y tipo de marca includa en la sonda y el mtodo de deteccin.

b) Resolucin. La resolucin de la seal puede variar de sitios especficos en una
clula, lo cual depende de la sonda marcada y del mtodo de deteccin.

c) Especificidad. La especificidad de la seal depende de la selectividad del lavado
y de secuencias similares que interfieran en el pegado de la sonda.
Las sondas requieren ser marcadas bien con istopos radiactivos (
32
P) o con
quimioluminiscencia, ya sea con fosfatasa alcalina o con peroxidasa de
rbano, las cules, tras la adicin de su sustrato especfico producen una
emisin de luz detectable.


El marcaje por quimioluminiscencia puede hacerse de dos formas: Por un
lado, la sonda puede estar unida a la enzima o bien unida a un ligando (p.ej,
biotina) para la cual hay un anticuerpo (avidina o estreptavidina en este
caso) est unido a la enzima que revelar el marcaje.


Los Rayos X pueden detectar tanto las seales radioactivas como las
quimioluminiscentes, siendo preferida por muchos investigadores la
segunda, dada su mayor rapidez, sensibilidad y reduccin de los riesgos
para la salud que conlleva trabajar con compuestos radioactivos.
La sonda puede ser/ o no radioactiva, en todos los casos
debe tener alta actividad especifica.

Determinacin de actividad especifica: una vez marcado
el DNA se precipita con TCA 5% y se cuenta la marca
precipitada.

AE = total de cuentas incorporadas
masa de acido nucleico usado
Se usa un nucleotido marcado:
32Pd NTP, -35Sd NTP, 125 Id NTP: Generalmente dCTP
biotina-11-d UTP, dioxigenina-11-d UTP
NICK TRANSLATION

Actan dos enzimas: dnasa 1 y dna polimerasa 1
Se utiliza dna doble cadena
Se introduce nick (agujero) al azar en una de las cadenas
del DNA.
Se usa enzima con actividad 5-3 exonucleasa: remueve
el dNTPs del extremo 5 (pol 1) y el nick se va
trasladando
Se separa el marcado del resto por precipitacin con
etanol o columna sephadex



Mtodos de marcacin de SONDAS
RANDOM PRIMER

Se utiliza una secuencia de oligonucleotidos conocida o de tipo
hexanucleotidos (cualquier secuencia consenso)
Se usa dna simple cadena (se desnaturaliza por calor)
Se usa enzima que no posea actividad 5 3 exonucleasa para que
no degrade al primer (fragmento exo-klenow)
Se genera cadena complementaria
Se separa el marcado del resto por precipitacion con etanol o
columna sephadex
Marcacin de SONDAS




NICK TRANSLATION RANDOM PRIMER
MASA A MARCAR 50 500 ng 25 250 ng
ACTIVIDAD
ESPECIFICA
5 x 10
8
dpm/ug 1 X 10
9
dpm / ug
LARGO del
FRAGMENTO
MARCADO
200 500 d NTP 200 2000 d NTP
SONDA NO RADIOACTIVA:
SE USA 1 ug DE MASA A MARCAR
SENSIBILIDAD COMO RAD. CON AE = 1 x 10
8
dpm/ug
MARCACION DE OLIGONUCLEOTIDOS


Se utilizan para realizar screening de bibliotecas
Se marcan usando la enzima deoxinucleotido transferasa (tdt) que
agrega dNTPs al extremo 3
Templado de 20 a 30 pb
Masa a marcar: 20 ng
Actividad especifica: 5 x 10
6
dpm/ ug
Se obtiene baja seal que ayuda a no tener fondo sucio
Tipo de sonda y mtodo de sntesis


i) Sondas de DNA doble cadena. Pueden ser preparadas utilizando tcnicas
como nick translation, random priming o PCR, en las cuales el nucletido marcado
es incorporado. PCR y random priming proporcionan una buena actividad especfica.
Estas sondas pueden ser desnaturalizadas antes de usar. Cuando se usan para
detectar una cadena simple como mRNA, estas son menos sensibles debido a que la
concentracin de la sonda marcada es reducida.

ii) Sondas de DNA de cadena simple (largas). Pueden ser preparadas
utilizando primer extension en templados de cadena simple o por PCR con un
nucletido marcado. ste ltimo es el ms usado porque es ms fcil de llevar a cabo
y las marcas pueden sintetizarse con poca cantidad de material. El PCR permite una
gran flexibilidad en la eleccin de las secuencias marcadas por el uso de primers.
Estas marcas han sido ampliamente usadas.


iiii) Oligonucletidos (entre 20 y 40 bases). oligonucletidos modificados
durante la sntesis qumica o adicionando una cola marcada. Una de las desventajas
es que algunos oligonucletidos marcados no se incorporan y por tanto la
sensibilidad disminuye.



iv) Sondas de RNA de cadena sencilla. Pueden ser sintetizadas por el uso de
una RNA polimerasa (SP6, T7 o T3 RNA polimerasa). La secuencia de la sonda es
clonada en un vector que flanquear dos sitios distintos de iniciacin.

La cadena de RNA antisentido (sonda) es sintetizada en direccin opuesta al gen
endgeno. Se recomienda linearizar la sonda de RNA con enzimas que dejen el
extremo 5 cohesivo, por que se ha reportado, que el extremo 3 romo promueve la
sntesis de transcritos anormales.
Los isotopos radiactivos difieren en cuanto a la resolucin de
la seal, la velocidad en obtencin de resultados y la
estabilidad de la sonda.
Marcaje con digoxigenina (DIG)

El mtodo de marcaje con DIG est basado en un esteroide
aislado de las plantas Digitalis purpurea y Digitalis lanata. Las
hojas y flores de estas plantas son la nica fuente natural de
digoxigenina.
La digoxigenina se enlaza en la posicin C5 de la uridina
mediante un brazo que contiene 11 tomos de carbono. Los
nucletidos marcados con DIG pueden ser incorporados a
las sondas de cidos nucleicos por DNA polimerasas (E. coli
DNA polimerasa I, T4 DNA polimerasa, T7 DNA
polimerasa, reverso transcritptasa y Taq DNA polimerasa),
al igual que RNA polimerasas (SP6, T3 O T7 RNA
polimerasa) y transferencia terminal.

Los cidos nucleicos pueden ser marcados qumicamente
con DIG-NHS ester o con DIG Chem-Link. Las sondas DIG-
marcadas pueden ser detectadas con una alta especificidad
por anticuerpos anti-digoxigenina (Anti-DIG) que son
conjugados a fosfatasa alcalina, peroxidasa, fluorescena,
rodamina u oro coloidal.
En principio la biotina puede ser
detectada en la misma longitud de onda
que la digoxigenina, dependiendo del
fluorforo acoplado a estreptavidina.

La estreptavidina o avidina es ms
frecuentemente usada porque stas
molculas tienen una alta capacidad de
enlace con la biotina
Marcaje con biotina

El marcaje de cidos nucleicos con biotina-dUTP (Figura 4) fue
desarrollado por David Ward y colaboradores en la Universidad
de Yale (Langer et al., 1981). Tambin se han implementado
procedimientos fotoqumicos al igual que un nmero de mtodos
de biotinilacin qumica han sido descritos

En (a) un istopo radiactivo se une al
fragmento de ADN; la consecuente
emisin de radiacin a o b puede
imprimir una placa sensible
(autorradiografia). En (b) y (c), a
travs de biotina y estreptavidina, o
bien de la digoxigenina y un
anticuerpo que la reconoce, la enzima
fosfatasa alcalina marca la sonda
dando lugar, con su presencia, a un
cambio de color del reactivo azul de
tetrazolio (reaccin coloreada). En (d)
la biotina, con la ayuda de la
estreptavidina, permite ligar una
partcula magntica que puede ser
separada, junto con la sonda,
mediante el empleo de un imn
(separacin magntica); en (e) y (f), la
peroxidasa, unida al ADN en forma
directa o a travs de fluoresceina y
un anticuerpo, da lugar a la emisin de
luz mediante el empleo del reactivo
luminol (reaccin luminosa).
Ejemplo:
Sonda
Sybr
Green