Anda di halaman 1dari 66

Dra. Flora E. Arana F.

CUM-USAC 2016

Recordar
La transcripcin produce ARN complementario para
una cadena de ADN.
La direccinen la que las
sintetizan ARN es siempre 5'3'.

ARN

polimerasas

Asimetra de la transcripcin:se transcribe para


cada gen una de las dos hebras de ADN, la hebra
que se toma como molde para producir el ARN
se la denominahebra molde, hebra sin sentido,
no codificantey la otra hebra de ADN, la que no se
transcribe, se la denominahebra con sentido,
codificante.

Terminacin de la
transcripcin

La informacin fluye (con la excepcin de la


transcripcin reversa) del ADN al ARN por va
del proceso llamado transcripcin, y luego a la
protena por el proceso de traduccin.
Transcripcin es el proceso de fabricacin ARN
usando el ADN como molde.
Traduccin es la construccin de una
secuencia de aminocidos (polipptido) con la
informacin proporcionada por la molcula de
ARN.

TRADUCCION
LA SINTESIS DE PROTEINAS O TRADUCCION TIENE LUGAR EN EL
CITOPLASMA Y ES EL ORDENAMIENTO LINEAL DE LOS
AMINOACIDOS PARA FORMAR UNA PROTEINA.
Molculas que intervienen:
-

Ribosomas: Une al ARNt, ARNm y enzimas.

ARN de transferencia (ARNt): Transporta un


aminocido y posee un triplete de nucletidos o anticodn.

ARN mensajero: Es una secuencia de nucletidos que lleva la


informacin codificada de cada aminocido en tripletes de nucletidos
o codn.

Enzimas: Ayudan al proceso de traduccin proporcionando energa

TRADUCCIN DEL MENSAJE


GENTICO
( SNTESIS DE PROTENAS)

Para la SNTESIS de protenas o


TRADUCCIN se requiere de las
interacciones
apropiadas de los tres tipos de RNA y
protenas
estructurales, reguladoras y
catalticas.

En la traduccin
participan:

El cido RiboNucleico mensajero (ARNm) es el


molde para la construccin de la protena.

El cido RiboNucleico ribosmico (ARNr) se


encuentra en el sitio donde se construye la
protena: el ribosoma.

El cido RiboNucleico de transferencia (ARNt) es


el transportador que coloca el aminocido
apropiado en el sitio correspondiente.

En la traduccin de mRNA
participan 5 componentes
1. Ribosomas: realizan el proceso de sntesis
2. tRNA alinea aa en orden correcto a lo largo
del mRNA
3. Aminoacil-tRNA sintetasa: une los aa a las
molculas de tRNA
4. Molculas mRNA llevan codificadas la
informacin de la secuencia de aa para
sintetizar los polipptidos.

El ARNm es el molde para la


secuencia de aminocidos de una
protena:

Treonina
Histidina

Los Ribosomas

Son las organelas de


la clula donde se
sintetizan la protenas.
En los procariotas
subunidad liviana
(30S) y una pesada
(50S), el ARNr difiere
en cada uno de ellos.
Los

eucariticos por una de 60S y otra de

40S.
Las dos subunidades solo se unen luego del
ingreso mRNA

La

subunidad liviana tiene el sitio para


que se una el ARNm. Tiene un rol crucial
en la decodificacin del ARN pues
monitorea el apareamiento de bases entre
el codn del ARNm y el anticodn de
ARNt.

El ARN mensajero es el que lleva la


informacin para la sntesis de protenas
(CODONES), es decir, determina el orden en
que se unirn los aminocidos.

Sitio de unin mRNA y 3


sitios que puede unir
tRNA.
Sitio A: aminoacil,
donde se une cada
nuevo tRNA que llega
portando aa.
Sitio Peptidil: dnde
reside tRNA que lleva
cadena polipeptidica en
formacin
Sitio E: de salida, donde
tRNA abandona el
ribosoma despus de
haber descargado el aa.

El ARNt:

El ARNt tiene forma


de trbol y es el que
lleva el aminocido apropiado al ribosoma . Posee
anticodones
Reconoce los codones en el mRNA
Codon mRNA 5 --- 3
Anticodon tRNA 3 5

Union al
aa

El ARNt:

En la parte terminal
del brazo mas largo
del ARNt se
encuentran tres
bases, el anticodn,
que son
complementarias con
el codn.

Existen 61 ARNt
diferentes, cada uno
posee un sitio
diferente para pegar
el aminocido y un
anticodn diferente.
Para el codn UUU, el
codn
anticomplementario

El cdigo gentico:

El cdigo gentico consiste en 61 codones


para aminocidos y 3 codones de
terminacin, que detienen el proceso de
traduccin.
El cdigo gentico es por lo tanto
redundante o sigue la hiptesis del balanceo,
en el sentido que tiene varios codones para
un mismo aminocido.

El balanceo hiptesis del balanceo se refiere a que


algunos ARNt son capaces de reconocer ms de un codn
en el ARNm como resultado de un reconocimiento NO
ESTNDAR.
Este reconocimiento se da entre el anticodn del ARNt y
la tercera posicin de algunos codones complementarios.
En esta posicin hay un apareamiento de bases dbil
debido a la formacin de pares de bases G-U y a la
sustitucin de la guanosina por inosina en los anticodones
de muchos ARNt con C, U o A en la tercera posicin del
codn, por lo cual si la inosina aparece en el anticodn
permite que un nico ARNt reconozca 3 codones
diferentes en la secuencia del mensajero.

Por ejemplo, la glicina es codificada por los


codones GGU, GGC, GGA, y GGG. Si un codn
muta por ejemplo de GGU a CGC, se
especifica el mismo aminocido.

(**) Codifica
adems el
aminocidos
Nro. 21: selenocis
tena
y el
Nro. 22: la pirrolisi
na
. Para la insercin
de los mismos es
necesario adems
la presencia de
una secuencia de
"insercin"
ubicada luego del
cdigo de
terminacin

El proceso de Traduccin incluye Cuatro pr


importantes:
*Activacin de aminocidos
*Formacin del complejo de Inicio
*Alargamiento de la cadena
*Terminacin

Existen
diferencias
polipeptdica
en procariotas
y eucariotas

*La Activacin de los aminocidos incluy

1. Elevacin a un nivel de energa


alto-AMINOACILO-aminoacil adenilado,
el AMP lo proporciona la hidrlisis de
ATP
2. Tener unido un RNAt especfico a su
extremo 3-OH
Ambas reacciones son catalizadas
por
AMINOACIL-RNAt SINTETASAS.

Aminoacil-tRNA
Sintetasa: Antes
que un aa sea
llevado por tRNA
debe estar unido a
ste
covalentemente, las
enzimas
responsables de esta
unin son las
aminoacil-tRNA
singtetasas (20
tipos).
Realiza la activacin
de los aa formando
un enlace ster entre
el carboxilo de un aa
Aminoacil-tRNA
transferasas,
y el 3;OH de tRNA
reconocen los nucletidos al menos en dos regiones distintas de las
molculas de tRNA. Despus de unir el aa otra aminoacil revisa el
producto final y si no es correcto lo hidroliza

Iniciacin

El ribosoma se une
al ARNm en un
codn de inicio

Elongacin

La cadena polipeptdica
crece al aadirle
sucesivos aminocidos

Terminacin

Cuando se
encuentra un
codn de
terminacin,
el polipeptido
se libera y el
ribosoma se
disocia

Traduccin

en procariotas & eucariotas

Traduccin en procariotas & eucari

INICIACIN
ARNm procariota
Mltiples sitios de inicio de la traduccin

ARNm eucariota
nico sitio de inicio de la traduccin

Pasos Iniciacin en Procariota


Unin IFs a la
Union
Subunidad 30S

1.

y 3, se unen a unidad
unido IF2

Sitio unin ribosoma

Unin tRNA
Iniciador y mRNA
Subunidad 30S

Hay 3 factores de iniciacin IF 1,2

2.

< con GTP

mRNA y tRNA se unen a unidad

<

mRNA se une a secuencia


shine-D (AGGA) ligeramente
adelante codn de iniciacin.
Esto coloca al codn de iniciacin
AUG del mRNA en el sitio P
donde se puede unir al anticodon
del tRNA adecuado
3.

La subunidad > se une al


complejo.
El complejo de iniciacin 70S
tiene
f MET-tRNAfmet en el sitio P del
ribosoma.

1. Unin de la subunidad 40s al ARNm, no hay


secuencia de Shine-Dalgarno, sino que el
ribosoma se une al ARNm al reconocer el cap.
2. Unin del ARNt con el aminocido Metionina al
codn de inicio AUG.

En eucariotas
existen 9 factores
de inciacin
denominados eIF1,
eIF2, y un iniciador
especial tRNAMet
eIF2-GTP se une
metionil tRNAMet y
estos a la unidad <
formando complejo
que se une a mRNA.
El tRNA lo rastrea
buscando AUG
(kozac) o de
iniciacin comn,
entonces la

>

se

P (peptidil)
E (liberacin)

A (aminoacil)

En el proceso de ALARGAMIENTO se necesita


Total TRES enlaces de alta energa por cada
Aminocido aadido:
*En la formacin de aminoacil-RNAt
*En la vinculacin del aminoacil-RNAt al sitio A
*En la traslocacin del sitio A al sitio P

El proceso de traduccin puede ser


llevado a cabo por conjuntos de ribosomas
o polirribosomas

INHIBIDOR QUMICO: La estreptomicina provoca que


el aminoacil-RNAt met sea liberado del complejo de inicio
Por lo que se disocia el RNA m, y los ribosomas.
No se forman nuevas cadenas polipeptdicas
y se da la muerte celular

*PROCESO DE TERMINACIN:

Para la terminacin de la sntesis de la cadena se req

1. Reconocimiento de CODONES DE PARO (UAA, UAG


UGA) cuya funcin es concluir el ensamblado de
polipptidos mediante los factores e liberacin RF1 o
UAG RF1
UAA RF1 y RF2
UGA RF2

2. La unin del factor RF3, junto con la hidrlisis de u


GTP provoca la :
Liberacin del ARNm.
Disociacin de los factores RF1 y RF2.
Disociacin de las subunidades ribosmicas.

En

eucariotas las funciones de los


factores EF-Tu y EF-Ts la realiza el
factor eEF1 y la funcin del EF-G
el factor eEF-2.
En eucariotas las funciones de
RF1 y RF2 slo la ejerce el factor
eRF

Factores de
TraduccinProcariotas
Funcin

Eucariotas

Iniciacin

IF-1, IF-2, IF-3

eIF-1, eIF-1A, eIF-2,


eIF-2B, eIF-3, eIF-4A,
eIF-4B, eIF-4E, eIF4G,
eIF-5

Elongacin

EF-Tu, EF-Ts, EF-G

eEF-1a, eEF-1bg,
eEF-2

Terminaci

RF-1, RF-2, RF-3

eRF-1, eRF-3

SINTESIS DE PROTEINAS:
TRADUCCIN

Hebras y direcciones de sntesis Todas las hebras se sintetizan desde el

extremo
5' > > > hacia el extremo 3. Las cadenas de protena se sintetizan desde el
extremo amino > > > hacia el extremo carboxilo.
Regla mnemotcnica para los colores: el extremo Azul es el Antiguo, el
extremo Rojo es el Reciente (donde se van aadiendo residuos nuevos).
El ARN mensajero se sintetiza de forma complementaria y antiparalela a la
hebra molde o plantilla (anticodones) del ADN,
5' > > > - - - - - - T
de modo que el RNAm resultante
Hebra codificante
TC------>>>
consta de codones que
(Codones)
3'
ADN
corresponden a los de la
(DNA)
hebra codificante de ADN.
3'< < < - - - - - - A
Los anticodones del ARNt
adaptan cada codn de 3 bases
del ARNm con el aminocidoARNm
(mRNA)
correspondiente, siguiendo
las reglas del cdigo gentico: ARNt
(tRNA)
Protena

Hebra molde
(Anticodones)

AG------<<<
5'

Mensaje
(Codones)

5' > > > - - - - - - U


UC------>>>
3'

Transferencia
(Anticodones)

3'< < < A A G < <


< 5'

Aminocidos

Amino > > >


Fenilalanina > > >
Carboxilo

Flexibilidad de la tercera base del anticodn, tambaleo

Estudios realizados por Sanger en 1955 con la insulina


pusieron de manifiesto que las propiedades especficas de las
protenas estaban determinadas por su estructura primaria o
secuencia de aminocidos. Sanger adems desarroll las
tcnicas de secuenciacin de protenas y determin la
secuencia de aminocidos de la insulina humana.

La siguiente figura muestra la secuencia de los primeros aminocidos del


extremo amino-terminal de la cadena de las hemoglobinas A y S.
Ingram a la izquierda Secuencia de aminocidos de la cadena b de las
hemoglobinas HbA y HbS

EJEMPLOS

FENILCETONURIA

ANEMIA FALCIFORME

GALACTOSEMIA

Es la incapacidad del organismo para utilizar


(metabolizar) el azcar galactosa
1 por cada 60.000 nacidos
Los individuos con galactosemia no pueden tolerar
ninguna forma de leche (ni humana ni animal) y
deben vigilar cuidadosamente la ingesta de
alimentos con contenido de galactosa.

HIPERCOLESTEROLEMIA
Aferesis LDL

ALBINISMO

ACONDROPLASIA

La causa de esta enfermedad es una mutacin en el gen que codifica para el


receptor 3 del factor de crecimiento fibroblstico (FGFR3), localizado en el
cromosoma 4.
Existen dos mutaciones posibles que afectan a este gen: G1138A y G1138C.
Ambas son puntuales,donde dos pares de bases complementarias del DNA se
intercambian

<>

FIBROSIS QUISTICA Cromosoma 7

RETINITIS PIGMENTOSA

DALTONISMO

Los genes que codifican los pigmentos de los conos verde y rojo se
hallan en el cromosoma X, y el del azul, en el cromosoma 7

HEMOFILIA

nucleotidos

transcripcion

PolimerasadeRNA
mRNA
rRNA
tRNA

traduccion

ribosoma

Aminoacidos

Protenas y Biotecnologa

Actividad: Dramatizacin del proceso de


traduccin
Paso 1: Transcripcin
3 TACCAAGTAGAATGAGGAGTTGTCTTTTCACGACAGTGGCGGGAG

ATACCATTCCATTTACACTTGGTTCAACCGCCTGTTCGTAATCCA

GCAAACATC 5

Actividad: Dramatizacin del proceso


de traduccin
Paso 1: Transcripcin
3 TACCAAGT AGAATGAGGAGTTGTC T T T TCACGACAGTGGCGGGAG
5 AUGGUUCAUCUUACUCCUCAACAGAAAAGUGCUGUCACCGCCCUC

ATACCAT T CCAT T TACACTTGGT T CAACCGCCTGT T CGT AATCCA


UAUGGUAAGGUAAAUGUGAACCAAGUUGGCGGACAAGCAUUAGGU

GCAAACATC 5
CGUUUGUAG3

Actividad: Dramatizacin del proceso


de traduccin
Paso 2: Identificar codones
3 TACCAAGT AGAATGAGGAGTTGTC T T T TCACGACAGTGGCGGGAG
5 AUGGUUCAUCUUACUCCUCAACAGAAAAGUGCUGUCACCGCCCUC

ATACCAT T CCAT T TACACTTGGT T CAACCGCCTGT T CGT AATCCA


UAUGGUAAGGUAAAUGUGAACCAAGUUGGCGGACAAGCAUUAGGU

GCAAACATC 5
CGUUUGUAG3

Actividad:
Paso 3: Leer el mARN por el
ribosoma
5 TACCAAGT AGAATGAGGAGTTGTC T T T TCACGACAGTGGCGGGAG
3 AUGGUUCAUCUUACUCCUCAACAGAAAAGUGCUGUCACCGCCCUC

ATACCAT T CCAT T TACACTTGGT T CAACCGCCTGT T CGT AATCCA


UAUGGUAAGGUAAAUGUGAACCAAGUUGGCGGACAAGCAUUAGGU

GCAAACATC 3
CGUUUGUAG5