Anda di halaman 1dari 109

Bioteknologi

Protein Rekombinan
Ambar Listyorini
Asraq Fahruzzaman
Badriyatun Nimah
Ervina Octaviani
Fitrahtunnnisah
Haka Asda
Hesti Sulistiorini
Marrisa
Muhammad Akbar
Najmah Mumtazah
Pidia Awalia N
Primo Bittaqwa
Putri Agni K
Ratih Dara Syadillah
Silviana Adhitya
Tri Wahyuni
Ummum Nada
Vishilpy Dimalia

Kelompok 2 AC
Protein Rekombinan
Rekombinan protein adalah suatu bentuk
manipulasi dari protein, yang dihasilkan dalam
berbagai cara untuk menghasilkan sejumlah
besar protein, memodifikasi urutan gen dan
memproduksi produk komersial yang
bermanfaat.
Protein rekombinan merupakan protein yang
diperoleh dari hasil teknologi DNA rekombinan.
Melalui teknologi DNA rekombinan dapat
dilakukan pemindahan gen pengode
enzim/protein dari satu organism ke
organisme lain.
TEKNIK PRODUKSI
PROTEIN REKOMBINAN
ISOLASI DNA GENOM, RNA TOTAL DAN
POLY(A) RNA
DNA genom berupa untai ganda dan dapat diisolasi dari
sel jenis apapun, termasuk bakteri, ragi, tanaman dan
binatang.
Hasil isolasi DNA yang diinginkan adalah DNA seutuh
mungkin, tidak rusak dan memiliki berat molekul tinggi.

Beberapa jenis RNA dapat ditemukan dalam sel, termasuk


messenger RNA (mRNA), ribosomal RNA (rRNA), transfer
RNA (tRNA) dan lain-lain. Kebanyakan studi (Northern blot,
RT-PCR) cukup menggunakan hasil isolasi RNA seluler total.

Untuk beberapa aplikasi, total RNA seluler tidak cukup


baik digunakan. Dari total RNA sebagian besar berupa
rRNA, sedangkan mRNA hanya 1- 3%.
1. Isolasi DNA Genom
Total
Suspensi sel-yang-
mengandung-DNA
diinkubasi dengan deterjen
dan atau enzim yang
berfungsi untuk melisis
sel/inti
DNA kemudian dikeringkan
dan dilarutkan kembali dalam
air dengan buffer tertentu
(Tris-HCl atau Tris-EDTA) dan
akan stabil selama beberapa
mendisosiasi DNA dari tahun.
protein (misalnya histon)
menggunakan enzim yang
dapat mendegradasi protein
(proteinase K).

DNA dipresipitasi dengan


etanol
Protein yang terdegradasi
sebagian, dihilangkan dari Dengan cara ini biasanya DNA
dengan BM tinggi (misalnya
larutan dengan cara ekstraksi
fenol/kloroform, presipitasi DNA genom manusia) akan
dengan garam, atau dengan membentuk threads (rantai)
melewatkan larutan melalui dan dapat ditarik dari larutan
kolom yang akan menahan menggunakan batang gelas.
DNA
2. Isolasi RNA Seluler
Total
Selama isolasi
RNA, sel atau
jaringan
dihomogenisa
sikan dalam RNA
larutan yang dipurifikasi
mengandung Pemisahan RNA dan
senyawa yang dari DNA genom. dipresipitasi
dapat dengan
menghambat etanol
kerja RNAse,
misalnya
guanidium
isotiosianat..
3. Isolasi mRNA
Hampir semua mRNA mengandung adenilat
(poly-adenilated/polyA RNA), sehingga sifat
ini dapat digunakan untuk menangkap dan
mengisolasi mRNA.

. Total RNA seluler dilewatkan melalui


kolom atau resin polydeoxythymine (kolom
oligodT, polydT) yang terikat pada fase padat.

RNA yang tidak terikat akan hilang tercuci,


sedangkan poly(A) RNA dapat dielusi pada
tahap berikutnya
Analisis DNA dan RNA
Pemisahan DNA dan RNA berdasarkan
ukuran dengan
elektroforesis pada sistem gel

Southern blot. DNA genom diisolasi


dan
digesti dengan enzim restriksi. DNA
kemudian dirun pada
gel agarose dan ditransfer ke
membran di mana DNA
kemudian diikatkan secara kovalen.
DNA selanjutnya
dihibridisasi menggunakan probe
yang dilabel.
Interaksi antara DNA dan probe yang
dilabel dideteksi
dengan cara memajangkan DNA-
membran ke film
Northern blotting.
Beberapa hal yang membedakan dengan Southern
blotting adalah:
RNA jauh lebih rentan terhadap degradasi dibanding DNA, oleh
(1)
karena itu elektroforesis dilakukan dalam bufer yang
mengandung zat kimia yang bersifat melindungi (biasanya
formaldehid),
RNA sudah berupa untai tunggal dan membutuhkan kondisi
(2)
denaturasi yang lebih ringan,
RNA biasanya berukuran tertentu sehingga tidak memelukan
(3)
digesti enzim untuk memperoleh pola pita. Kedua prosedur
sangat mirip karena setelah elektroforesis RNA juga ditransfer ke
membran melalui difusi kapilaritas. Biasanya sinar UV digunakan
untuk mengikat (crosslink) RNA pada membran sehingga tidak
bergerak (imobilisasi)
Sekuensing
Ekspresi Rekombinan
Protein
Host
Vector
Tag
Purifikasi
SKEMA
Sistem Ekspresi
Translasi in vitro (in vitro translation) protein
rekombinan

Cara yang
paling
sederhana
Menggunakan
lisat retikulosit
(reticulocyte
lysates)

http://images.the-scientist.
Ekspresi protein rekombinan dalam E.
Coli
Paling baik digunakan untuk ekspresi protein
intraseluler yang relatif kecil dan tidak memerlukan
modifikasi pascatranslasi (posttraslational modification)
yang terlalu banyak untuk dapat berfungsi.
Menambahkan label/marka (tag) yang telah dipurifikasi
kepada protein yang diekspresikan untuk memudahkan
menemukan protein setelah diekspresikan.
Marka yang banyak digunakan adalah glutation-
Stransferase (GST) yang dapat diisolasi menggunakan
kolom glutation atau marka histidin untuk isolasi
menggunakan kolom nikel.
Kerugiannya :
ketidakmampuan
untuk melakukan
prosessing kompleks
seperti glikosilasi
beberapa protein
bersifat labil (atau
toksik) pada hospes.
protein yang besar
biasanya tidak
diproduksi atau tidak
terlipat (folding)
dengan efisien.
Keuntungan sistem
ekspresi pada E.
coli :
- mudah untuk
melakukan
manipulasi DNA
rekombinan (mirip
seperti kloning
plasmid) dan
Yeast protein expression systems Saccharomyces
cerevisiae

Sistem genetik yang sangat berkembang,


penggunaannya mudah, berkurangnya waktu dan
biaya membuat S. Cerevisiae menjadi organisme
yang menarik untuk diekspresikan dan memproduksi
protein rekombinan.
Ragi mampu membawa plasmid yang dirancang
khusus dan kemampuan ini berfungsi dalam sistem
ekspresi protein rekombinan. Plasmid terdiri dari
situs restriksi yang dapat digunakan untuk
memasukkan urutan gen yang diinginkan.
Transformasi dari ragi dengan plasmid menghasilkan
protein yang diinginkan dan dapat ditingkatkan.
Features
low cost culture
methods
suitable for both
intracellular and
secreted proteins
provides
eukaryotic post-
translational
glycosylation of
proteins although
it results in high
Ekspresi protein rekombinan dengan
bantuan baculovirus

Ekspresi yang dibantu


oleh baculovirus dalam
sel serangga adalah satu
cara lain yang umum
digunakan untuk ekspresi
protein rekombinan.
Tingkat ekspresi yang
tinggi akan memudahkan
purifikasi, kecuali jika
terjadi agregasi. Namun,
untuk melakukan seleksi
dan rekombinasi
sejumlah besar protein
Ekspresi protein rekombinan
dengan bantuan baculovirus
Ekspresi pada galur sel mamalia
Sangat jarang dapat menproduksi protein
seefisien E. coli atau Baculovirus, salah satu
kelebihannya adalah mampu memproses
polipeptida kompleks menggunakan mesin
intraseluler yang sesuai.
Prosesing peptida, folding, atau glikosilasi
dapat dilakukan dengan tepat, untuk
mengekspresi protein tertentu seringkali
diperlukan kondisi yang hanya dapat dicapai
dengan menggunakan sel homolog atau
jaringan khusus (tissue specific).
Features
transient
expression is easy
and rapid
provide all the
post-translational
modifications found
in mammalian cells
stable transfection
results in higher
yield, scalability
and reproducible
production
www.uq.edu.au
Ekspresi menggunakan vektor adenovirus

Vektor adenovirus sangat menarik karena telah


menginfeksi berbagai macam sel mamalia dan
karena genom adenovirus telah dapat diubah
menghasilkan virus yang tidak mampu mereplikasi
dan dapat membawa sekuens manusia.
Adenovirus telah banyak digunakan untuk
mengekspresikan protein rekombinan pada sel dan
jaringan yang sulit ditransfer.
Penggunaan adenovirus sebagai vektor untuk
terapi gen juga menjadikan sistem ini sangat
menarik untuk ekspresi gen.
Memasukkan vektor virus yang mengandung gen
yang dikehendaki ke dalam sel 293 yang
mengekspresikan E1a memungkinkan untuk
mengemas dan memanen virus serta virus tidak
ber-replikasi pada sel lain. Vektor adenovirus telah
digunakan untuk mengekspresikan :
1. gen normal pada organ yang defektif (misalnya
ekspresi CFTR pada penderita cystic fibrosis)
2. gen yang toksik pada tumor (misalnya timidin
kinase pada tumor otak)
3. untuk mentarget gen cell-cycle arrest pada sel
vaskuler yang sedang berproliferasi.
Keterbatasan adenovirus antara lain :
ketidakmampuannya untuk menerima DNA asing
>10 kb, jangka waktu ekspresinya relatif pendek in
vivo (beberapa minggu sampai bulan), toksik
terhadap sel, dan menginduksi respon imun.
Pilihan Host untuk Amplifikasi protein

Sistem host tersedia dalam beberapa bentuk termasuk fag,


bakteri, ragi, tumbuhan, jamur berserabut, serangga atau sel
mamalia yang tumbuh dalam kultur dan hewan transgenik.
Pilihan terakhir dari host akan bergantung pada persyaratan
yang spesifik dan aplikasi untuk protein rekombinan. Pemilihan
host tidak hanya mempengaruhi amplifikasi dan isolasi dari
protein, tetapi juga cara dimana produk kemudian dapat
dimurnikan.
Dalam rangka untuk memutuskan host mana yang paling cocok
dalam jumlah dan tingkat kemurnian produk serta integritas
biologis dan potensi toksisitas sebaiknya dipertimbangkan.
Sebagai contoh, system ekspresi bakteri tidak cocok jika
modifikasi pasca-translasi diperlukan untuk menghasilkan
produk rekombinan yang dapat berfungsi penuh.
Lokasi produk dalam host akan
mempengaruhi pilihan metode untuk
isolasi dan pemurnian dari produk.
Sebagai contoh, sebuah host bakteri
dapat mensekresikan protein ke dalam
media pertumbuhan, mentransportnya
ke dalam ruang periplasmik atau
menyimpannya sebagai badan inklusi
yang tidak dapat larut dalam sitoplasma.
Keuntungan DNA
rekombinan
Bidang kesehatan Bidang peertanian
Produksi insulin Menurut situs dari Human Genome Project, pada
Penggunaan insulin untuk pasien diabetes dalam 2006. pentanit idak perlu menggunanakan
memproduksi insulin sangatlah banyak sehingga herbisida kimia lagi untuk mengusir serangga
untuk mendapatkannya dibutuhkan inulin dari pengganggu. Sehingga menekan menekan
pankreas sapi atau babi yang cukup banyak pula. pengeluaran biaya untuk pembelian pestisida.
Tetapi dengan teknologi DNA rekombinan telah Dan menekan penggunaan pestisida yang
memungkinkan para ilmuwan untuk berlebihan dalam pengendalian hama dan
mengembangkan insulin manusia sintetis. penyakit.
Mutasi
tahan terhadap serangan penyakit
Menggantikan gen yang rusak dengan gen yang tanaman.
sehat Sehingga gen yang telah disisipi oleh gen yang
sehat akan memulai fungsinya sehingga pasien . Para pakar fitopatologi telah banyak
dapat normal menemukan beberapa varietas tanaman hasil
Kanker rekayasa genetika yang tahan terhadap
seranagan penyakit.
mencegah pertumbuhan sel yang tidak terkontrol
dengan cara dapat mengaktifkan dan menonaktifkan pengembangan padi yang berisi tingkat
sel yang berkembang biak peningkatan besi dan vitamin, untuk digunakan
Vaksin di negara-negara Asia di mana kekurangan gizi
Vaksin disisipkan pada produk tanaman seperti pada
kronis.
tanaman tomat atau kentang sehingga dalam proses Meningkatkan efisiensi fotosintesis, sehingga
pengiriman dan penyimpanan, dibandingkan dengan hasil panen dengan mengkonversi tanaman C3
vaksin injeksi. dan C4 oleh rekombinasi genetik
Kerugian DNA rekombinan
Bidang kesehatan Bidang pertanian
Kekhawatiran kesehatan Kekhawatiran etis
penggunaan DNA rekombinan dalam Teknologi ini juga menimbulkan kekhawatiran
etis, terutama ketika gen manusia dimasukkan ke
produk makanan mengkhawatirkan Efek dalam organisme bukan manusia yang kemudian
jangka panjang pada kesehatan manusia menjadi sebagian manusia. Di Cina, DNA manusia
masih belum diketahui dan dipastikan sedang ditempatkan dalam tomat dan paprika
keamanannya. Menurut profesor Inggris untuk mempercepat pertumbuhan mereka.
Timbul pertanyaan: Apakah makan tomat yang
Mae Wan-Ho, DNA rekombinan dapat
mengandung DNA manusia membuat Anda
membahayakan karena memasukkan kanibal?
gen asing ke dalam genom. hal ini dapat Penurunan efektifitas dari pestisida. Penggunaan
menimbulkan efek berbahaya dan fatal, tumbuhan yang tahan terhadap hama secara
termasuk kanker. terus menerus dapat menstimulir munculnya
gen-gen baru hama yang tahan/resisten terhadap
Terjadinya reaksi alergi.
beberapa jenis pestisida.
Intoduksi gen tertentu seperti gen Transfer gen kepada spesies yang tidak menjadi
kacang-kacangan ke dalam tanaman target. Kasus munculnya superweeds yang
kedelai dapat menimbulkan reaksi allergi sangat resisten terhadap herbisida akibat
yang berpengaruh terhadap ketahanan penggunaan rekayasa genetika (soybean
roundup). Hal ini terjadi karena adanya transfer
tubuh. gen dari tumbuhan ke gulma.
KERUGIAN
PERTIMBANGAN EKONOMI
Penggunaan dinilai tidak ekonomis dan merugikan
petani, karena untuk menghasilkan membutuhkan
biaya yang tinggi dan selanjutnya biasanya dipatenkan
oleh penciptanya. Biaya penelitian dan hak paten
Produk hasil DNA rekombinan akan dibebankan kepada
pengguna (petani) melalui penjualan yang mahal.
Selain itu, Produk hasil DNA rekombinan pada
umumnya tidak menghasilkan keturunan dan
digunakan hanya satu kali tanam. Kondisi ini tentunya
menimbulkan ketergantungan yang tinggi petani
terhadap benih oleh perusahaan penghasil
PERBEDAAN BIOTEKNOLOGI
KONVENSIONAL DAN MODERN
Menurut the United Nation Convention on Biological
Diversity, terminologi bioteknologi diartikan sebagai
teknologi aplikatif yang memanfaatkan sistem biologi,
organisme-organisme hidup atau turunannya guna
menyempurnakan produk atau proses untuk
kepentingan spesifik.
Konvensional Modern
- menerapkan biologi, biokimia, telah menggunakan teknik rekayasa
atau rekayasa masih dalam tingkat tinggi dan terarah sehingga
hasilnya dapat dikendalikan dengan
tingkat yang terbatas.
baik.
- menggunakan jasad hidup Teknik yang sering digunakan adalah
secara utuh. dengan melakukan manipulasi
- contoh, di bidang teknologi genetik pada suatu jasad hidup
pangan adalah pembuatan bir, misal rekayasa genetika, kultur
roti, maupun keju yang sudah jaringan, rekombinan DNA,
pengembangbiakan sel induk,
dikenal sejak abad ke-19. kloning, dan lain-lain.
- Di bidang medis, penerapan Teknologi ini memungkinkan untuk
bioteknologi di masa lalu memperoleh penyembuhan penyakit-
dibuktikan antara lain dengan penyakit genetik maupun kronis yang
penemuan vaksin, antibiotik, belum dapat disembuhkan, seperti
dan insulin walaupun masih kanker ataupun AIDS.
Beberapa prinsip dasar dalam
dalam jumlah yang terbatas
rekayasa genetika, yaitu DNA
akibat proses fermentasi yang rekombinan, fusi protoplasma, dan
tidak sempurna. kultur jaringan.
PERBEDAAN BIOTEKNOLOGI KONVENSIONAL DAN
MODERN

Konvensional
Modern
Memakai makhluk hidup dan
komponennya secara langsung
Langsung menggunakan Menggunakan prinsip-prinsip ilmiah
makhluk hidup dan belum Hasil pengkajian berbagi disiplin
mengetahui penggunaan enzim ilmu yg mendalam
Tanpa didasari prinsip ilmiah Diproduksi secara masal
Berdasarkan keterampilan yang Mengupayakan membuat produk
diwariskan turun temurun dengan efektif dan efisien
Tidak sepenuhnya diproduksi Didasarkan pada manipulasi atau
secara masal teknik DNA disamping
menggunakan dasar mikrobiologi
Bioteknologi yang
dan biokimia
menggunakan mikroorganisme
Tidak hanya digunakan pada
untuk memproduksi alkohol,
industri makanan namun juga telah
asam asetat, tempe, tahu,
meliputi banyak bidang, seperti
oncom, dll
teknik genetik.
Dengan beragamnya penelitian dan
perkembangan keilmuan serta
teknologi, keuntungan yang lebih
Contoh-contoh
Hormon
Contoh: Hormon Insulin. Penderita penyakit Diabetes mellitus
kekurangan hormon insulin sehingga kadar gula dalam darahnya
sangat tinggi. Dengan adanya bioteknologi, saat ini hormon
insulin telah dapat dihasilkan secara buatan (transgenik) dengan
bantuan bakteri Escherichia coli. Pembuatan insulin dilakukan
dengan menyisipkan gen insulin ke dalam bakteri. Pada sel
bakteri E. coli, dimasukkan DNA sel manusia yang mengandung
gen insulin sehingga bakteri E. coli dapat menghasilkan insulin.
Karena bakteri dapat berkembang biak dengan cepat maka
hormon insulin pun dapat dihasilkan dalam jumlah yang banyak.
Kini, insulin mudah didapatkan oleh penderita diabetes mellitus
dalam bentuk cair.
Vaksin
Contoh: Vaksin Hepatitis B dan malaria. Secara konvensional
pelemahan kuman dilakukan dengan pemanasan atau
pemberian bahan kimia. Dengan bioteknologi dilakukan fusi
atau transplantasi gen.
Contoh Produk Farmasi Berbasis
Bioteknologi Protein Rekombinan
ABSTR
AK
PENDAHULUAN
Human Growth Hormone
(hGH)
Eschericia coli
Sistem promotor
Tujuan Penelitian
Bahan dan Metode
E. coli galur DH5 studi transformasi, propagasi dan ekspresi

pBAD24

Plasmid studi kloning dan


ekspresi

modified vektor pBAD24, pBAD24M


Dr. Yasuda, Institute of Genetics, Jepang

Enzim restriksi Bangalore Genei, Bangalore India

L+arabinosa Hi Media, Mumbai, India

Antibodi poliklonal anti-hGH Abexome Life Sciences, Bangalore, India

ahan kimia lainnya dan oligos Sigma, USA

Gen hGH GenScript, USA

hGH reseptor dan rhGH komersial R & D Systems, USA


Kloning dan ekspresi hGH pada vektor pBAD24
dan pBAD24M
Gen hGH diamplifikasi PCR
menggunakan gen hGH sintetis
sebagai template untuk
menghasilkan produk PCR dari
585 bp
Pemendekan EcoRI / HindIII
produk PCR diligasi ke vektor
pBAD24
aliquot lain dari produk PCR
dipendekkan dengan NdeI /
HindIII dan diikat ke vektor
pBAD24M
transformasi sel DH5

rekombinan dipilih oleh koloni


PCR yang menggunakan
primer spesifik gen hGH
Kloning dan ekspresi hGH pada vektor pBAD24
dan pBAD24M

Sel E. coli DH5 yang mengandung


baik pBAD24-hGH atau rekombinan
pBAD24M-hGH ditumbuhkan dalam
LB dengan ampisilin 100 mg ml-1 dan
diinduksi dengan 13 mM arabinosa
selama 4 jam pada suhu 37oC

sel-sel yang diinduksi dipanen dan


dipisahkan antara fraksi yang larut dan
fraksi yang tidak larut

Kedua fraksi dianalisis pada 12,5% SDS-


PAGE dan divisualisasikan dengan
Coomassie Blue Staining
Penentuan hasil hGH menggunakan densitometri

Pita protein hGH pada gel


poliakrilamida Coomassie blue-
stained

dikuantitatif (diperbanyak)
menggunakan sistem Bio Rad Imager

Hasil hGH ditentukan dengan membandingkan


angka pita monomer rhGH dengan jumlah
standar BSA run di gel yang sama.
Studi bioreaktor
Bibit Inokulum disiapkan dengan
menginokulasi E. coli DH5cells yang
membawa plasmid pBAD24-hGH atau
pBAD24M-hGH, pada media LB dan
ditumbuhkan selama 16 jam pada suhu 37 C
dengan agitasipada 200 rpm
Fermentasi dilakukan dalam 5L bioreaktor
(Sartorius, Jerman) untuk mencapai
ekspresi rhGH tingkat tinggi dan dalam
medium 2,5 L

Medium fermentasi diinokulasi dengan


overnight seed cultur pada 10% v / v. Aerasi
disimpan pada 1 vvm (volume udara /
volume fermentasi menengah / menit) dan
suhu dipertahankan pada 37 C
Studi bioreaktor

Agitasi ditetapkan antara 300-800 rpm,


tingkat oksigen terlarut dipertahankan pada
30% dengan penambahan otomatis oksigen
murni ke udara yang dikendalikan oleh
pengontrol aliran massa pada instrumen

Fermentasi dilakukan pada pH 7,00 yang


dikendalikan dengan penambahan
otomatis 30% H3PO3 atau 12% NH4OH
dan foaming dikendalikan dengan
penambahan 0,05% antifoam US 1510

Kultur yang tumbuh diinduksi pada OD600


dari 10 sampai 15 dengan penambahan 13
mM L + arabinosa
Studi bioreaktor

Biomassa dicapai pada akhir lima jam pasca


induksi diukur dengan memperkirakan berat
sel basah (WCW) per liter dari medium
fermentasi

Untuk isolasi hGH dari broth fermentasi,


broth yang sudah dipanen disentrifugasi
pada 8000 rpm selama 10 menit dan pelet
sel yang diinduksi ~ 140 g sel basah
disangga pada 10 mM Tris buffer pH 8,0 dan
volume suspensi sel dibuat untuk 1 L

Proses pengacauan sel dilakukan pada 900-


1000 bar pada homogenizer tekanan tinggi
dan dilakukan selama tiga bagian
Studi bioreaktor

Lisat sel yang diperoleh disentrifugasi pada


10.000 rpm selama 15 menit untuk
memisahkan fraksi larut dan tidak larut

Setiap fraksi dianalisis pada SDS-PAGE


diikuti dengan metode pewarnaan
Coomassie R250

Total protein diperkirakan dengan metode BCA


(Thermo Scientific, USA) sedangkan scanning
densitometer dilakukan untuk memperkirakan
jumlah hGH yang dicapai bersama dengan
perhitungan persentase kemurnian dari incluion
bodies.
Purifikasi dan Analisis dari rhGH murni
Purifikasi dan Analisis dari rhGH murni
Mengkarakterisasi dari rHGH murni
Mengkarakterisasi dari rHGH murni
Aktivitas Biologi dari rhGH
HASIL
Pemilihan pBAD24-hGH dan
pBAD 24M-hGH rekombinan

PRIMER pBAD24-hGH pBAD24M-


Dari hasil PCR menunjukan hGH
bahwa pBAD 24M-hGH (Line
2) terlihat tingkat pita yang
terbentuk lebih tinggi dari
primer (M), dan hasil PCR ini
menunjukan bahwa gen hGH
telah disisipkan kedalam
vektor. sedangkan pBAD24-
hGH terihat tidak adanya
perubahan signifikan (line 1)

pBAD24M-hGH
Hasil Ekspresi rhGH dalam
Biorekator
Pada proses fermentasi pBAD24-hGH dan pBAD 24M-hGH dengan keadaan lingkungan
yang sama, terlihat pola pertumbuhan yang sama tetapi tingkat ekspresi rhGH pada
pBAD24MhGH hampir 25x lebih tinggi dibandingkan dengan pBAD24-hGH (gambar 3).
Dan nilai OD rHG pada pBAD24-hGH hanya 75 mg/mL dan pada pBAD24MhGH
sebanyak 1.862 mg/Ml dengan kondisi yang sama (tabel 1)ketika diukur dengan
densitometer, hasil penelitian menunjukan badan inklusi pada pBAD24- hGH hanya
1,8% sedangkan pada pBAD24M-hGH sebanyak 59% dari total protein
Purifikasi dari bakteri Hgh
pada proses purifikasi, dilakukan
dua proses, yaitu
1. Menggunakan ion Q
Sepharose FF , menghasilkan
Hgh dengan tingkat
kemurnian 66%. karena
adanya muatan negatif pada
proses ini juga menghapus
kontaminan dari DNA host
2. hGh dimasukan kedam kolom
(SP sepharose FF) dan protein
yang masih terikat dan dielusi
sehingga mendapatkan
tingkat kemurnian yang tinggi
>95%, dengan peroehan
kembai 40%
Karakterisasi rhGH murni
Pada proses karakterisasi rhGH murni
dimana, terdapat 3 proses, yaitu :
1. menggunakan proses
Squencing N-terminal dimana urutan
Pada rhGH yang didapat cocok dengan N-
terminal pada growth hormon manusia
2. Menggunakan MALDI-TOF/TOF dan
menunjukan adanya 86% karakterisitik
peptida untuk somatotropin manusia.
menggunakan
Bioanaizer Agilent
2100 dengan
waktu retensi yang
rHgh murni
sama dengan
komersial
somatotropin
komersial
menunjukan nilai
CD (Circular
dichroism) 85%
pada peneitian ini
aktivitas biologi
dari rhGH yang
telah dimurnikan
memiliki aktivitas
yang hampir
sama dengan
somatotropin Keterangan
yang tersedia Hitam : Hgh komersial
Putih : hasil Hgh yang telah
secara komersial. dimurnikan
DISCUSSION
Penyediaan supply dari
hGH yang stabil
diperlukan secara terus-
menerus
Dan pengembangan
produksi hGH yang hemat
biaya (cost-effective) dan
juga yang bermutu tinggi
sangat diperlukan untuk
pembuatan produk hGH
skala besar pada industri
farmasi
hGH expression

Ekspresi hGH menggunakan promoter arabinose


pada E.coli :
Terjadi di daerah periplasmic E.coli
Vektor pBAD yang termodifikasi menghasilkan
rendemen dari ekspresi rhGH dalam kadar
yang tinggi jika dibandingkan dengan
menggunakan vektor pBAD24
Peningkatan rendemen ini karena : hasil
sequence yang efisien dan adanya peningkat
translasi yang digabung dalam vektor
pBAD24M
Purifikasi hGH

Penulis menggunakan strain Beberapa peneliti yang


E.coli K12 untuk ekspresi melakukan percobaan purifikasi
rhGH dengan berbagai metode
Teknik ini tidak memungkinkan purifikasi kebanyakan
untuk produksi dalam skala menghasilkan rendemen yang
besar dan juga penggunaan masih sangat sedikit (sekitar 19
strain E.coli K12 dengan % : yang dilakukan Niimi dkk,
1987)
arabinose merupakan
alternatif yang bagus Penulis ini menggunakan metode
purifikasi rhGH yang
Sebagian besar ekspresi rhGH menggunakan sistem promoter
yang diketahui sebagai arabinose dengan inklusi bakteri
periplasmic protein, degradasi mencapai 750 mg l-1 yang
rhGH yang terekspresi tidak merupakan hasil tertinggi hingga
saat ini
dapat dihindari akibat adanya
beberapa enzim protease yang
terdapat di area periplasmik
hal ini yang menjadi tantangan
dalam proses hilir selanjutnya
Bentuk hGH
Bentuk olligomerik GH memiliki bioaktivitas yang
lebih kecil dibanding bentuk monomeriknya
Data yang ditampilkan dalam jurnal ini mengenai :
pengamatan bentuk tunggal dari monomer rhGH
tanpa dimer yang menunjukkan potensi sistem
ekspresi untuk skala besar produksi rhGH
Data ini juga menunjukkan bentuk peak tunggal
pada Agilent 2100 bioanalyzer dengan waktu
retensi yang sesuai dengan GH komersial yang
mengindikasikan bahwa alat ini dapat digunakan
untuk menilai kemurnian dari proses preparasi
rekombinan protein
Perbedaan kecil dari perpanjangan asam
amino ditemukan dapat menyebabkan
perubahan dalam laju ekspresi rhGH
Dan hal ini dicapai dengan adanya 20 gen
berbeda dari hGH dengan urutan Met-Xxx-
Glu-Glu-hGH, dimana Xxx menandakan 20
asam amino berbeda yang membuat
peneliti harus melakukan upaya lanjutan
untuk meningkatkan jumlah ekspresi hGH
menggunakan teknik yang berbeda
Kesimpulan
Penelitian ini telah menunjukkan perbandingan
karaktersitik biokimia dari rhGH yang berasal dari
bakteri dengan standar rhGH dengan menguji
urutan N-terminal, MALDI-TOF/TOF, CD spectra dan
Agilent 2100 bioanalyzer.
Pengamatan dari rhGH yang telah dimurnikan yang
diperoleh dari penelitian ini menunjukkan
bioaktivitas yang sama yang dibandingkan dengan
rhGH komersial
Proses yang dilakukan dalam penelitian ini sangat
sederhana dan dengan biaya minimal untuk
produksi skala industri (besar)
PENDAHULUAN

tPa ??
Merupakan salah satu dari empat jenis aktivator plasminogen
(urokinase, streptokinase, tPa, dan DSPA1)
Diproduksi di dinding hati dan pada pembulu darah
Merupakan enzim dengan berat molekul 72kD dan tersusun
dari 527 asam amino
Merupakan enzim yang terlibat dalam proses pemecahan
gumpalan darah dengan mengkatalisis konversi plasminogen
menjadi plasmin
Hasil rekombinannya banyak digunakan untuk pengobatan
penyakit jantung dan oklusi pembulu darah otak
Mengapa Dikembangkan Teknik
Rekombinan tPa?
Keuntungan Menggunakan Teknik
Molekuler Farming
Molekuler Farming
adalah suatu proses
penggunaan
tanaman dan hewan
yang direkayasan
secara genetis
sebagai suatu materi
baru dan
termodifikasi
(Davies and
Chambers, 2000)

(Norris, 2005)
Bahan dan Metode
Plasmid dan Bakteri
Transformasi Mentimun
Analisis PCR dan RT-PCR
Karena tanaman resisten terhadap antibiotik kanamisin
mungkin tidak benar untuk tanaman reansgenik-untuk
contoh, sel-sel tumbuhan hanya menerima vektor
(tanpa tPA gen) reaksi PCR digunakan untuk
mengkonfirmasikan keberadaan gen. Ekstraksi DNA
dari daun mentimun muda segar diregenerasi pada
medium selektif yang dilakukan melalui Metode CTAB.
Keberadaan gen tPA diselidiki dalam sel tumbuhan
mentimun yang diregenerasi pada media selektif
dengan reaksi PCR dan tPA gen spesifik primer.
Urutan dari primer adalah sebagai berikut:

F -tPA: 5GAGTCTAGATAAACAATGGATGCAATGAAGAGAGGG 3
R-tPA: 5ATAGTCAACTCATAGCTCATCTTTCGGTCGCATGTTG 3

Kondisi yang diperlukan untuk proliferasi DNA dari gen tPA termasuk
denaturasi awal 180s/950C, 35 siklus denaturasi 60s/950C, annealing 30s/600C,
dan elongasi 120s/720C. Produk PCR diperiksa pada 1% gel agarose dan Gelred.
Daun muda mentimun transgenik dan larutan RNX-Plus (Synagene, Inc)
digunakan untuk ekstraksi RNA. Pembangunan cDNA dilakukan
menggunakan kit ekstraksi cDNA (Fermentase Co).
Reverse-transkripsi (RT) -CR reaksi dan primer spesifik (dirancang dari gen tengah)
yang digunakan untuk ekspresi gen tPA di sel tumbuhan mentimun transgenik.
Urutan primer adalah sebagai berikut:

F -tPA: 5TGGGGAACCACAACTACTGCAGAAAC 3
R-tPA: 5GAAACCTCTCCTGGAAGCAGTGGG 3

Kondisi untuk amplifikasi cDNA gen tPA termasuk prime


dengan denaturasi 180s/950C, 35 siklus tiga langkah denaturasi 60s/950C,
annealing 45s/600C, dan elongasi 40s/720C.
Dot Blot Enzyme
Imunoassay
Analisa SDS-PAGE
Untuk mendeteksi massa molekul dari protein rekombinan
tPA (terhadap protein lain yang diproduksi pada tumbuhan
ketimun transgenik yang dibandingkan dengan tumbuhan
non-transgenik), dilakukan elektroforesis gel poliakrilamid
(PAGE).

Metode simpel ini mempunyai pemecahan yang tepat


untuk identifikasi dan kemurnian protein secara spesifik.
Pada penelitian ini, metode sodium dedocyl sulfat (SDS)
PAGE dengan sedikit modifikasi digunakan untuk
elektroforesis protein.

Gel terdiri dari dua bagian :


a) pemisahan gel dengan konsentrasi 12,5 % dan
b) pengahambatan gel dengan konsentrasi 4%.

) Untuk menyiapkan gel ini, dibutuhkan akrilamid,


bisakrilamid, SDS, tris dan TEMED yang telah digunakan.
Di akhir proses elektroforesis, pewarnaan dan pemutihan
Enzymed Linked
Imunosorbent Assay
ELISA telah digunakan untuk penetuan secara kuantitas dari
protein rekombinan tPA relatif terhadap protein terlarut pada
tanaman ketimun transgenic

Tujuannya, setelah penentuan densitas dari protein yang telah


diekstrak pada tanaman transgenik maupun daun non transgenik
dengan spektrofotometer, 50 ng setiap sampel ditempatkan pada
piring dengan 5 kali pengulangan.

Dan juga, untuk prosedur kurva standar, digunakan enam


konsentrasi protein tPA yang berbeda.

Setelah semua tahap percobaan selesai dilakukan, termasuk


penambahan protein non relexive, untuk contoh, serum albumin
babi, primary antibody yang dilarutkan (200 kali) dan secondary
antibody yang dilakukan (200 kali) yang mengandung
peroksidase, substrat enzim TMB melekat antibodi secondary
yang digunakan.

Setelah 15 menit, larutan berhenti ditambahkan dan


Result & Discussion
Transformasi
Cucumber
Studi mengenai regenerasi sel Tahapan inokulasi regenerasi eksplan
tumbuhan mentimun dilakukan dalam kotiledon dan akar tanaman.
konsentrasi NAA dan BAP yang berbeda.

Menurut Abukazemy et al. (2011)


regenerasi terbaik tercapai pada media
MS dengan hormon NAA (0,1 mg/L)
dan BAP (3 mg/L ).

Setelah mempersiapkan eksplan


kotiledon, inokulasi yang dilakukan oleh
Agrobacterium yang mengandung
struktur pBI121-tPA.

Konsentrasi terbaik dari antibiotik


kanamisin untuk eliminasi sel non-
transgenik , yaitu 40mg/L.

Pemilihan tanaman transgenik dilakukan


melalui regenerasi pada media selektif
yang mengandung antibiotik kanamisin.

Dalam hal ini, eksplan yang tidak


menerima konstruksi, tidak mampu a. Inokulasi eksplant timun
regenerasi pada media selektif. b. Regenerasi dari inokulasi eksplan pada
medium selektif
c. Perakaran bibit diregenerasi pada medium
akar
Analisis Molekuler dari
Regenerasi Tanaman
Cucumber
Reaksi PCR dengan primer Hasil PCR tanaman transgenik
gen spesifik dilakukan pada
DNA yang diekstraksi dari
tanaman mentimun.
Beberapa band yang
diamati pada 1700 bp
tanaman transgenik.
Kehadiran single band di
sekitar 1700 bp di setiap
tanaman regenerasi dengan
ketiadaan pada tanaman
kontrol adalah alasan kuat
untuk tPA gen transformasi
ke tanaman mentimun.
Analisis Molekuler dari
Regenerasi Tanaman
Cucumber
Hasil PCR tanaman transgenik

RT PCR dilakukan
pada produksi cDNA.
RT-PCR dengan primer
spesifik dari tengah
gen menunjukkan
beberapa band di
sekitar 500 bp.

Tidak adanya band-


band ini pada
tanaman non-
transgenik adalah
Setelah ditransformasi
Dalam penelitian ini, pada sel nukleus
telah di jelaskan bahwa tanaman mentimun
pada awalnya, kloning dengan bantuan
gen tPA ke vektor pBI121 Agrobacterium dan
dikonfirmasi dengan regenerasi pada
reaksi : medium yang selektif,
PCR kloning keberadaan dan
Enzim pencernaan ekspresi gen tPA
Eequencing dikonfirmasi dengan
tes menggunakan PCR
dan RT-PCR
Akhirnya, produksi tPA protein dan nilai relatif terhadap nilai
total protein terlarut ditentukan oleh tiga percobaan, yaitu :
Dot Blot
Dot blot adalah sebuah teknik untuk Dalam percobaan ini, ada atau
mendeteksi, menganalisis, dan tidaknya protein tPA diantara
mengidentifikasi protein. semua protein yang diekstraksi
pada daun tanaman transgenik
Protein sampel tidak dipisahkan diselidiki dengan antibodi spesifik.
melalui elektroforesis akan tetapi Setelah menambahkan substrat
ditandai dengan template sirkuler ikatan enzim antibodi sekunder,
secara langsung pada substrat kertas. termasuk larutan pewarna DAB,
H2O2, dan PBS.

Prinsip :
Amati perbedaan warna :
Ekstrak yang mengandung
Penempelan protein atau asam nukleat
protein tPA dari tidak
secara langsung pada membran.
berwarna hingga coklat
Sampel yang terlarut ditarik melalui
Tanaman non-transgenik
membran baik menggunakan vakum,
maupun absorpsi dan intrusi, sehingga Tidak ada perubahan yang
protein berikatan dengan membran terlihat
sedangkan komponen lainnya dapat
melewati membran.
Dot Blot

Variasi dalam intensitas warna pada sampel kontrol positif (C+; protein
tPA murni) mungkin karena perbedaan konsentrasi yang tidak
diinginkan.

Perbedaan antara tanaman non-transgenik (wt) karena adanya kotoran


dalam ekstrak protein
Sistem produksi protein
rekombinan farmasi
menggunakan sistem
mikroba, serangga dan
kultur sel mamalia, dan Produksi
hewan transgenik memiliki
protein
kelemahan dalam hal :
Biaya produksi
pada
Keamanan produk
tanaman
Integritas
meningkat
Obat protein tPA lebih disukai
dibandingkan dengan obat lain yang
serupa.
Waktu paruh plasma berkurang pada
Reteplase, Saruplase, Lanutplase
dan dosis lebih rendah daripada
Reteplase dan Lantuplase.
Spesifisitas tPA jauh lebih besar
daripada streptokinase. Namun,
perkiraan biaya setiap perlakuan lebih
besar dibanding streptokinase
Dalam penelitian ini, ditemukan bahwa dengan banyaknya produksi
tanaman mentimun pengobatan penyakit menjadi lebih mudah

Cara evaluasi, faktor, dan metode lain untuk meningkatkan efisiensi


transfer gen untuk produksi protein tPA pada mentimun dan tanaman
lainnya dianjurkan.
SDS - PAGE
Tujuan: Identifikasi dan pemurnian
protein spesifik (protein rekombinan
tPA)
Pada Jurnal ini hasil pita pada garis
o Wt= sampel control yaitu
tanaman timun non-transgenic
o L= Marker molekul protein
o 1-3= Sampel Tanaman timun
transgenic

Protein dari tPA memiliki berat


molekul yaitu 60-67kDa
Pita tambahan terlihat pada sampel
tanaman transgenic dan tidak
dimiliki oleh sampel tanaman
kontrol
ELISA (Enzyme Linked
Immunosorbent Assay)
Tujuan: Menentukan jumlah protein rekombinan tPA
Absorbansi sampel tanaman control dan tanaman
transgenic diukur pada panjang gelombang 450nm
Protein tPA murni diukur dan dibuat sebagai kurva
standard, untuk menentukan kadar dari masing masing
sampel
Hasil dari elisa menunjukan bahwa laju absorbansi
tanaman timun transgenic dua kali lebih banyak dari non
transgenic
Pada tahap cloning awal, gen ditransformasi oleh
Agrobacterium dan mendapatkan Protein rekombinan Human
Tissue Plasminogen di dalam sel tanaman timun.
Kloning DNA tPA dilakukan ke vector pBI121 dikonfirm dengan
PCR cloning reactor, Enzyme digestion dan Sequencing.
Setelah itu ditransformasikan ke medium yang selektif,
keberadaan dan ekspresi gen tPA dikonfirmasi dengan PCR
dan RT-PCR.
Terakhir yaitu produksi protein rekombinan tPA dan
perhitungan jumlah relative dan jumlah total protein terlarut
dengan 3 eksperimen yaitu Dot- blot, SDS-PAGE dan ELISA
Daftar Pustaka
Anonim, The Recombinant Protein Handbook, Protein Amplification and Simple Purification,
Edition AA, Amersham Pharmacia Biotech,
Grompe, Marcus et.al. 1998. Teknik Rekombinan DNA dan Genetik. Principles of Molecular
Medicine
Kayser, O., dan Muller, R.H. (2004). Pharmaceutical Biotechnology; Drug Discovery and
Clinical Applications. Willey-VCH: German
Marks, B. Dawn. 2000. Biokimia Kedokteran Dasar: Sebuah Pendekatan Klinis. Jakarta: EGC
Mshaneh Asgari et al.,2014. Production Of Human Tissue Plasminogen Activator (tPa) in
Cucumis sativus.http://www.tandfoline.com/Ioi/Ipbb20
http://www.biotecharticles.com/Genetics-Article/Advantages-of-Recombinant-DNA-351.html
https://www.quora.com/What-are-the-advantages-and-disadvantages-of-recombinant-DNA
http://www.biology.lifeeasy.org/5128/recombinant-dna-disadvantages
http://www.bphn.go.id/data/documents/pkj_2012_-_4.pdf
http://www.sigmaaldrich.com/technical-documents/articles/biology/protein-expression-syst
ems.html
http://procube.sysmex.co.jp/eng/p/e_silkworm_outline/
https://www.uq.edu.au/pef/content/protein-expression-0
http://www.amsbio.com/baculovirus-protein-expression-services.aspx diakses pada Minggu,
18 Desember 2016
Apa saja sistem ekspresi yang dapat
digunakan untuk produksi protein
rekombinan dan apa kelebihannya

Anda mungkin juga menyukai