Anda di halaman 1dari 28

ACIDO

DESOXIRRIBONUCLEICO (DNA)
ACIDO RIBONUCLEICO (RNA)

HISTORIA DEL ADN


El ADN se aisl por primera
vez, durante el invierno de
1869,
por el mdico suizo
Friedrich Miescher.
Realizaba experimentos acerca
de la composicin qumica del
pus de vendas quirrgicas
desechadas cuando not un
precipitado de una sustancia
desconocida que caracteriz
qumicamente ms tarde. Lo
llam nuclena, debido a que lo
haba extrado a partir de
ncleos celulares.

En los aos 20, Phoebus Levene, en sus


estudios de la estructura y funcin de los
cidos nucleicos, logr determinar la
existencia de ADN y ARN, adems de que el
ADN est formado por 4 bases nitrogenadas.

Determin que la unidad bsica


del ADN estaba conformada por
fosfato-azcar-base nitrogenada
a la cual llam nucletido

En 1952, se logr determinar que el ADN es la molcula


responsable de la herencia.

Un ao despus Francis Crick y James Watson, Rosalind Franklin, Maurice


Wilkins, lograron dilucidar mediante estudios de difraccin de rayos X, la
estructura molecular de doble hlice del ADN, lo que les vali el premio Novel
de fisiologa y medicina en 1962.

QU ES EL
ADN?
ElADNes la molcula de la herencia
omolculahereditaria y contiene codificada
toda la informacin relativa a un organismo
vivo.

Los cidos nucleicos estn formados por subunidades


estructurales o monmeros, denominados nucletidos
ADN
Acido nucleico
Nucletido

Pentosa

Base nitrogenada

Grupo fosfato
Nuclesido

AZUARES/PENTOSA

Una pentosa, que puede ser la D-ribosa en el


ARN; o la D-2- desoxirribosa en el ADN

BASE NITROGENADA

Compuestos anillados que presentan N y C


Pirimidinas (anillo
sencillo)

Tinima
Citosina

Uracilo

Puricas (anillos dobles)

Adenina

Guanina

CIDO FOSFRICO/GRUPO FOSFATO H3PO4

Cada nucletido puede contener (AMP), (ADP) o (ATP)


grupos de cido fosfrico, aunque como monmeros
constituyentes de los cidos nucleicos slo aparecen en
forma de nuclesidos monofosfato.

A la unin de una pentosa con una base


nitrogenada se le llama nuclesido. Esta unin se
hace mediante un enlace glucosdico.

Si la pentosa es una desoxirribosa


tenemos Los desoxirribonucleotidos
Timina - Adenina - Guanina - Citosina

Si la pentosa es una ribosa tenemos


Los ribonucletidos
Uracilo Adenina - Citosina - Guanina

ESTRUCTURA PRIMARIA ADN


Secuencia de nucletidos
encadenados. Es en estas cadenas
donde se encuentra la
informacin gentica, y dado que
el esqueleto es el mismo para
todos, la diferencia de la
informacin radica en la distinta
secuencia de bases nitrogenadas.
Esta secuencia presenta un
cdigo, que determina una
informacin u otra, segn el
orden de las bases.
5'ACGTTTAACGACAAGTATTAAGACAAGTATTAA3'

ESTRUCTURA SECUNDARIA
Fue postulada por Watson y
Crick,
basndose
en
la
difraccin de rayos X que
haban realizado Franklin y
Wilkins.

En 1953 demostraron que la


estructura del ADN consiste
en una doble hlice formada
por dos cadenas.
De acuerdo con el modelo de doble
hlice propuesto por Watson y Crick,
la estructura secundaria del ADN
consiste en:

Una doble hlice


esta formada por dos
cadenas helicoidales
de polinucletidos,
enrolladas la una
alrededor de la otra a
lo largo de un eje
imaginario comn.
El enrollamiento es
dextrgiro (sentido
de las agujas del reloj).
Las cadenas son
antiparalelas, se
disponen en sentido
opuestos. Una va en
sentido 3'5' y la otra
en sentido 5' 3'

La doble hlice o fibra del ADN 20

Las bases
nitrogenadas se
sitan en el
interior de la
doble hlice
mientras que el
azcar (la
pentosa) y el
cido fosfrico
forman el
esqueleto
externo.

Las dos
cadenas estn
unidas por
puentes de
hidrgenos
formados
entre los pares
adeninatimina (A=T)
dos puentes y
guaninacitosina (GC)
tres puentes.

REPLICACIN DEL
ADN
La transmisin de informacin implica que el ADN es capaz
de duplicarse de manera de obtener dos molculas iguales a
partir de la molcula inicial. Este proceso se llama
replicacin.

ARN

cido ribonucleico(ARN),es el material


gentico de ciertos virus (virus ARN) y,
en los organismos celulares, molcula
que dirige las etapas intermedias de la
sntesis proteica. El cido ribonucleico
es un cido nucleico formado por una
cadena de ribonucletidos.

El ARN est formado por una


cadena de compuestos qumicos
llamados nucletidos . Cada uno
esta formado por una molcula
de un azcar llamado
ribosa
un grupo fosfato
uno de los 4 posibles
compuestos nitrogenados
llamados bases :
-adenina
- uracilo
-guanina
-citosina
En los organismos celulares
desempea diversas funciones.
Es la molcula que dirige las
etapas intermedias de la
sntesis proteica; el ADN no
puede actuar solo, y se vale del
ARN para transferir esta
informacin vital durante la
sntesis de protenas (produccin
de las protenas que necesita la

El cido ribonucleico se forma a


partir de un proceso de
duplicacin (o rplica) de las
cadenas de ADN, esto se realiza
en el interior delElncleo
las del proceso
primerde
paso
clulas.
denominado flujo de informacin
gentica. Luego tenemos la
Finalmente el
transcripcin o la copia de la
ARN, formado
informacin gentica en la nueva
en el ncleo,
cadena de ADN producida, que
sale de l y se
tambin se lleva a cabo en el
dirige al
ncleo, formndose el ARN.
citoplasma,
donde
distinguimos a
unos
corpsculos
denominados
ribosomas, que
sern los
escenarios de la
sntesis

N
R
A
L
E
D
N

I
CLASIFICAC

ARNr (ribosomal o
ribosomico)

El ARN
ribosmico
(ARNr ) se halla
combinado con
protenas para
formar los
ribosomas.

Sus
principales
caracterstic
as son:
-Forma parte
de las
subunidades
ribosmicas
cuando se
une con
muchas
proteinas.
-Estn
vinculados
con la
sntesis de
proteinas.

ARNm
(mensajero)

Sus caractersticas son la


siguientes:
- Cadenas de largo tamao
con estructura primaria.
- Se le llama mensajero
porque transporta la
informacin necesaria para la
sntesis proteica.
- Cada ARNm tiene informacin
para sintetizar una protena
determinada.

El lugar exacto para colocarse en


el ARNm lo hace gracias a tres
bases, a cuyo conjunto se llaman
anticodn (las complementarias
en el ARNm se llaman codn).

ARNt ( de
transferencia)

ESTRUCTURA
Est formado por la unin de muchos ribo nucletidos, los
cuales se unen entre ellos mediante enlaces fosfodiester en
sentido 5-3( igual que en el ADN ).
Estn formados por una sola cadena.

ESTRCUCTURA
PRIMARIA
Al igual que el ADN, se refiere
a la secuencia de las bases
nitrogenadas que constituyen
sus nucletidos.

ESTRUCTURA
SECUNDARIA
En una misma cadena, existen regiones
con secuencias complementarias capaces
de aparearse.

ESTRUCTURA
TERCIARIA

Es un plegamiento, complicado,
sobre al estructura secundaria.

s
i
s
e
t
n
S e
d
s
a
n

e
t
Pr o