Anda di halaman 1dari 38

Murder Mystery:

DNA Sequencing

Science Expo

The story so far


Last night, the STEM students attended an end of the semester
gala on the 6th floor of the STEM building. During the event, a
murder happened. The victim, Alex, was found dead on the 6th
floor balcony. Crime scene investigators found a kiss mark on
his cheek, a few strands of hair, and blood that was splattered
on the victim. He had a stab wound on his neck, presumably
from a high heel shoe. The shoe was left at the scene of the
crime, and fingerprints were lifted off of the heel. There are
three possible suspects: Adrienne, Amanda, and Laina. All
three of these people were seen with Alex at the gala just
before his death. Your job is to determine which of the
suspects was the killer and if this person had an accomplice to
the murder. Your job is to test the lipstick sample that was
found, the hair strands, the blood that was found on the victim
and suspects, and analyze the suspects fingerprints.

What are we analyzing?

DNA identification is one tool law


enforcement teams worldwide use
accurately prove or disprove suspects
DNA evidence can be analyzed using
professional DNA marker analyzation
software and special computing
equipment, much of which is proproritary

The Central Dogma of


Molecular Biology

The central dogma of


molecular biology: first stated
by Francis Crick in 1956.
The information flow in a
biological system.

Francis Crick
1916 - 2004

Information in DNA
DNA sequence contains the information:
DNA sequence: ATAATCGAATGCG
Binary code: 01000101010100001010
Text: This object is red
Due to DNA base pairing, one strand of
DNA is the reverse-complement of the
other strand:
5-ATAATCGAATGCG-3
3-TATTAGCTTACGC-5
Information in RNA: the same, except T is coded
as U

Translate DNA/RNA into


Protein Info

There are about 20 commonly seen amino


acids in any one given organisms.
There are only 4 DNA nucleotides (& also
only 4 nucleotides in RNA)
How many DNA/RNA bases/nucleotides
(i.e., length of the code) are needed to
code at least 20 different amino acids?
1 nucleotide-long code: 4 Proteins
2 nucleotide-long code: 16 Proteins
3 nucleotide-long code: 64 Proteins

The Codon Table

Codon Redundancy:
Lost Information

The forbidden routes: you cannot go from


protein sequence to DNA or DNA
sequence, as the codon redundancy also
means there is lost information from
DNA/RNA to protein sequence.
I.e., 20 amino acids couldnt fully resolve

A Gene?

A stretch of DNA sequence with a defined


function with possibly many different
products.
It is not isolated, but associated with many
regulatory sequences.
Some of these regulatory sequences might
be quite far away in terms of linear DNA
distance.

History in DNA
Sequencing Technology
Manual (late 1970s
late 1980s): a few 102
bp/sample, a few
samples/run
Automated Sanger
Sequencing (1990s
mid 2000s): a few 102
bp/sample, 100
samples/run
Next Generation
Sequencing (NGS)
(2005 current): a few
102 bp/sample, > 106

Promised Impacts
Personalized Medicine
Treatment tailored to your genetic background
Rapid/Remote Diagnostics
Screening against all pathogens at once in one
test
Advanced Therapeutics
New cancer therapies, genetic disorder treatment
Crop Improvement
Discover genes for desirable traits (breeding/GM)

AACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGCAC
TTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAATA
CAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCCC
AAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTC
ACATCACCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAA
GCATCCCCGTTCCAGTGAGTTCACCCTCTAAATCACCACGATCAAAAGGAACAAGCATCAAGCACGCAGC
AATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAA
ACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGA
TTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAACT
CACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACAC
ACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATC
AACAAAACTGCTCGCCAGAACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATC
CCTCTAGAGGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATATA
CCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAAAGACGTTAGGTC
AAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTAT
GAAACTTGTCGAAGGTGGATTTAGCAGTAAACTAAGAGTAGAGTGCTTAGTTGAACAGGGCCCTGACTTG
AGCGCGTACACAAGGACCGCCCGTCACCCTCCTCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTA
TTTATATAGAGGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTA
GCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTAAACCTA
GCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAAAGTATAGGCG

Sequence Knowledge

the sequence needs to be analyzed

Understanding
X:AATCATTGATC
||| |||||||
1:AATGATTGATC
X:AATCATTGATC
||| || | ||
2:AATGATCGTTC
X:AATCATTGATC
||| | ||||
3:AATGA--GATC

What Can DNA Sequence Analysis Do?


Locate the root cause of genetic
disorders, cancer, and infectious
disease.
Locate the genes for antibiotic
resistance and pathogenicity.
Predict disease susceptibility.
Locate genes for desirable traits in
plants/animals.
Locate genes for producing useful
molecules.
Can be used for DNA identification.

Inspecting the DNA

Extracted DNA: in some


clear liquid, in a tube.
Are there any DNA?
What kind of DNA?
Is this the correct DNA
that you want?
Are there any mutations
in there?

DNA Quick Fact


Nucleotide: building
blocks of DNA and
RNA
Different nucleotides:

How can we check the DNA?


Different methods differing in both
speed and efficiency
As seen earlier, this process is
being refined over the years

Measuring the
Optical Density

Check Purity:
Pure DNA has an OD260/OD280 ratio of about 1.8;
Pure RNA has an OD260/OD280 ratio of about 2.0.
Low ratios: possible contamination (e.g. protein).

Gel Electrophoresis

In a gel electrophoresis,
DNA migrates to the
positively charged pole
in a electric field.
Why?
Different migration
speeds.
What factors determine
the speed of the migrate
in the gel slab?

A Rough Check on DNA Sequence:


Restriction Enzyme Digestion &
Gel Electrophoresis

Restriction enzyme:
Aka: restriction
endonuclease

Enzymes that cut


(digest) DNA at specific
recognition nucleotide
sequences:
Restriction cognition
sites

A Rough Check on DNA Sequence:


Restriction Enzyme Digestion &
Gel Electrophoresis

Different molecules
will have different
sequences:
Different cut sites
for different REs.
Cut into different
number of pieces,
of different length.
A rough way to
distinguish different
DNA molecules.

The Ultimate Checking


Method: Sequencing

DNA sequencing: determine the exact nucleotide


sequence of a DNA molecule.
Example: ATAATCGAATGCG
Method?

The Sanger
Sequencing Method
Developed
by Frederick
Sanger in
1977.

The Sanger
Sequencing Method

Easy to automate.
The most widely used
DNA sequencing
method for over 25
years.
Recently, the Next
Generation
Sequencing (NGS)
technologies have
surpassed this
method.

Sanger Capillary Sequencer

Use capillary electrophoresis and


florescent dye-labeled ddTNPs.
Automated.

Understanding By
Matching

SeqX

X:AATCATTGATC
||| |||||||
1:AATGATTGATC
X:AATCATTGATC
||| || | ||
2:AATGATCGTTC

Seq1
Seq2
Seq3

X:AATCATTGATC
||| | ||||
3:AATGA--GATC

Using Diagnostic Tools

NCBI Blast
NCBI:
National
Center for
Biotechnology
Information.
BLAST: Basic
Local
Alignment
Search Tool

Lets Try it Out!


Turn on the computer and open up
a web browser to head to Google
Locate the program called
FinchTV and open it

Understanding
BLAST Results

Best Result

Understanding
BLAST Results

Not the Best Result

Viewing Chromotographs

More Than Just Base Pairs

Quality score.
Measures how certain/confident of the signal.

Identifying the Suspects


Visual Comparison of the DNA
Who do you think is suspect from
these samples?