Anda di halaman 1dari 46

From Gene to Protein

How Genes Work


AP Biology
2007-2008

What do genes code for?

How does DNA code for cells & bodies?

how are cells and bodies made from the instructions in DNA

DNA
AP Biology

proteins

cells

bodies

The Central Dogma

Flow of genetic information in a cell

How do we move information from DNA to proteins?

DNA

RNA

protein
DNA gets all the glory, but proteins do all the work!

trait

replication

AP Biology

Metabolism taught us about genes

Inheritance of metabolic diseases


suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product

lack of an enzyme Tay sachs PKU (phenylketonuria) albinism


disease

Am I just the sum of my proteins?

metabolic pathway

AP Biology enzyme 1

enzyme 2

disease

enzyme 3

disease

enzyme 4

disease

Beadle & Tatum

1941 | 1958
one gene : one enzyme hypothesis

George Beadle

Edward Tatum
AP Biology

"for their discovery that genes act by regulating definite chemical events"

Beadle & Tatum


Wild-type Neurospora

X rays or ultraviolet light create mutations

Minimal medium
spores

asexual spores

Growth on complete medium positive control

Select one of the spores Test on minimal medium to confirm presence of mutation negative control Grow on complete medium

Minimal media supplemented only with


experimentals Choline Pyridoxine Riboflavin Minimal Nucleic Arginine control amino acid p-Amino Niacin Inositol acid Folic supplements acid Thiamine benzoic acid AP Biology

From gene to protein


nucleus cytoplasm

a a

transcription

translation

a a

a a

a a a a a a

DNA

mRNA
ribosome

a protein
a a a a a

a a

a a

trait
AP Biology

Transcription
from DNA nucleic acid language to RNA nucleic acid language

AP Biology

2007-2008

RNA

ribose sugar N-bases


uracil instead of thymine U : A C : G

single stranded lots of RNAs

mRNA, tRNA, rRNA, siRNA transcription

DNA
AP Biology

RNA

Transcription

Making mRNA

transcribed DNA strand = template strand untranscribed DNA strand = coding strand

same sequence as RNA transcription bubble

synthesis of complementary RNA strand

enzyme

RNA polymerase

coding strand
A T C G T

5
C

DNA

A G T A T C T A

G C

A G C T

T A

C A G C T G

A T

A T

3 5

3
G C A U C G U C G T A G C A T

3
AP Biology build RNA

unwinding

rewinding

mRNA

53

RNA polymerase

template strand

RNA polymerases

3 RNA polymerase enzymes

RNA polymerase 1

only transcribes rRNA genes makes ribosomes transcribes genes into mRNA only transcribes tRNA genes

RNA polymerase 2

RNA polymerase 3

each has a specific promoter sequence it recognizes

AP Biology

Which gene is read?

Promoter region
binding site before beginning of gene TATA box binding site binding site for RNA polymerase & transcription factors

Enhancer region

binding site far upstream of gene

turns transcription on HIGH AP Biology

Transcription Factors

Initiation complex

transcription factors bind to promoter region


suite of proteins which bind to DNA hormones? turn on or off transcription

trigger the binding of RNA polymerase to DNA

AP Biology

Matching bases of DNA & RNA

Match RNA bases to DNA bases on one of the DNA strands

A G U G U C G G A U A

C A

U C

C
A AG C U

5'

RNA A C C polymerase G

3'

T GG T A C A G C T A G T C A T CG T A C CG T
AP Biology

Eukaryotic genes have junk!

Eukaryotic genes are not continuous

exons = the real gene

expressed / coding DNA inbetween sequence

introns come out!

introns = the junk

intron = noncoding (inbetween) sequence

eukaryotic DNA
exon = coding (expressed) sequence

AP Biology

mRNA splicing

Post-transcriptional processing

eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript
intron = noncoding (inbetween) sequence

~10,000 base

eukaryotic DNA
exon = coding (expressed) sequence

pre-mRNA

primary mRNA transcript


AP Biology

mature mRNA transcript

~1,000 base

spliced mRNA

Discovery of exons/introns

1977 | 1993

Richard Roberts
CSHL

Philip Sharp MIT

adenovirus common cold

beta-thalassemia
AP Biology

Splicing must be accurate

No room for mistakes!

a single base added or lost throws off the reading frame

AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AP Biology Met|Arg|Val|Arg|STOP|

RNA splicing enzymes

Whoa! I think we just broke a biological rule!

snRNPs

small nuclear RNA exon proteins


5'

snRNA intron

snRNPs exon 3'

Spliceosome

several snRNPs recognize splice site sequence

spliceosome 5' 3' lariat 5' 3'

cut & paste gene


No, not smurfs!

snurps

AP Biology

mature mRNA

exon 5'

exon 3' excised intron

Alternative splicing

Alternative mRNAs produced from same gene


when is an intron not an intron different segments treated as exons

Starting to get hard to define a gene!

AP Biology

More post-transcriptional processing

Need to protect mRNA on its trip from nucleus to cytoplasm

enzymes in cytoplasm attack mRNA


protect the ends of the molecule add 5 GTP cap add poly-A tail
longer tail, mRNA lasts longer: produces more protein

3' A

mRNA P G P P

5'

AP Biology

From gene to protein


nucleus cytoplasm

a a

transcription

translation

a a

a a

a a a a a a

DNA

mRNA
ribosome

a protein
a a a a a

a a

a a

trait
AP Biology

Translation
from nucleic acid language to amino acid language

AP Biology

2007-2008

How does mRNA code for proteins?


DNA
4 ATCG

TACGCACATTTACGTACGCGG

mRNA AUGCGUGUAAAUGCAUGCGCC
4 AUCG

?
Met Arg Val Asn Ala Cys Ala
How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

protein
20
AP Biology

mRNA codes for proteins in triplets

DNA

TACGCACATTTACGTACGCGG
codon

mRNA AUGCGUGUAAAUGCAUGCGCC

?
AP Biology

protein

Met Arg Val Asn Ala Cys Ala

Cracking the code

1960 | 1968
Nirenberg & Khorana

Crick

determined 3-letter (triplet) codon system

WHYDIDTHEREDBATEATTHEFATRAT

Nirenberg (47) & Khorana (17)


determined mRNAamino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids

created artificial UUUUU mRNA found that UUU coded for phenylalanine

AP Biology

Marshall Nirenberg

1960 | 1968

Har Khorana

AP Biology

The code

Code for ALL life!

strongest support for a common origin for all life several codons for each amino acid 3rd base wobble

Code is redundant

Why is the wobble good?

Start codon

AUG methionine

AP Biology

Stop codons

UGA, UAA, UAG

How are the codons matched to amino acids?


DNA

TACGCACATTTACGTACGCGG
5 3

mRNA AUGCGUGUAAAUGCAUGCGCC
3 5

codon

UAC
tRNA amino acid
AP Biology

GCA CAU anti-codon Met


Arg

Val

From gene to protein


nucleus cytoplasm

a a

transcription

translation

a a

a a

a a a a a a

DNA

mRNA
ribosome
aa

a protein
a a a a a

a a

a a

trait
AP Biology

Transfer RNA structure

Clover leaf structure


anticodon on clover leaf end amino acid attached on 3 end

AP Biology

Loading tRNA

Aminoacyl tRNA synthetase


enzyme which bonds amino acid to tRNA bond requires energy


ATP AMP bond is unstable so it can release amino acid at ribosome easily
Trp C=O
OH OH

Trp C=O
O

Trp H2O
O

activating enzyme tRNATrp anticodon

AP Biology

tryptophan attached to tRNATrp

AC C UGG

mRNA

tRNATrp binds to UGG condon of mRNA

Ribosomes

Facilitate coupling of tRNA anticodon to mRNA codon

organelle or enzyme?

Structure
ribosomal RNA (rRNA) & proteins 2 subunits

large small

E P A

AP Biology

Ribosomes

A site (aminoacyl-tRNA site)

holds tRNA carrying next amino acid to be added to chain holds tRNA carrying growing polypeptide chain empty tRNA leaves ribosome from exit site

P site (peptidyl-tRNA site)

Met

E site (exit site)

5'
U A C A U G

3'

AP Biology

Building a polypeptide

Initiation

brings together mRNA, ribosome subunits, initiator tRNA adding amino acids based on codon sequence end codon
Met Met

Elongation

Termination

Leu

3 2 1
Val Ser release factor Trp
Leu
Leu

Met tRNA

Met Leu

Ala

U AC 5' C UGAA U mRNA A U G 3' E P A

5'

UAC GAC A U G C U GA A U

5'
3'

U A C GA C AA U A U G C UG

5' 3'

U AC G A C AA U AU G C UG

3'

A CC U GG U A A

3'

AP Biology

Destinations:

Protein targeting

Signal peptide

address label
start of a secretory pathway

secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc

AP Biology

RNA polymerase DNA

Can you tell the story?


pre-mRNA

amino acids
exon intron

tRNA
5' GTP cap

mature mRNA
poly-A tail large ribosomal subunit

aminoacyl tRNA synthetase

polypeptide

3'

5'
small ribosomal subunit

tRNA E P A

AP Biology

ribosome

The Transcriptional unit (gene?)


enhancer
1000+b

20-30b 3' RNA TATA polymerase DNA

translation start TAC

exons

translation stop ACT 5' DNA

transcriptional unit (gene)

UTR

introns

UTR

promoter

transcription start
5' pre-mRNA

transcription stop
3'

AP Biology

5' GTP mature mRNA

3'

AAAAAAAA

Bacterial chromosome

Protein Synthesis in Prokaryotes


Psssst no nucleus!

Transcription mRNA

Cell membrane Cell wall


AP Biology
2007-2008

Prokaryote vs. Eukaryote genes

Prokaryotes

Eukaryotes

DNA in cytoplasm circular chromosome naked DNA no introns

DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons
introns come out!

intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence
AP Biology

Translation in Prokaryotes

Transcription & translation are simultaneous in bacteria


DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

AP Biology

Translation: prokaryotes vs. eukaryotes

Differences between prokaryotes & eukaryotes

time & physical separation between processes

takes eukaryote ~1 hour from DNA to protein

no RNA processing

AP Biology

Any Questions??
What color would a smurf turn if he held his breath?

AP Biology

2007-2008

Substitute Slides for Student Print version

AP Biology

2007-2008

Can you tell the story?

AP Biology

The Transcriptional unit


enhancer
1000+b

20-30b 3' RNA TATA polymerase TAC

exons transcriptional unit


ACT 5' DNA

introns

5'

3'

5'
AP Biology

3'