Anda di halaman 1dari 33

REPLIKASI DNA

BS-1 (2)

REPLIKASI DNA 1
A. Struktur DNA
B. Gambaran umum replikasi kromosom
C. Mekanisme & fase dalam replikasi DNA
D. Peran masing-masing enzim dalam replikasi
DNA
E. DNA REPAIR

REPLIKASI DNA 2
referensi

REPLIKASI DNA 3
REPLIKASI DNA 4
A. STRUKTUR DNA

REPLIKASI DNA 5
REPLIKASI DNA 6
B. GAMBARAN UMUM REPLIKASI DNA

REPLIKASI DNA 7
REPLIKASI DNA
(penggandaan DNA)

REPLIKASI DNA 8
Replikasi DNA terjadi pada:
1. leading strand template
2. lagging strand template

REPLIKASI DNA 9
Replikasi DNA pada:
1. leading strand template
berlangsung dari 3’ – 5’
secara berkelanjutan.
2. lagging strand template
berlangsung dari 5’ – 3’ secara
simultan.
REPLIKASI DNA 10
C. MEKANISME & FASE REPLIKASI DNA

1. Inisiasi
2. Elongasi
3. Pelepasan primer
4. Penggabungan fragmen DNA

REPLIKASI DNA 11
1. Inisiasi:
awal replikasi, primer RNA dibentuk oleh DNA primase pada lagging
strand (sintesis fragmen Okazaki 1).

REPLIKASI DNA 12
2. Elongasi:
pilin DNA asal dibuka lebih lanjut dan pemanjangan pilin DNA
baru, pemanjangan fragmen Okazaki 2.

REPLIKASI DNA 13
3. Elongasi lanjutan:
fragmen Okazaki 2 berakhir, fragmen Okazaki 3 dibentuk dan
berikutnya DNA primase mulai membentuk fragmen 4.

REPLIKASI DNA 14
4. Pelepasan primer:
DNA polimerase 1 melepas primer dari DNA.

REPLIKASI DNA 15
5. Penggabungan fragmen DNA:
fragmen DNA baru digabungkan (disambung) oleh DNA ligase

REPLIKASI DNA 16
DNA DOUBLE HELIX
3’ 5’
ATGCCGTTAAGCCGATAGACGTACGTAAGGCATTGACCAGGTAGGCC

5’ 3’

REPLIKASI DNA 17
PASANGAN DNA PADA LEADING STRAND

3’ 5’
ATGCCGTTAAGCCGATAGACGTACGTAAGGCATTGACCAGGTAGGCC

5’ 3’

REPLIKASI DNA 18
BUATLAH FRAGMENT OKAZAKI

3’ 5’

5’ 3’

REPLIKASI DNA 19
PASANGAN DNA PADA LAGGING STRAND

3’ 5’

5’ 3’

REPLIKASI DNA 20
D. Peran enzim dalam Replikasi
Enzim atau Faktor Aktivitas
Helicase Pengurai DNA heliks
Protein Pengikat Menstabilkan DNA dalam
bentuk untai tunggal
DNA Mengkait pada garpu
topoisomerase replikasi
Primase Mensintesis primers RNA
DNA polimerase Membentuk rantai DNA
pada primers
DNA ligase Menyambung DNA
REPLIKASI DNA 21
REPLIKASI DNA 22
REPLIKASI DNA 23
REPLIKASI DNA 24
E. DNA REPAIR

25
26
27
28
Kelainan DNA repair pada
anak tersebut
menyebabkan stratum
korneum menebal dan
berpigmen (Xeroderma
pigmentosum) kanker kulit
yang diturunkan dari kedua
orang tuanya

29
Seorang anak penderita Xeroderma pigmentosum bermain-
main diluar rumah. Menggunakan pakaian khusus yang
dirancang oleh NASA. Pakaian tersebut tak tertembus sinar
ultraviolet yang dihasilkan oleh sinar matahari.
30
Xeroderma pigmentosum adalah penyakit turunan Kanker Kulit yang
terjadi karena tereksposenya kulit terhadap sinar matahari.
Laporan pertama  yang menghubungkan antara DNA
“repair” dengan kanker diperoleh dari
hasil penelitian pada penyakit Xeroderma
Pigmentosum.
Ada Individu  sangat sensitif UV sinar matahari walaupun
hanya beberapa menit
 kanker kulit Xeroderma Pigmentosum.termasuk
karsinoma sel basal sel squamosa dan
melanoma
Bagi mereka hanya bisa keluar rumah pada malam hari
 “Anak-anak Bulan” (Children of the Moon)
 di New York ada “Camp Sundown”
NASA  “Special Space Suit”
31
REPLIKASI DNA 33