DNA, RNA, Cells,

Bioinformatics
BMED 213 - Lecture 3
Learning Objectives
Discuss gene expression
Explain how proteins are formed from mRNA
Describe Exons, Introns, Codons, and transcription
Discuss OI and how gene therapy may be useful in the future to treat
it
Cell Organization
Plasma Membrane is the boundary between inside and outside of the
cell
Composition: Approximately 60% water. The balance being organic
compounds & traces of inorganics
Eukaryotic-cell nucleus is surrounded by a membrane (animal cells)
Prokaryotic-single cellular chromosome or organelles
DNA
The molecule inside the nucleus of a cell that carries the genetic
instructions for making living organisms
Double helix composed of phosphates, sugars, and 4 nitrogenous
bases (A, G, C, T)
DNA -Adenine, Guanine, Cytocine, Thymine
DNA
Exons
Definition: The region of a gene that contains the code for producing
proteins (The process of producing protiens is termed translation).
Each exon codes for a specific portion of the complete protein.
In some species (including humans), a gene's exons are separated by long
regions of DNA (called introns).
Exons, Introns, and Genes
The gene is a sequence of exons and
introns containing information
The instructions in a gene that tell the
cell how to make a specific protein. A, T,
G, and C are the "letters" of the DNA
code; they stand for the chemicals
adenine, thymine, guanine, and cytosine,
respectively, that make up the nucleotide
bases of DNA.
Each gene's code combines the four
chemicals in various ways to spell out 3-
letter "words" that specify which amino
acid is needed at every step in making a
protein.
Intron
Definition: A noncoding sequence of DNA that is initially copied into
RNA but is cut out of the final RNA transcript.
Regulated by external factors to provide an instruction set for mRNA
encoding
Approximately 95% of DNA is not encoded into protein
Introns allow for creating many
different proteins with a more
compact gene
Codon
Three base (GCUA) sequences in RNA
which specify (code for) a single amino
acid
Defines the words DNA uses to build
amino acid chains (protein)
There are 20 amino acids
The word can be start, stop, or an
amino acid building block
Even though all proteins start coding
with M, it (the amino acid, M) may be
edited out later
RNA
A chemical similar to a single strand of DNA. In RNA, the letter U,
which stands for uracil, is substituted for T in the genetic code.
RNA delivers DNA's genetic message to the cytoplasm of a cell where
proteins are made.
mRNA is messenger RNA - the most important variant of RNA - which actually
carries the message
Central Dogma

The process is DNA to RNA to

protein
Protein synthesis occurs by
reading the information in one
direction
Not possible to reverse order
Gene Expression
The conversion of the
information from the gene
(Genotype) into mRNA via
transcription and then to protein
via translation resulting in the
phenotypic manifestation of the
gene (Phenotype)
Genotype and Phenotype
Genotype
The entire genetic makeup of an
organism; the combination of
genes for one or more specific
traits
The combination of alleles
inherited from parents
The actual GENES
Ex: GG (one G from each parent)
= green pea pod
Phenotype
An organisms appearance or
other detectible appearance
Observable traits
PHYSICAL appearance
Ex GG = Green pea pod
(observable trait: based on
genotype)
 Exon1 Exon2

2 Proteins

Exon1 Intron1 Exon2

3 Proteins
E1, E2, E1E2
 Translation Exercise

UUCGUCAUGGGAUGUAAGCGAUAA
UUC GUC AUG GGA UGU AAG CGA UAA
M G C K R STOP
Why are codons composed of 3
nitrogenous base combinations?

A. Three works
B. Two would not work
C. No one really knows why
D. Four would work better
E. None of these
A genetic region has 3 exons (E1,E2, and E3)
separated by 2 introns. What is the number of proteins that can be
formed?

A. 3
B. 4
C. 5
D. 6
E. 7
The presence of introns in the gene allows for a larger number
of proteins to be formed from fewer exons.

A. True
B. False
How many amino acids are there in DNA?

A. 20
B. 3
C. 4
D. 5
E. None of the above
Determination of Cell Properties
Micropipette aspiration is performed to determine the mechanical
properties of single cells.
Chondrocytes are isolated from the extracellular matrix using
enzymatic digestion
A microscopic pipette (5 m diameter) is used to apply a small
pressure to the cell surface, and the ensuing deformation is recorded
through a videomicroscope.
Micropipette Aspiration

In combination with a
theoretical analysis, the
viscoelastic properties of the
cell can be determined with this
experiment.
http://www.mae.ufl.edu/cellme
ch/gallery/g-recovery.html
Finite Element Analysis
To determine the nature of the interactions between the
chondrocyte, the pericellular matrix (PCM), and the ECM, we
developed a model for cell-matrix interactions based upon detailed
microscopy of the cell membrane, the PCM, and the ECM.
By dividing the analysis into two separate problems, a multiple scaling
algorithm can be used to calculate the stress-strain environment in
the vicinity of the cell.
 FEM Results

The presence of a PCM can

significantly alter the
mechanical response of the
cell, implying a functional
mechanical role for this
region. Slight changes in the
PCM mechanical properties,
as occurs with aging or
disease, may alter the
interactions between the
chondrocyte and ECM.
Mechanotransduction

These studies suggest that changes in

osmotic stress induce volume change
in isolated cells and may initiate
[Ca2+] ion transients through an actin-
dependent mechanism within the
cell...
May affect local and distanct tissue
structure
Name the process by which substances too large to pass though the
plasma membrane are moved out of the cell.

A. Osmosis
B. Active Transport
C. Exocytosis
D. Diffusion
 Case Study
Cellular/Genetic Therapy for Bone Diseases
The Problem

A child is brought into the emergency

room with a fractured leg. The parents
are unable to explain how the leg
fractured. X-rays reveal several other
fractures in various stages of healing. The
parents say they did not know about
these fractures, and cannot explain what
might have caused them. Hospital
personnel call child welfare services to
report a suspected case of child abuse.
The child is taken away from the parents
and placed in foster care.
The Reality
Scenes like this occur in emergency rooms every day. But in this case,
the cause of the fractures is not child abuse. It is osteogenesis
imperfecta, or OI. OI is a genetic disorder characterized by bones that
break easily--often from little or no apparent cause. A person with OI
may sustain just a few or as many as several hundred fractures in a
lifetime.
Two Classifications

Cortical
Trabecular
Trabecular Bone

Cortical Bone
Cortical Bone Composition

25%

43% Water
Organic
Apatite

32%

Collagen (Type I)
Proteoglycan
Others
Bone Microstructure

Highly organized collagen fiber

Lamellar Organization
Haversian canals for blood
supply
Structure of Cortical Bone
Cortical Bone Microstructure
Bone is a composite material, with a mineral phase (hydroxyapatite) and an
organic phase (mostly collagen)
Two types of cortical bone:
Primary: that which is formed first
Secondary: that which forms in response to remodeling
Cortical bone can have several forms
Lamellar (sheets of mineral with oriented reinforcing collagen)
Woven bone (mineral with disorganized collagen)
Plexiform (a brick-like structure)
Osteons are the dominant feature of secondary cortical bone
Role of Collagen
Bone is a composite of an apatite and collagen
Apatite functions for compressive strength
Collagen serves to toughen bone
Collagen

Self-assembled into long, thin

fibrils that cross-link to one
another in the spaces around
cells
The cross-links result in the
formation of very strong mature
type I collagen fibers.
Osteogenesis Imperfecta
Brittle bone disease
4 levels
Type I
Type II
Type III
Type IV
Most severe forms are fatal
Type I
Most Common and mildest form
Bones predisposed to fracture. Most fractures occur before puberty
Sclera (whites of the eyes) usually have a blue, purple, or gray tint
Normal or near-normal stature
Collagen form is normal, but the amount is less than normal
Type II
Most severe form.
Frequently lethal at or shortly after birth, often due to respiratory
problems. In recent years, some people with Type II have lived into
young adulthood.
Numerous fractures and severe bone deformity.
Small stature with underdeveloped lungs.
Collagen is improperly formed
Type III
Severe form of the disease
Bones fracture easily.
Fractures often present at birth, and x-rays may reveal healed fractures that occurred before
birth.
Short stature.
Sclera have a blue, purple, or gray tint.
Respiratory problems possible.
Bone deformity, often severe.
Brittle teeth possible.
Hearing loss possible.
Collagen is improperly formed
Type IV
Between Type I and Type III in severity.
Bones fracture easily, most before puberty.
Shorter than average stature.
Sclera are white or near-white (i.e., normal in color).
Mild to moderate bone deformity.
Tendency toward spinal curvature.
Barrel-shaped rib cage.
Triangular face.
Brittle teeth possible.
Hearing loss possible.
Collagen is improperly formed.
Causes
Most cases of OI are caused by a dominant genetic defect.
Mutations in one of two genes
type I collagen
Family history
No family history of the disorder
Genetic defect occurred as a spontaneous mutation
Collagen Defect (mutation) COL1A1
The COL1A1 gene provides instructions for making part of a large
molecule called type I collagen. Collagens are a family of proteins that
strengthen and support many tissues in the body, including cartilage,
bone, tendon, skin, and the white part of the eye (the sclera). Type I
collagen is the most abundant form of collagen in the human body.
A component of type I collagen called the pro-1(I) chain is produced
from the COL1A1 gene. Collagens begin as rope-like procollagen
molecules that are each made up of three chains. Type I collagen is
composed of two pro-1(I) chains and one pro-2(I) chain (which is
produced from the COL1A2 gene).
Collagen Defect (mutation) COL1A2
The COL1A2 gene provides instructions for making part of a large
molecule called type I collagen. Collagens are a family of proteins that
strengthen and support many tissues in the body, including cartilage,
bone, tendon, skin, and the white part of the eye (the sclera). Type I
collagen is the most abundant form of collagen in the human body.
A component of type I collagen called the pro-2(I) chain is produced
from the COL1A2 gene. Collagens begin as rope-like procollagen
molecules that are each made up of three chains. Type I collagen is
composed of two pro-1(I) chains (which are produced from the
COL1A1 gene) and one pro-2(I) chain.
Effects
Childrens bones easily break under normal
activity
Hearing Loss
Short stature
Brittle teeth
Whites of the eye are not the proper color
Etc
Death is usually due to pulmonary failure
associated with deformity of the thorax,
i.e. rib cage, vertebra (scoliosis)
Treatments SOST GENE
There is not yet a cure for OI
Treatment is directed toward preventing or
controlling the symptoms
Maximizing independent mobility
Developing optimal bone mass and muscle
strength
Bisphosphonate drugs
Sclerostin antibody (Scl-Ab) therapy may be
beneficial for treating OI by stimulating
osteoblast production.
Sclerostin is a protein that in humans is
encoded by the SOST gene and produced by
osteocytes