Anda di halaman 1dari 109

Bioteknologi

Protein Rekombinan
Ambar Listyorini Pidia Awalia N
Asraq Fahruzzaman Primo Bittaqwa
Badriyatun Nimah Putri Agni K
Ervina Octaviani Ratih Dara Syadillah
Fitrahtunnnisah Silviana Adhitya
Haka Asda Tri Wahyuni
Hesti Sulistiorini Ummum Nada
Marrisa Vishilpy Dimalia
Muhammad Akbar
Najmah Mumtazah

Kelompok 2 AC
Protein Rekombinan
Rekombinan protein adalah suatu bentuk
manipulasi dari protein, yang dihasilkan dalam
berbagai cara untuk menghasilkan sejumlah besar
protein, memodifikasi urutan gen dan
memproduksi produk komersial yang bermanfaat.
Protein rekombinan merupakan protein yang
diperoleh dari hasil teknologi DNA rekombinan.
Melalui teknologi DNA rekombinan dapat dilakukan
pemindahan gen pengode enzim/protein dari satu
organism ke organisme lain.
TEKNIK PRODUKSI PROTEIN
REKOMBINAN
ISOLASI DNA GENOM, RNA TOTAL
DAN POLY(A) RNA
DNA genom berupa untai ganda dan dapat diisolasi dari sel jenis
apapun, termasuk bakteri, ragi, tanaman dan binatang.
Hasil isolasi DNA yang diinginkan adalah DNA seutuh mungkin, tidak
rusak dan memiliki berat molekul tinggi.

Beberapa jenis RNA dapat ditemukan dalam sel, termasuk messenger RNA
(mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA) dan lain-lain.
Kebanyakan studi (Northern blot, RT-PCR) cukup menggunakan hasil isolasi
RNA seluler total.

Untuk beberapa aplikasi, total RNA seluler tidak cukup baik digunakan.
Dari total RNA sebagian besar berupa rRNA, sedangkan mRNA hanya 1-
3%.
1. Isolasi DNA Genom Total
Suspensi sel-yang-mengandung-
DNA diinkubasi dengan deterjen dan
atau enzim yang berfungsi untuk
melisis sel/inti

DNA kemudian dikeringkan dan


dilarutkan kembali dalam air dengan
buffer tertentu (Tris-HCl atau Tris-
EDTA) dan akan stabil selama beberapa
tahun.
mendisosiasi DNA dari protein
(misalnya histon) menggunakan
enzim yang dapat mendegradasi
protein (proteinase K).

DNA dipresipitasi dengan etanol


Protein yang terdegradasi sebagian, Dengan cara ini biasanya DNA dengan
dihilangkan dari larutan dengan cara BM tinggi (misalnya DNA genom
ekstraksi fenol/kloroform, presipitasi manusia) akan membentuk threads
dengan garam, atau dengan (rantai) dan dapat ditarik dari larutan
melewatkan larutan melalui kolom menggunakan batang gelas.
yang akan menahan DNA
2. Isolasi RNA Seluler Total

Selama isolasi RNA,


sel atau jaringan
dihomogenisasikan
dalam larutan yang
RNA dipurifikasi dan
mengandung Pemisahan RNA dari
dipresipitasi dengan
senyawa yang dapat DNA genom.
etanol
menghambat kerja
RNAse, misalnya
guanidium
isotiosianat..
3. Isolasi mRNA
Hampir semua mRNA mengandung adenilat (poly-
adenilated/polyA RNA), sehingga sifat ini dapat
digunakan untuk menangkap dan mengisolasi mRNA.

. Total RNA seluler dilewatkan melalui


kolom atau resin polydeoxythymine (kolom oligodT, polydT)
yang terikat pada fase padat.

RNA yang tidak terikat akan hilang tercuci, sedangkan


poly(A) RNA dapat dielusi pada tahap berikutnya
Analisis DNA dan RNA
Pemisahan DNA dan RNA berdasarkan ukuran
dengan
elektroforesis pada sistem gel

Southern blot. DNA genom diisolasi dan


digesti dengan enzim restriksi. DNA kemudian
dirun pada
gel agarose dan ditransfer ke membran di
mana DNA
kemudian diikatkan secara kovalen. DNA
selanjutnya
dihibridisasi menggunakan probe yang dilabel.
Interaksi antara DNA dan probe yang dilabel
dideteksi
dengan cara memajangkan DNA-membran ke
film
otoradiografi
Northern blotting.
Beberapa hal yang membedakan dengan Southern
blotting adalah:
(1) RNA jauh lebih rentan terhadap degradasi dibanding DNA, oleh
karena itu elektroforesis dilakukan dalam bufer yang mengandung
zat kimia yang bersifat melindungi (biasanya formaldehid),
(2) RNA sudah berupa untai tunggal dan membutuhkan kondisi
denaturasi yang lebih ringan,
(3) RNA biasanya berukuran tertentu sehingga tidak memelukan digesti
enzim untuk memperoleh pola pita. Kedua prosedur sangat mirip
karena setelah elektroforesis RNA juga ditransfer ke membran
melalui difusi kapilaritas. Biasanya sinar UV digunakan untuk
mengikat (crosslink) RNA pada membran sehingga tidak bergerak
(imobilisasi)
Sekuensing
Ekspresi Rekombinan Protein
Host
Vector
Tag
Purifikasi
SKEMA
Sistem Ekspresi
Translasi in vitro (in vitro
translation) protein rekombinan
Cara yang paling
sederhana
Menggunakan lisat
retikulosit
(reticulocyte
lysates)

http://images.the-scientist.com
mRNA (biasanya diterjemahkan (translasi)
ditranskripsikan secara menggunakan ribosom
in vitro dari cDNA yang yang ada dalam lisat
diklon dalam plasmid) retikulosit.

untuk enzim-enzim,
Protein yang
reaksi katalisis,
ditranslasikan secara in
imunopresipitasi, uji
vitro dapat digunakan
interaksi DNA-protein,
sebagai substrat
dan lain-lain.
Ekspresi protein rekombinan
dalam E. Coli
Paling baik digunakan untuk ekspresi protein
intraseluler yang relatif kecil dan tidak memerlukan
modifikasi pascatranslasi (posttraslational
modification) yang terlalu banyak untuk dapat
berfungsi.
Menambahkan label/marka (tag) yang telah dipurifikasi
kepada protein yang diekspresikan untuk memudahkan
menemukan protein setelah diekspresikan.
Marka yang banyak digunakan adalah glutation-
Stransferase (GST) yang dapat diisolasi menggunakan
kolom glutation atau marka histidin untuk isolasi
menggunakan kolom nikel.
Kerugiannya :
ketidakmampuan
untuk melakukan
prosessing kompleks
seperti glikosilasi
beberapa protein
bersifat labil (atau
toksik) pada hospes.
protein yang besar
biasanya tidak
diproduksi atau tidak
terlipat (folding)
dengan efisien.
Keuntungan sistem
ekspresi pada E. coli :
- mudah untuk
melakukan manipulasi
DNA rekombinan (mirip
seperti kloning
plasmid) dan proses
seleksi
- ekspresi yang cepat.
Yeast protein expression systems
Saccharomyces cerevisiae
Sistem genetik yang sangat berkembang,
penggunaannya mudah, berkurangnya waktu dan biaya
membuat S. Cerevisiae menjadi organisme yang
menarik untuk diekspresikan dan memproduksi protein
rekombinan.
Ragi mampu membawa plasmid yang dirancang khusus
dan kemampuan ini berfungsi dalam sistem ekspresi
protein rekombinan. Plasmid terdiri dari situs restriksi
yang dapat digunakan untuk memasukkan urutan gen
yang diinginkan. Transformasi dari ragi dengan plasmid
menghasilkan protein yang diinginkan dan dapat
ditingkatkan.
Features
low cost culture
methods
suitable for both
intracellular and
secreted proteins
provides eukaryotic
post-translational
glycosylation of
proteins although it
results in high
Ekspresi protein rekombinan
dengan bantuan baculovirus
Ekspresi yang dibantu oleh
baculovirus dalam sel serangga
adalah satu cara lain yang
umum digunakan untuk
ekspresi protein rekombinan.
Tingkat ekspresi yang tinggi
akan memudahkan purifikasi,
kecuali jika terjadi agregasi.
Namun, untuk melakukan
seleksi dan rekombinasi
sejumlah besar protein mutan
pada sistem ini masih agak
sulit.
terjadi rekombinasi dengan DNA
baculovirus dalam sel Sf9
Mentransfer plasmid yang sehingga sekuens DNA yang
mengandung cDNA yang menyandi protein mantel virus
dikehendaki (coat protein) utama, polyhedrin,
diganti dengan protein yang
dikehendaki.

Dihasilkan ekspresi protein


Selanjutnya akan dapat rekombinan dalam jumlah tinggi.
mengekspresikan lebih dari satu Sel Sf9 dapat melakukan
protein bersama-sama sekaligus glikosilasi (walaupun secara
(misalnya imunoglubulin). struktural berbeda dengan sel
mamalia),
Ekspresi protein rekombinan dengan
bantuan baculovirus
Ekspresi pada galur sel mamalia
Sangat jarang dapat menproduksi protein
seefisien E. coli atau Baculovirus, salah satu
kelebihannya adalah mampu memproses
polipeptida kompleks menggunakan mesin
intraseluler yang sesuai.
Prosesing peptida, folding, atau glikosilasi dapat
dilakukan dengan tepat, untuk mengekspresi
protein tertentu seringkali diperlukan kondisi
yang hanya dapat dicapai dengan menggunakan
sel homolog atau jaringan khusus (tissue specific).
Features
transient expression
is easy and rapid
provide all the post-
translational
modifications found
in mammalian cells
stable transfection
results in higher
yield, scalability and
reproducible
production
www.uq.edu.au
Ekspresi menggunakan vektor
adenovirus
Vektor adenovirus sangat menarik karena telah
menginfeksi berbagai macam sel mamalia dan karena
genom adenovirus telah dapat diubah menghasilkan
virus yang tidak mampu mereplikasi dan dapat
membawa sekuens manusia.
Adenovirus telah banyak digunakan untuk
mengekspresikan protein rekombinan pada sel dan
jaringan yang sulit ditransfer.
Penggunaan adenovirus sebagai vektor untuk terapi
gen juga menjadikan sistem ini sangat menarik untuk
ekspresi gen.
Memasukkan vektor virus yang mengandung gen yang
dikehendaki ke dalam sel 293 yang mengekspresikan E1a
memungkinkan untuk mengemas dan memanen virus
serta virus tidak ber-replikasi pada sel lain. Vektor
adenovirus telah digunakan untuk mengekspresikan :
1. gen normal pada organ yang defektif (misalnya
ekspresi CFTR pada penderita cystic fibrosis)
2. gen yang toksik pada tumor (misalnya timidin kinase
pada tumor otak)
3. untuk mentarget gen cell-cycle arrest pada sel
vaskuler yang sedang berproliferasi.
Keterbatasan adenovirus antara lain :
ketidakmampuannya untuk menerima DNA asing >10 kb,
jangka waktu ekspresinya relatif pendek in vivo (beberapa
minggu sampai bulan), toksik terhadap sel, dan
menginduksi respon imun.
Pilihan Host untuk Amplifikasi
protein
Sistem host tersedia dalam beberapa bentuk termasuk fag, bakteri,
ragi, tumbuhan, jamur berserabut, serangga atau sel mamalia yang
tumbuh dalam kultur dan hewan transgenik.
Pilihan terakhir dari host akan bergantung pada persyaratan yang
spesifik dan aplikasi untuk protein rekombinan. Pemilihan host tidak
hanya mempengaruhi amplifikasi dan isolasi dari protein, tetapi
juga cara dimana produk kemudian dapat dimurnikan.
Dalam rangka untuk memutuskan host mana yang paling cocok
dalam jumlah dan tingkat kemurnian produk serta integritas
biologis dan potensi toksisitas sebaiknya dipertimbangkan.
Sebagai contoh, system ekspresi bakteri tidak cocok jika modifikasi
pasca-translasi diperlukan untuk menghasilkan produk rekombinan
yang dapat berfungsi penuh.
Lokasi produk dalam host akan mempengaruhi
pilihan metode untuk isolasi dan pemurnian
dari produk.
Sebagai contoh, sebuah host bakteri dapat
mensekresikan protein ke dalam media
pertumbuhan, mentransportnya ke dalam
ruang periplasmik atau menyimpannya
sebagai badan inklusi yang tidak dapat larut
dalam sitoplasma.
Keuntungan DNA rekombinan
Bidang kesehatan Bidang peertanian
Produksi insulin Menurut situs dari Human Genome Project,
Penggunaan insulin untuk pasien diabetes dalam pada 2006. pentanit idak perlu
memproduksi insulin sangatlah banyak sehingga menggunanakan herbisida kimia lagi untuk
untuk mendapatkannya dibutuhkan inulin dari mengusir serangga pengganggu. Sehingga
pankreas sapi atau babi yang cukup banyak pula. menekan menekan pengeluaran biaya untuk
Tetapi dengan teknologi DNA rekombinan telah
memungkinkan para ilmuwan untuk pembelian pestisida. Dan menekan
mengembangkan insulin manusia sintetis. penggunaan pestisida yang berlebihan dalam
Mutasi pengendalian hama dan penyakit.
Menggantikan gen yang rusak dengan gen yang tahan terhadap serangan penyakit tanaman.
sehat Sehingga gen yang telah disisipi oleh gen yang . Para pakar fitopatologi telah banyak
sehat akan memulai fungsinya sehingga pasien menemukan beberapa varietas tanaman
dapat normal
hasil rekayasa genetika yang tahan terhadap
Kanker
seranagan penyakit.
mencegah pertumbuhan sel yang tidak terkontrol
dengan cara dapat mengaktifkan dan pengembangan padi yang berisi tingkat
menonaktifkan sel yang berkembang biak peningkatan besi dan vitamin, untuk
Vaksin digunakan di negara-negara Asia di mana
Vaksin disisipkan pada produk tanaman seperti kekurangan gizi kronis.
pada tanaman tomat atau kentang sehingga dalam Meningkatkan efisiensi fotosintesis, sehingga
proses pengiriman dan penyimpanan, dibandingkan hasil panen dengan mengkonversi tanaman
dengan vaksin injeksi. C3 dan C4 oleh rekombinasi genetik
Kerugian DNA rekombinan
Bidang kesehatan Bidang pertanian
Kekhawatiran kesehatan Kekhawatiran etis
penggunaan DNA rekombinan dalam produk Teknologi ini juga menimbulkan kekhawatiran etis,
makanan mengkhawatirkan Efek jangka terutama ketika gen manusia dimasukkan ke dalam
organisme bukan manusia yang kemudian menjadi
panjang pada kesehatan manusia masih sebagian manusia. Di Cina, DNA manusia sedang
belum diketahui dan dipastikan ditempatkan dalam tomat dan paprika untuk
keamanannya. Menurut profesor Inggris Mae mempercepat pertumbuhan mereka. Timbul
Wan-Ho, DNA rekombinan dapat pertanyaan: Apakah makan tomat yang
membahayakan karena memasukkan gen mengandung DNA manusia membuat Anda kanibal?
asing ke dalam genom. hal ini dapat Penurunan efektifitas dari pestisida. Penggunaan
menimbulkan efek berbahaya dan fatal, tumbuhan yang tahan terhadap hama secara terus
termasuk kanker. menerus dapat menstimulir munculnya gen-gen
baru hama yang tahan/resisten terhadap beberapa
Terjadinya reaksi alergi. jenis pestisida.
Intoduksi gen tertentu seperti gen kacang- Transfer gen kepada spesies yang tidak menjadi
kacangan ke dalam tanaman kedelai dapat target. Kasus munculnya superweeds yang sangat
menimbulkan reaksi allergi yang resisten terhadap herbisida akibat penggunaan
rekayasa genetika (soybean roundup). Hal ini terjadi
berpengaruh terhadap ketahanan tubuh. karena adanya transfer gen dari tumbuhan ke
gulma.
KERUGIAN
PERTIMBANGAN EKONOMI
Penggunaan dinilai tidak ekonomis dan merugikan
petani, karena untuk menghasilkan membutuhkan
biaya yang tinggi dan selanjutnya biasanya dipatenkan
oleh penciptanya. Biaya penelitian dan hak paten
Produk hasil DNA rekombinan akan dibebankan kepada
pengguna (petani) melalui penjualan yang mahal.
Selain itu, Produk hasil DNA rekombinan pada
umumnya tidak menghasilkan keturunan dan
digunakan hanya satu kali tanam. Kondisi ini tentunya
menimbulkan ketergantungan yang tinggi petani
terhadap benih oleh perusahaan penghasil
PERBEDAAN BIOTEKNOLOGI
KONVENSIONAL DAN MODERN
Menurut the United Nation Convention on
Biological Diversity, terminologi bioteknologi diartikan
sebagai teknologi aplikatif yang memanfaatkan sistem
biologi, organisme-organisme hidup atau turunannya
guna menyempurnakan produk atau proses untuk
kepentingan spesifik.

Konvensio
Modern
nal
Konvensional Modern
- menerapkan biologi, biokimia, telah menggunakan teknik rekayasa
atau rekayasa masih dalam tingkat tinggi dan terarah sehingga
hasilnya dapat dikendalikan dengan
tingkat yang terbatas. baik.
- menggunakan jasad hidup Teknik yang sering digunakan adalah
secara utuh. dengan melakukan manipulasi
- contoh, di bidang teknologi genetik pada suatu jasad hidup
pangan adalah pembuatan bir, misal rekayasa genetika, kultur
roti, maupun keju yang sudah jaringan, rekombinan DNA,
pengembangbiakan sel induk,
dikenal sejak abad ke-19. kloning, dan lain-lain.
- Di bidang medis, penerapan Teknologi ini memungkinkan untuk
bioteknologi di masa lalu memperoleh penyembuhan penyakit-
dibuktikan antara lain dengan penyakit genetik maupun kronis yang
penemuan vaksin, antibiotik, belum dapat disembuhkan, seperti
dan insulin walaupun masih kanker ataupun AIDS.
dalam jumlah yang terbatas Beberapa prinsip dasar dalam
rekayasa genetika, yaitu DNA
akibat proses fermentasi yang rekombinan, fusi protoplasma, dan
tidak sempurna. kultur jaringan.
PERBEDAAN BIOTEKNOLOGI KONVENSIONAL DAN
MODERN

Konvensional Modern
Memakai makhluk hidup dan komponennya
Langsung menggunakan secara langsung
makhluk hidup dan belum Menggunakan prinsip-prinsip ilmiah
mengetahui penggunaan enzim
Hasil pengkajian berbagi disiplin ilmu yg
Tanpa didasari prinsip ilmiah mendalam
Berdasarkan keterampilan yang Diproduksi secara masal
diwariskan turun temurun Mengupayakan membuat produk dengan
Tidak sepenuhnya diproduksi efektif dan efisien
secara masal Didasarkan pada manipulasi atau teknik DNA
disamping menggunakan dasar mikrobiologi
Bioteknologi yang dan biokimia
menggunakan mikroorganisme Tidak hanya digunakan pada industri
untuk memproduksi alkohol, makanan namun juga telah meliputi banyak
asam asetat, tempe, tahu, bidang, seperti teknik genetik.
oncom, dll Dengan beragamnya penelitian dan
perkembangan keilmuan serta teknologi,
keuntungan yang lebih besarpun didapatkan.
Contoh-contoh
Hormon
Contoh: Hormon Insulin. Penderita penyakit Diabetes mellitus
kekurangan hormon insulin sehingga kadar gula dalam darahnya sangat
tinggi. Dengan adanya bioteknologi, saat ini hormon insulin telah dapat
dihasilkan secara buatan (transgenik) dengan bantuan bakteri
Escherichia coli. Pembuatan insulin dilakukan dengan menyisipkan gen
insulin ke dalam bakteri. Pada sel bakteri E. coli, dimasukkan DNA sel
manusia yang mengandung gen insulin sehingga bakteri E. coli dapat
menghasilkan insulin. Karena bakteri dapat berkembang biak dengan
cepat maka hormon insulin pun dapat dihasilkan dalam jumlah yang
banyak. Kini, insulin mudah didapatkan oleh penderita diabetes mellitus
dalam bentuk cair.

Vaksin
Contoh: Vaksin Hepatitis B dan malaria. Secara konvensional pelemahan kuman
dilakukan dengan pemanasan atau pemberian bahan kimia. Dengan
bioteknologi dilakukan fusi atau transplantasi gen.
Contoh Produk Farmasi Berbasis Bioteknologi
Protein Rekombinan
Sistem ekspresi yang berdasar pada
promotor arabinosa dalam E. coli
untuk produksi dan pemurnian
rekombinan hormon pertumbuhan
manusia (rhGH).

Studi shake flask menunjukkan


jumlah rhGH yang terekspresi di
dalam vector pBAD24
(pBAD24M) cukup besar
Bioaktivitas dari rhGH yang dibandingkan dengan vektor
dimurnikan adalah sebanding pBAD24 asli. Sementara, tingkat
dengan hGH yang tersedia rhGH hanya mencapai 75 mg l-1
secara komersial dengan pBAD24 di dalam
(Somatotropin). bioreaktor, dan mencapai ~ 1860
mg l-1 dengan vektor pBAD24M
dinilai oleh densitometri protein
yang diselesaikan dengan (SDS-
PAGE).

Protein rhGH berhasil


Bakteri murni derivat rhGH dimurnikan dari badan inklusi
dikarakterisasi dengan N- setelah denaturasi urea oleh dua
terminal sequence, studi langkah kromatografi pertukaran
spektrum CD, analisis sidik jari ion sederhana dengan
massa dan analisis Agilent 2100 pemulihan keseluruhan sebesar
bioanalyzer. 40% dari ~ 750 mg l-1 hGH yang
dimurnikan.
PENDAHULUAN
Human Growth Hormone (hGH)

hGH hGH1
Peptida kecil, satu-rantai dari 191
Hormon protein heterogen, terdiri residu, diproduksi dan disekresikan
dari beberapa isoform dan gen GH oleh kelenjar hipofisis anterior.
cluster pada kromosom 17q yang Protein ini bertanggung jawab
berisi 2 gen GH (GH1 atau GH-N untuk efek dalam metabolisme
dan GH2 atau GH-V) selain itu 2 protein, karbohidrat dan lipid serta
sampai 3 gen yang mengkode pertumbuhan dan kekebalan
terkait chorionic (Jorgensen, 1987) dan digunakan
somatomammotropin (Baumann, dalam pengobatan dwarfisme
2009). hypopituitary (Hindmarsh dan
Brook, 1997).
Eschericia coli
Berbagai sistem ekspresi telah Aspek yang menarik dari sistem
dicoba untuk ekspresi hGH: E. coli sehubungan dengan hGH
Bacillus subtilis (Franchi et al., 1991), adalah rhGH telah diuji untuk
sel mamalia seperti CHO (Dallia et al. ekspresi dalam ruang
2003), periplasmic E. coli (Chang et al,
sistem baculovirus (Geng et al., 2002) 1987;. Ghorpade dan Garg,
dan
1993) dan di sitoplasma sebagai
ragi seperti Pichia pastoris (Ascacio-
Martinez dan Barrera-Saldana, 2004;. badan inklusi (Mukhija et al,
Deshpande et al, 2009). 1995; Schoner et al, 1992).

Penggunaan E. coli untuk


produksi rhGH tingkat
keberhasilan yang lebih tinggi.
Selama gen tersebut tidak
terglikosilasi, maka
diekspresikan dalam E. coli
(Goeddel et al., 1979).
Sistem promotor

Sistem promotor induksi Dari jumlah tersebut,


kuat (misalnya lac, T7, trpA, promotor arabinose adalah
tac, lambda pL dan lainnya) sistem yang terpelajari
yang biasa digunakan dalam dengan baik karena
E. coli rekombinan menggunakan biaya rendah,
menguntungkan selama memiliki peraturan ketat
memproduksi protein dan menghasilkan ekspresi
rekombinan pada tingkat tinggi dari gen pada
kepadatan sel yang tinggi induksi (Banerjee et al.,
dalam fermentasi fed-batch. 2009).
Tujuan Penelitian
Hal ini terutama dipilih
Mengembangkan hasil karena E. coli K12
yang tinggi dari rhGH1 memiliki tingkat biosafety
(selanjutnya disebut organisme level I,
sebagai rhGH) dikloning merupakan strain recA minus,
dalam sistem E. coli K12 mampu mempertahankan
jumlah tinggi salinan plasmid
dibawah promotor bebas dari bakteriofag
arabinosa. terintegrasi endogen.

Peneliti juga mencoba


bekerja pada protokol
pemurnian sederhana Jurnal ini juga fokus
untuk pemurnian pada karakterisasi
bacteri derivat dari seperti persiapan rhGH
rhGH sehingga protokol yang dimurnikan.
bersifat scalable dan
hemat biaya.
Bahan dan Metode
E. coli galur DH5 studi transformasi, propagasi dan ekspresi

pBAD24

Plasmid studi kloning dan


ekspresi

modified vektor pBAD24, pBAD24M


Dr. Yasuda, Institute of Genetics, Jepang

Enzim restriksi Bangalore Genei, Bangalore India

L+arabinosa Hi Media, Mumbai, India

Antibodi poliklonal anti-hGH Abexome Life Sciences, Bangalore, India

Bahan kimia lainnya dan oligos Sigma, USA

Gen hGH GenScript, USA

rhGH reseptor dan rhGH komersial R & D Systems, USA


Kloning dan ekspresi hGH pada vektor pBAD24 dan pBAD24M

Gen hGH diamplifikasi PCR menggunakan


gen hGH sintetis sebagai template untuk
menghasilkan produk PCR dari 585 bp

Pemendekan EcoRI / HindIII produk


PCR diligasi ke vektor pBAD24

aliquot lain dari produk PCR


dipendekkan dengan NdeI / HindIII
dan diikat ke vektor pBAD24M

transformasi sel DH5

rekombinan dipilih oleh koloni PCR


yang menggunakan primer spesifik
gen hGH
Kloning dan ekspresi hGH pada vektor pBAD24 dan pBAD24M

Sel E. coli DH5 yang mengandung baik


pBAD24-hGH atau rekombinan pBAD24M-hGH
ditumbuhkan dalam LB dengan ampisilin 100
mg ml-1 dan diinduksi dengan 13 mM
arabinosa selama 4 jam pada suhu 37oC

sel-sel yang diinduksi dipanen dan dipisahkan


antara fraksi yang larut dan fraksi yang tidak larut

Kedua fraksi dianalisis pada 12,5% SDS-PAGE dan


divisualisasikan dengan Coomassie Blue Staining
Penentuan hasil hGH menggunakan densitometri

Pita protein hGH pada gel


poliakrilamida Coomassie blue-stained

dikuantitatif (diperbanyak) menggunakan


sistem Bio Rad Imager

Hasil hGH ditentukan dengan membandingkan angka pita


monomer rhGH dengan jumlah standar BSA run di gel
yang sama.
Studi bioreaktor
Bibit Inokulum disiapkan dengan menginokulasi E. coli
DH5cells yang membawa plasmid pBAD24-hGH atau
pBAD24M-hGH, pada media LB dan ditumbuhkan selama
16 jam pada suhu 37 C dengan agitasi pada 200 rpm

Fermentasi dilakukan dalam 5L bioreaktor (Sartorius,


Jerman) untuk mencapai ekspresi rhGH tingkat tinggi
dan dalam medium 2,5 L

Medium fermentasi diinokulasi dengan overnight seed


cultur pada 10% v / v. Aerasi disimpan pada 1 vvm
(volume udara / volume fermentasi menengah / menit)
dan suhu dipertahankan pada 37 C
Studi bioreaktor

Agitasi ditetapkan antara 300-800 rpm, tingkat oksigen


terlarut dipertahankan pada 30% dengan penambahan
otomatis oksigen murni ke udara yang dikendalikan oleh
pengontrol aliran massa pada instrumen

Fermentasi dilakukan pada pH 7,00 yang dikendalikan


dengan penambahan otomatis 30% H3PO3 atau 12%
NH4OH dan foaming dikendalikan dengan
penambahan 0,05% antifoam US 1510

Kultur yang tumbuh diinduksi pada OD600 dari 10


sampai 15 dengan penambahan 13 mM L + arabinosa
Studi bioreaktor

Biomassa dicapai pada akhir lima jam pasca induksi diukur


dengan memperkirakan berat sel basah (WCW) per liter
dari medium fermentasi

Untuk isolasi hGH dari broth fermentasi, broth yang


sudah dipanen disentrifugasi pada 8000 rpm selama 10
menit dan pelet sel yang diinduksi ~ 140 g sel basah
disangga pada 10 mM Tris buffer pH 8,0 dan volume
suspensi sel dibuat untuk 1 L

Proses pengacauan sel dilakukan pada 900-1000 bar


pada homogenizer tekanan tinggi dan dilakukan selama
tiga bagian
Studi bioreaktor

Lisat sel yang diperoleh disentrifugasi pada 10.000


rpm selama 15 menit untuk memisahkan fraksi larut
dan tidak larut

Setiap fraksi dianalisis pada SDS-PAGE diikuti dengan


metode pewarnaan Coomassie R250

Total protein diperkirakan dengan metode BCA (Thermo


Scientific, USA) sedangkan scanning densitometer dilakukan
untuk memperkirakan jumlah hGH yang dicapai bersama dengan
perhitungan persentase kemurnian dari incluion bodies.
Purifikasi dan Analisis dari rhGH murni

Sebelum proses,setiap gram dari berat basah


dari badan inklusi dicuci dengan 40 volume
dari Badan inklusi (8,5
Sejak klon
gram berat basah)
Pbad24M-hGH
diperoleh dari 1
terekspresi
wash buffer 1 (50 mM Tris.Cl, pH 8, 1% Triton liter fermentasi
dalam jumlah
X 100 and 20 mM EDTA), broth/air daging
signifikan dari
yang dilarutkan di
hGH, klon ini
dalam 340 mL dari
digunakan untuk wash buffer 2 (50 mM Tris.Cl, pH 8, 2M urea 8 M urea, pH 12,5
mempurifikasi and 20 mM DTT) dan selama 30 menit
rHGH.
pada suhu ruang.
wash buffer 3 (Milli Q water).

Protein yang terlipat kembali (3400 ml) Badan inklusi yang terlarut
buffer nya ditukarkan dengan 20 Mm
Natrium asetat pH 4,5 mengandung kemudian melipat kembali dalam
2,5% sukrosa, 0,2 Tween 80 dan 0,5 volume 10 dari 50 Mm Tris.Cl, pH 8,8
Mm EDTA (buffer seimbang). dengan metode dilusi cepat.
Purifikasi dan Analisis dari rhGH murni

Protein-protein
Setelah buffer yang terikat
bertukar, dielusi dengan
gradient linear
Kolom dicuci dengan buffer seimbang sampai 0.0-1.0 M NaCl
protein diperjelas DD280 dicapai nol pada 20 mM
dengan Natrium Asetat
sentrifugasi pada pH 4,5
13000 rpm untuk elusi dari protein-protein terikat diteruskan mengandung
15 menit dengan menggunakan gradient linear dari 2,5% sukrosa, 0,2
larutan NaCl (0.0-1.0 M) pada buffer yang % tween 80 dan
sama di dalam sistem purifikasi protein o,5 mM EDTA
supernatant yang explorer AKTA (GE Heathlcare, Sweden). pada volume
dihasilkan (4080
1870 ml.
ml) diisi pada
kolom penukar Aliran yang melalui fraksi (4780 ml)
anion (Q mengandung protein hGH kemudian diisi Kemurnian dari
Sepharose FF, GE pada kolom penukar kation (SP Sepharose, FF hGH diperiksa
Healthcare, GE Healthcare, Sweden) dengan
Sweden) pada mensubjekan
laju alir 8 protein pada SDS
ml/menit. PAGE diikuti oleh
pewarnaan silver.
Mengkarakterisasi dari rHGH murni

Penggunaan N terminal dari protein


PMF (Peptide Mass Finger Printing) untuk rhGH murni diteruskan pada
mempersiapkan hGH murni Australian Proteome Analysis Facility
menggunakan Bruker Daltonik MALDI untuk mendeterminasi keaslian.
TOF/TOF (IISC, Banglore, India)
Spektroskopi sirkular dikrois (CD) dari
dan massa peptide diperoleh oleh MALDI persiapan rhHG murni (0,5 mg/mL)
TOF/TOF dianalisi dengan Software diambil dalam Jasco J-715 merekam
MASCOT (www.matrixscience.com) spektropolarimeter menggunakan sel
quartz silinder.

Data ditampilkan sebagai eliptisitas molar (mdeg) versus panjang gelombang (nm)

dan elemen structural sekunder dideterminasi dengan menggunakan tool k2D online
(http://www.emblheidelberg. de/~andrade/k2d) pada IISC, Bangalore, India.

rhGH murni juga dianalisi pada bioanalizer Agilent 2010 :Instrumen elektrophoresis kapiler
generasi baru dengan mikrofluida berbasis platform yang tersedia secara komersial.
Mengkarakterisasi dari rHGH murni

Data ditampilkan pada


elektrogram dengan
Karna massa konstan memplotkan unit
untuk merubah rasio Sampel disiapkan intensitas fluoresen
dan menghadirkan mengikuti protocol (FU) versus retensi
matrix polimer manufacturer dan kit waktu dalam detik.
pengayakan pada chip protein 80 yang
dari bioanalizer. digunakan untuk rhGH yang diturunkan
analisis protein, dari bakteri dan rhGH
Molekul-molekul berkisar antara 5 dan yang secara komersial
dipisahkan berdasarkan 80 kDa. tersedia dibandingkan
ukuran. dengan instrument
sebagai protokol per
manufacturer.
Aktivitas Biologi dari rhGH

Secara singkat, reseptor hGH terfusi ke sistem


Fc manusia (Sister R &D,USA) dilapiskan 25 ng
Aktivitas hGH ditentukan per sumur ke dalam plate sumur Nunc 96 pada
dengan mengukur pengikatan triplikat.
dari hGH ke reseptor hGH pada
assay in vitro dilaporkan oleh
Schellenberger et al (2009). Sumur diblok/dihambat dengan 3% BSA diikuti
dengan inkubasi selama 1 jam dengan
bermacam-macam konsentrasi hGH.

Setelah pencucian secara extensive, plate diinkubasi dengan 1:750 didilusi antibody anti
hGH kelinci pada 37C untuk 1 jam diikuti dengan inkubasi kambing anti kelinci IgG-HRP.
3,3,5,5-Tetramethylbenzidine (TMB, Sigma) digunakan substrat chromogen dan
absorbansi dibaca pada 370 nm setelah 30 menit.
HASIL
Pemilihan pBAD24-hGH dan
pBAD 24M-hGH rekombinan

Dari hasil PCR menunjukan PRIMER pBAD24-hGH pBAD24M-hGH


bahwa pBAD 24M-hGH (Line
2) terlihat tingkat pita yang
terbentuk lebih tinggi dari
primer (M), dan hasil PCR ini
menunjukan bahwa gen hGH
telah disisipkan kedalam
vektor. sedangkan pBAD24-
hGH terihat tidak adanya
perubahan signifikan (line 1)

pBAD24M-hGH
Hasil Ekspresi rhGH dalam Biorekator
Pada proses fermentasi pBAD24-hGH dan pBAD 24M-hGH dengan keadaan lingkungan
yang sama, terlihat pola pertumbuhan yang sama tetapi tingkat ekspresi rhGH pada
pBAD24MhGH hampir 25x lebih tinggi dibandingkan dengan pBAD24-hGH (gambar 3).
Dan nilai OD rHG pada pBAD24-hGH hanya 75 mg/mL dan pada pBAD24MhGH
sebanyak 1.862 mg/Ml dengan kondisi yang sama (tabel 1)ketika diukur dengan
densitometer, hasil penelitian menunjukan badan inklusi pada pBAD24- hGH hanya
1,8% sedangkan pada pBAD24M-hGH sebanyak 59% dari total protein
Purifikasi dari bakteri Hgh
pada proses purifikasi, dilakukan
dua proses, yaitu
1. Menggunakan ion Q
Sepharose FF , menghasilkan
Hgh dengan tingkat
kemurnian 66%. karena
adanya muatan negatif pada
proses ini juga menghapus
kontaminan dari DNA host
2. hGh dimasukan kedam kolom
(SP sepharose FF) dan
protein yang masih terikat
dan dielusi sehingga
mendapatkan tingkat
kemurnian yang tinggi >95%,
dengan peroehan kembai
40%
Karakterisasi rhGH murni
Pada proses karakterisasi rhGH murni dimana,
terdapat 3 proses, yaitu :
1. menggunakan proses
Squencing N-terminal dimana urutan Pada rhGH
yang didapat cocok dengan N-terminal pada
growth hormon manusia
2. Menggunakan MALDI-TOF/TOF dan
menunjukan adanya 86% karakterisitik peptida
untuk somatotropin manusia.
menggunakan
Bioanaizer Agilent 2100
dengan waktu retensi
yang sama dengan
rHgh murni
somatotropin komersial
komersial
menunjukan nilai CD
(Circular dichroism)
85%
pada peneitian ini
aktivitas biologi dari
rhGH yang telah
dimurnikan memiliki
aktivitas yang hampir
sama dengan
somatotropin yang
tersedia secara Keterangan
komersial. Hitam : Hgh komersial
Putih : hasil Hgh yang telah dimurnikan
DISCUSSION
Manajemen
terhadap
kekerdilan
pada pituitari
(dwarfisme)

Penyediaan supply dari hGH


Human yang stabil diperlukan secara
terus-menerus
Pengobatan
terhadap luka
Growth Pengobatan
gagal ginjal
Dan pengembangan produksi
hGH yang hemat biaya (cost-
bakar
Hormone kronis effective) dan juga yang
bermutu tinggi sangat
(hGH) diperlukan untuk pembuatan
produk hGH skala besar pada
industri farmasi

Pengobatan
patah tulang
hGH expression

Ekspresi hGH menggunakan promoter arabinose pada E.coli :


Terjadi di daerah periplasmic E.coli
Vektor pBAD yang termodifikasi menghasilkan rendemen
dari ekspresi rhGH dalam kadar yang tinggi jika
dibandingkan dengan menggunakan vektor pBAD24
Peningkatan rendemen ini karena : hasil sequence yang
efisien dan adanya peningkat translasi yang digabung
dalam vektor pBAD24M
Purifikasi hGH

Penulis menggunakan strain E.coli K12 Beberapa peneliti yang melakukan


untuk ekspresi percobaan purifikasi rhGH dengan
berbagai metode purifikasi
Teknik ini tidak memungkinkan untuk
kebanyakan menghasilkan
produksi dalam skala besar dan juga
rendemen yang masih sangat sedikit
penggunaan strain E.coli K12 dengan (sekitar 19 % : yang dilakukan Niimi
arabinose merupakan alternatif yang dkk, 1987)
bagus
Penulis ini menggunakan metode
Sebagian besar ekspresi rhGH yang
purifikasi rhGH yang menggunakan
diketahui sebagai periplasmic protein,
sistem promoter arabinose dengan
degradasi rhGH yang terekspresi tidak inklusi bakteri mencapai 750 mg l-1
dapat dihindari akibat adanya yang merupakan hasil tertinggi
beberapa enzim protease yang hingga saat ini
terdapat di area periplasmik hal ini
yang menjadi tantangan dalam proses
hilir selanjutnya
Bentuk hGH
Bentuk olligomerik GH memiliki bioaktivitas yang lebih
kecil dibanding bentuk monomeriknya
Data yang ditampilkan dalam jurnal ini mengenai :
pengamatan bentuk tunggal dari monomer rhGH tanpa
dimer yang menunjukkan potensi sistem ekspresi
untuk skala besar produksi rhGH
Data ini juga menunjukkan bentuk peak tunggal pada
Agilent 2100 bioanalyzer dengan waktu retensi yang
sesuai dengan GH komersial yang mengindikasikan
bahwa alat ini dapat digunakan untuk menilai
kemurnian dari proses preparasi rekombinan protein
Perbedaan kecil dari perpanjangan asam amino
ditemukan dapat menyebabkan perubahan
dalam laju ekspresi rhGH
Dan hal ini dicapai dengan adanya 20 gen
berbeda dari hGH dengan urutan Met-Xxx-Glu-
Glu-hGH, dimana Xxx menandakan 20 asam
amino berbeda yang membuat peneliti harus
melakukan upaya lanjutan untuk meningkatkan
jumlah ekspresi hGH menggunakan teknik yang
berbeda
Kesimpulan
Penelitian ini telah menunjukkan perbandingan
karaktersitik biokimia dari rhGH yang berasal dari
bakteri dengan standar rhGH dengan menguji urutan
N-terminal, MALDI-TOF/TOF, CD spectra dan Agilent
2100 bioanalyzer.
Pengamatan dari rhGH yang telah dimurnikan yang
diperoleh dari penelitian ini menunjukkan bioaktivitas
yang sama yang dibandingkan dengan rhGH komersial
Proses yang dilakukan dalam penelitian ini sangat
sederhana dan dengan biaya minimal untuk produksi
skala industri (besar)
PENDAHULUAN
tPa ??
Merupakan salah satu dari empat jenis aktivator plasminogen
(urokinase, streptokinase, tPa, dan DSPA1)
Diproduksi di dinding hati dan pada pembulu darah
Merupakan enzim dengan berat molekul 72kD dan tersusun dari
527 asam amino
Merupakan enzim yang terlibat dalam proses pemecahan gumpalan
darah dengan mengkatalisis konversi plasminogen menjadi plasmin
Hasil rekombinannya banyak digunakan untuk pengobatan penyakit
jantung dan oklusi pembulu darah otak
Mengapa Dikembangkan Teknik
Rekombinan tPa?
Harga
tPa masih Dikembangkan
sangat lah produksi
dibutuhkan tPa dengan
untuk Pada awalnya, teknik
pengobatan Menurut catalog rekombinan
penyakit Innovative sehingga dapat
jantung Research Inc, menghasilkan
harga Human TPA
Karena onset 0,1 mg sekitar Rp. tPa dalam
kerja tPa yang 3.634.000 jumlah banyak
cepat dalam (Tergolong
pengobatan Mahal)

Fungsi Solusi
Selanjutnya
dikembangkan
dengan teknik Dengan adanya
rekombinan pada : teknologi molekuler
Pada awalnya tPa
- Aspergilus nidulans farming,
berasal dari ekstraksi
dikembangkan lah
Human Bowes - Sel mamalia rekombinan protein
Melanoma Cells
- Sel insekta pada tanaman
mentimun
- S. Cerevisiae
- E. coli

Alasan Pemilihan
Alasan :
Mentimun :
DNA yang Tanaman dapat
Karena mentimun
mengandung tPa memproduksi protein
banyak tersebar
ditransfer kedalam tanpa mengubah
didunia. Sebanyak 2,5
nukleus tanaman struktur asli tanaman.
juta hektar dunia
dengan bantuan Molekuler dalam
ditanami tanaman
Agrobacterium pertanian memiliki
mentimun dan 42,5
potensi yang tidak
juta ton yang dipanen
terbatas
didunia
Keuntungan Menggunakan Teknik
Molekuler Farming
Molekuler Farming adalah
suatu proses penggunaan
Tanaman dapat tumbuh pada
tanaman dan hewan yang
Tanaman dapat skala pertanian yang cukup besar direkayasan secara genetis
memproduksi protein hanya dengan air, mineral dan sebagai suatu materi baru
kompleks yang tidak cahaya matahari. Dibandingkan
dapat diproduksi oleh dengan kultivasi sel mamalia yang
dan termodifikasi (Davies
yeast atau bakteri membutuhkan proses yang lebih and Chambers, 2000)
sulit dan mahal

Tanaman dapat
memproduksi protein
dalam jumlah banyak
pada jaringannya
(Norris, 2005)
Bahan dan Metode
Plasmid dan Bakteri
cDNA dari gen tPA manusia dengan situs restriksi Sac I dan
Bam HI di kloning ke dalam ekspresi tanaman vektor pBI121
yang mengandung kembang kol mosaik virus promotor
CaMV 35S, urutan terminator transkripsi (NOS), dan gen -
glucuronidase.

tPA diamplifikasi dengan primer yang mengandung XBA I dan


Hinc I

Kemudian dimasukkan ke dalam tanaman vektor biner pBI121


(diambil dari NIGEB) di bawah kendali kembang kol virus
mosaik promotor 35S dan NOS terminator

Bagian tengah gen ini diamplifikasi dengan dua primer (FB: 5-


ttgatgcgaaactgaggctg-3 dan RB: 5-cttctcagatttcgtgstacc-3)

Produk dimasukkan ke dalam dua CaMV35S dan NOS


terminator dan hilir dari vektor pBI121 dengan situs restriksi
XBA I dan Bam HI. Kemudian diisi ulang dengan DNA T4 ligase.
Transformasi Mentimun

Untuk
memverifikasi
regenerasi yang
tepat, eksplan
Setelah 6 hari, kotiledon tanaman
kotiledon diisolasi mentimun
Biji mentimun ditempatkan pada
didesinfeksi dari batang dengan
melengkung dan media MS dengan
dibagi menjadi 5x5- hormon naftalen
mm asetat (NAA) dan
konsentrasi yang
berbeda hormon
purin amino benzil
(BAP)
Analisis PCR dan RT-PCR
Karena tanaman resisten terhadap antibiotik kanamisin mungkin
tidak benar untuk tanaman reansgenik-untuk contoh, sel-sel
tumbuhan hanya menerima vektor (tanpa tPA gen) reaksi PCR
digunakan untuk mengkonfirmasikan keberadaan gen. Ekstraksi
DNA dari daun mentimun muda segar diregenerasi pada medium
selektif yang dilakukan melalui Metode CTAB. Keberadaan gen
tPA diselidiki dalam sel tumbuhan mentimun yang diregenerasi
pada media selektif dengan reaksi PCR dan tPA gen spesifik
primer.
Urutan dari primer adalah sebagai berikut:

F -tPA: 5GAGTCTAGATAAACAATGGATGCAATGAAGAGAGGG 3
R-tPA: 5ATAGTCAACTCATAGCTCATCTTTCGGTCGCATGTTG 3

Kondisi yang diperlukan untuk proliferasi DNA dari gen tPA termasuk
denaturasi awal 180s/950C, 35 siklus denaturasi 60s/950C, annealing 30s/600C,
dan elongasi 120s/720C. Produk PCR diperiksa pada 1% gel agarose dan Gelred.
Daun muda mentimun transgenik dan larutan RNX-Plus (Synagene, Inc)
digunakan untuk ekstraksi RNA. Pembangunan cDNA dilakukan
menggunakan kit ekstraksi cDNA (Fermentase Co).
Reverse-transkripsi (RT) -CR reaksi dan primer spesifik (dirancang dari gen tengah)
yang digunakan untuk ekspresi gen tPA di sel tumbuhan mentimun transgenik.
Urutan primer adalah sebagai berikut:

F -tPA: 5TGGGGAACCACAACTACTGCAGAAAC 3
R-tPA: 5GAAACCTCTCCTGGAAGCAGTGGG 3

Kondisi untuk amplifikasi cDNA gen tPA termasuk prime


dengan denaturasi 180s/950C, 35 siklus tiga langkah denaturasi 60s/950C,
annealing 45s/600C, dan elongasi 40s/720C.
Dot Blot Enzyme
Imunoassay

Pertama, 20 ng protein
Produksi dari protein
Untuk menggunakan teknik absolut tPA (kontrol positif)
rekombinan tPA pada sel
ini untuk mendeteksi dan protein yang
timbuhan ketimun
produksi protein diekstraksi dari daun
transgenik telah diteliti
rekombinan tPA pada transgenik dan tumbuhan
melalui teknik dot blot dan
ekstrak tumbuhan non-transgenik (sebagai
menggunakan antibodi
transgenik, kontrol) yang ditempatkan
yang spesifik.
di atas kertas nitroselulosa.

Bagian lain dari kertas


Setelah dicuci, antibodi
dihambat dengan serum
secondary peroksidase-
albumin babi. Kemudian perubahan warna diamati
linked bertambah. Dengan
kertasnya dicuci dengan hanya pada ekstrak
menambahkan substrat
buffer PBS-T dan tumbuhan yang
enzim yang mengandung
ditambahkan antibodi mengandung protein tPA.
larutan DAB stain dengan
primer (400
H2O2,
mikrogram/mL).
Analisa SDS-PAGE

Untuk mendeteksi massa molekul dari protein rekombinan tPA (terhadap


protein lain yang diproduksi pada tumbuhan ketimun transgenik yang
dibandingkan dengan tumbuhan non-transgenik), dilakukan
elektroforesis gel poliakrilamid (PAGE).

Metode simpel ini mempunyai pemecahan yang tepat untuk identifikasi


dan kemurnian protein secara spesifik. Pada penelitian ini, metode
sodium dedocyl sulfat (SDS) PAGE dengan sedikit modifikasi digunakan
untuk elektroforesis protein.

Gel terdiri dari dua bagian :


a) pemisahan gel dengan konsentrasi 12,5 % dan
b) pengahambatan gel dengan konsentrasi 4%.

Untuk menyiapkan gel ini, dibutuhkan akrilamid, bisakrilamid, SDS, tris


dan TEMED yang telah digunakan. Di akhir proses elektroforesis,
pewarnaan dan pemutihan gel telah terdeteksi pada scanner.
Enzymed Linked
Imunosorbent Assay

ELISA telah digunakan untuk penetuan secara kuantitas dari protein rekombinan
tPA relatif terhadap protein terlarut pada tanaman ketimun transgenic

Tujuannya, setelah penentuan densitas dari protein yang telah diekstrak pada
tanaman transgenik maupun daun non transgenik dengan spektrofotometer, 50
ng setiap sampel ditempatkan pada piring dengan 5 kali pengulangan.

Dan juga, untuk prosedur kurva standar, digunakan enam konsentrasi protein tPA
yang berbeda.

Setelah semua tahap percobaan selesai dilakukan, termasuk penambahan


protein non relexive, untuk contoh, serum albumin babi, primary antibody yang
dilarutkan (200 kali) dan secondary antibody yang dilakukan (200 kali) yang
mengandung peroksidase, substrat enzim TMB melekat antibodi secondary yang
digunakan.

Setelah 15 menit, larutan berhenti ditambahkan dan peneyerapan telah terbaca


pada 450 nm dengan ELISA.
Result & Discussion
Transformasi Cucumber

Gen tPA dikloning ke


Kloning gen tPA struktur yang dihasilkan,
dalam vektor pBI121
dikonfirmasi oleh koloni ditransformasikan ke sel pBI121-tPA membangun
bawah promotor
PCR, enzim pencernaan, inang bakteri (E. coli informasi
CaMV35S, Kozak urutan,
dan sequencing galur DH5a)
dan sinyal KDEL
Studi mengenai regenerasi sel tumbuhan Tahapan inokulasi regenerasi eksplan kotiledon
mentimun dilakukan dalam konsentrasi dan akar tanaman.
NAA dan BAP yang berbeda.

Menurut Abukazemy et al. (2011)


regenerasi terbaik tercapai pada media
MS dengan hormon NAA (0,1 mg/L) dan
BAP (3 mg/L ).

Setelah mempersiapkan eksplan


kotiledon, inokulasi yang dilakukan oleh
Agrobacterium yang mengandung
struktur pBI121-tPA.

Konsentrasi terbaik dari antibiotik


kanamisin untuk eliminasi sel non-
transgenik , yaitu 40mg/L.

Pemilihan tanaman transgenik dilakukan


melalui regenerasi pada media selektif
yang mengandung antibiotik kanamisin.

Dalam hal ini, eksplan yang tidak


menerima konstruksi, tidak mampu a. Inokulasi eksplant timun
regenerasi pada media selektif. b. Regenerasi dari inokulasi eksplan pada medium selektif
c. Perakaran bibit diregenerasi pada medium akar
d. Transformasi bibit ke tanah dan lingkungan non steril
Analisis Molekuler dari Regenerasi Tanaman
Cucumber
Reaksi PCR dengan primer Hasil PCR tanaman transgenik
gen spesifik dilakukan pada
DNA yang diekstraksi dari
tanaman mentimun.
Beberapa band yang diamati
pada 1700 bp tanaman
transgenik.
Kehadiran single band di
sekitar 1700 bp di setiap
tanaman regenerasi dengan
ketiadaan pada tanaman
kontrol adalah alasan kuat
untuk tPA gen transformasi
ke tanaman mentimun.
Analisis Molekuler dari Regenerasi
Tanaman Cucumber
Hasil PCR tanaman transgenik

RT PCR dilakukan pada


produksi cDNA. RT-PCR
dengan primer spesifik dari
tengah gen menunjukkan
beberapa band di sekitar
500 bp.

Tidak adanya band-band ini


pada tanaman non-
transgenik adalah alasan
untuk ekspresi gen tPA
dalam tanaman transgenik
Setelah ditransformasi pada
Dalam penelitian ini, telah di sel nukleus tanaman
jelaskan bahwa pada awalnya, mentimun dengan bantuan
kloning gen tPA ke vektor Agrobacterium dan
pBI121 dikonfirmasi dengan regenerasi pada medium
reaksi : yang selektif, keberadaan
PCR kloning dan ekspresi gen tPA
Enzim pencernaan dikonfirmasi dengan tes
Eequencing menggunakan PCR dan RT-
PCR
Akhirnya, produksi tPA protein dan nilai relatif terhadap nilai total protein
terlarut ditentukan oleh tiga percobaan, yaitu :
Dot Blot
Dot blot adalah sebuah teknik untuk Dalam percobaan ini, ada atau tidaknya
mendeteksi, menganalisis, dan protein tPA diantara semua protein yang
mengidentifikasi protein. diekstraksi pada daun tanaman transgenik
diselidiki dengan antibodi spesifik.
Protein sampel tidak dipisahkan melalui Setelah menambahkan substrat ikatan
elektroforesis akan tetapi ditandai enzim antibodi sekunder, termasuk larutan
dengan template sirkuler secara pewarna DAB, H2O2, dan PBS.
langsung pada substrat kertas.
Amati perbedaan warna :
Ekstrak yang mengandung protein tPA
Prinsip : dari tidak berwarna hingga coklat
Penempelan protein atau asam nukleat Tanaman non-transgenik Tidak ada
secara langsung pada membran. Sampel perubahan yang terlihat
yang terlarut ditarik melalui membran baik
menggunakan vakum, maupun absorpsi
dan intrusi, sehingga protein berikatan
dengan membran sedangkan komponen
lainnya dapat melewati membran.
Dot Blot

Variasi dalam intensitas warna pada sampel kontrol positif (C+; protein tPA murni)
mungkin karena perbedaan konsentrasi yang tidak diinginkan.

Perbedaan antara tanaman non-transgenik (wt) karena adanya kotoran dalam ekstrak
protein
Sistem produksi
protein rekombinan
farmasi menggunakan
sistem mikroba,
serangga dan kultur
sel mamalia, dan Produksi
hewan transgenik protein pada
memiliki kelemahan tanaman
dalam hal : meningkat
Biaya produksi
Keamanan produk
Integritas
Obat protein tPA lebih disukai dibandingkan
dengan obat lain yang serupa.
Waktu paruh plasma berkurang pada
Reteplase, Saruplase, Lanutplase dan dosis
lebih rendah daripada Reteplase dan
Lantuplase.
Spesifisitas tPA jauh lebih besar daripada
streptokinase. Namun, perkiraan biaya setiap
perlakuan lebih besar dibanding streptokinase
Dalam penelitian ini, ditemukan bahwa dengan banyaknya produksi tanaman mentimun
pengobatan penyakit menjadi lebih mudah

Nilai protein rekombinan dalam tanaman transgenik dilaporkan antara


0,002% dan 7% dari total protein larut tergantung pada faktor ekspresi
gen spesifik dan tanaman yang digunakan untuk transformasi

Namun, dalam penelitian ini, tingkat ekspresi protein tPA relatif


terhadap total protein yang terlarut dalam tanaman mentimun
transgenik, yaitu 0,8-1%

Adanya tiga faktor regulasi ekspresi yaitu (CaMV 35S, Kozak, NOS) dan
KDEL menyebabkan peningkatan ekspresi gen tPA pada tanaman
mentimun

Menurut penelitian lain, ekspresi gabungan ini digunakan untuk


produksi HGM-CSF di tanaman tomat dan menyebabkan produksi
protein rekombinan 0,02% dari total protein yang larut

Alasan untuk peningkatan produksi tanaman mentimun mungkin adalah


kombinasi gen dengan sinyal KDEL. Sehingga sangat meningkatan
akumulasi protein rekombinan dalam tanaman

Cara evaluasi, faktor, dan metode lain untuk meningkatkan efisiensi transfer gen untuk
produksi protein tPA pada mentimun dan tanaman lainnya dianjurkan.
SDS - PAGE
Tujuan: Identifikasi dan pemurnian
protein spesifik (protein rekombinan
tPA)
Pada Jurnal ini hasil pita pada garis
o Wt= sampel control yaitu tanaman
timun non-transgenic
o L= Marker molekul protein
o 1-3= Sampel Tanaman timun
transgenic

Protein dari tPA memiliki berat


molekul yaitu 60-67kDa
Pita tambahan terlihat pada sampel
tanaman transgenic dan tidak dimiliki
oleh sampel tanaman kontrol
ELISA (Enzyme Linked
Immunosorbent Assay)
Tujuan: Menentukan jumlah protein rekombinan tPA
Absorbansi sampel tanaman control dan tanaman transgenic diukur
pada panjang gelombang 450nm
Protein tPA murni diukur dan dibuat sebagai kurva standard, untuk
menentukan kadar dari masing masing sampel
Hasil dari elisa menunjukan bahwa laju absorbansi tanaman timun
transgenic dua kali lebih banyak dari non transgenic
Pada tahap cloning awal, gen ditransformasi oleh
Agrobacterium dan mendapatkan Protein rekombinan Human
Tissue Plasminogen di dalam sel tanaman timun.
Kloning DNA tPA dilakukan ke vector pBI121 dikonfirm dengan
PCR cloning reactor, Enzyme digestion dan Sequencing.
Setelah itu ditransformasikan ke medium yang selektif,
keberadaan dan ekspresi gen tPA dikonfirmasi dengan PCR
dan RT-PCR.
Terakhir yaitu produksi protein rekombinan tPA dan
perhitungan jumlah relative dan jumlah total protein terlarut
dengan 3 eksperimen yaitu Dot- blot, SDS-PAGE dan ELISA
Daftar Pustaka
Anonim, The Recombinant Protein Handbook, Protein Amplification and Simple Purification, Edition
AA, Amersham Pharmacia Biotech,
Grompe, Marcus et.al. 1998. Teknik Rekombinan DNA dan Genetik. Principles of Molecular
Medicine
Kayser, O., dan Muller, R.H. (2004). Pharmaceutical Biotechnology; Drug Discovery and Clinical
Applications. Willey-VCH: German
Marks, B. Dawn. 2000. Biokimia Kedokteran Dasar: Sebuah Pendekatan Klinis. Jakarta: EGC
Mshaneh Asgari et al.,2014. Production Of Human Tissue Plasminogen Activator (tPa) in Cucumis
sativus.http://www.tandfoline.com/Ioi/Ipbb20
http://www.biotecharticles.com/Genetics-Article/Advantages-of-Recombinant-DNA-351.html
https://www.quora.com/What-are-the-advantages-and-disadvantages-of-recombinant-DNA
http://www.biology.lifeeasy.org/5128/recombinant-dna-disadvantages
http://www.bphn.go.id/data/documents/pkj_2012_-_4.pdf
http://www.sigmaaldrich.com/technical-documents/articles/biology/protein-expression-
systems.html
http://procube.sysmex.co.jp/eng/p/e_silkworm_outline/
https://www.uq.edu.au/pef/content/protein-expression-0
http://www.amsbio.com/baculovirus-protein-expression-services.aspx diakses pada Minggu, 18
Desember 2016
Apa saja sistem ekspresi yang dapat
digunakan untuk produksi protein rekombinan
dan apa kelebihannya