Anda di halaman 1dari 19

Strategi Kloning Gen Insulin dengan

Menggunakan Vektor pSVL pada


Host Cell COS-7 dari sel epitel
ginjal kera hijau Afrika

Kelompok 12

COS-7
Lini sel COS-7 ini
berasal dari ginjal dari
kera
hijau
Afrika,
Cercopithecus aethiops
Mampu
mengekspresikan
SV40 T-antigen dan
mempertahankan
kerentanan untuk SV4

Pertimbangan
pemilihan COS-7
Transformasinya efisien,
Pengendalian jumlah duplikat gen efisien

COS -7 mampu menghasilkan T protein suhusensitif.


Dapat membuat replikasi plasmid berjalan
dengan stabil, disablement yang baik memiliki
penanda (marker).
Sel COS-7 rentan terhadap SV40 pada suhu
400C

Vektor pSVL
memiliki :
virus SV40
late promotor (Pro
SV40)
bagian dari wilayah
pengkodean
polipeptida virus
(VP1)

Pertimbangan pemilihan
pSVL
Memiliki origin of replication
Daerah penempelan yang sesuai.
Mempunyai gen marker

Ukuran yang sesuai,


Memiliki multiple cloning site (MCS)

Modifikasi Gen Insulin


(menggunakan PCR)
Membuat desain primer
1. Desain forward Primer
Situs Restriksi : BamHI
Start Kodon : ATG
Overlap dengan gen of interest

B-chain gene :

TTT GTG AAC CAA CAC CTG TGC GGC TCA CAC CTG GTG GAA GCT
CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC
AAG ACC

A-chain gene :

GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC
CAG CTG GAG AAC TAC TGC AAC

2. Desain reverse Primer


Situs Restriksi : HindIII
Stop Kodon : TAA
Overlap dengan gen of interest

Urutan basa pada gen insulin

Situs Restriksi BamHI

Situs Restriksi XBaI

Sticky End

Desain primer

Temperature Melting
Suhu dimana setengah dari primer sudah
menempel pada DNA template
Tm untuk kedua primer sama atau selisih
2-4 C dan diatas 60C

GC Content
Kandungan GC dalam primer harus
berada diantara 40 - 60%.

Desain primer B-Chain Gene


Desain forward primer Gen Insulin (5end)
GGATCCATGTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTA
Situs
Start
Restriksi
BamHI Kodon

17 Basa Gen Insulin

Desain reverse primer Gen Insulin (3-end)


TCTAGATTAAAACACTTGGTTGTGGACACGCCGAGTGTGGACCACCTTCGAGAGATGGAT

Situs
Stop
Restriksi Kodon
XBaI

17 Basa Gen Insulin

Desain primer A-Chain Gene


Desain forward primer Gen Insulin (5end)
GGATCCATGGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAG)

Start
Situs
Restriksi Kodon
BamHI

17 Basa Gen Insulin

Desain reverse primer Gen Insulin (3-end)


TCTAGATTACCGTAACACCTTGTTACGACATATGGTCGTAGACGAGGGAGATGGTCGACCTC

Situs
Stop
Restriksi Kodon
XBaI

17 Basa Gen Insulin

Proses PCR B-Chain Gene


Kriteria desain primer
Temperature Melting (TM)
- TM forward primer : 76C
- TM reverse primer : 74C
Selisih TM : 2C

GC Content
- GC forward primer : 53,3%
- GC reverse primer : 48,33%

Memenuhi

3 Primer

Proses PCR A-Chain Gene


Kriteria desain primer
Temperature Melting (TM)
- TM forward primer : 76C
- TM reverse primer : 74C
Selisih TM : 2C

GC Content
- GC forward primer : 55%
- GC reverse primer : 50%

Memenuhi

Ikatan Disulfida

Pada tahap terakhir, kedua rantai A dan B insulin yang telah murni kemudian direaksikan dengan proses
oksidasi untuk membentuk jembatan disulfida yang merupakan bagian dari struktur insulin, sehingga akan
diperoleh hormon insulin hasil rekombinan yang identik dengan insulin yang terdapat pada manusia
Proses oksidasi berlangsung sebagai berikut: Rantai A dan B dioksidasi, bila tidak terbentuk protein yang
diinginkan maka direduksi kembali. Proses oksidasi-reduksi ini memakan waktu dan tidak efisien

Ikatan disulfida

penambahan
insert
Penambahan
alkalinfosfatase

inkubasi
campuran
larutan

penambahan
buffer

penambahan
DNA ligase

penambahan
air (pelarut)

Metode ligasi

proses pemotongan dengan enzim restriksi


agar dapat menghasilkan ujung yang tidak
rata (sticky end).

Metode ligasi

Transfeksi Kalsium Fosfat


Transfeksi merupakan prosedur untuk mengintroduksi asam
nukleat asing ke dalam sel untuk memproduksi sel yang
termodifikasi secara genetik
Stable Transfection

Transient Transfection

Transfeksi kalium fosfat termasuk ke dalam metode yang


berbasis kimiawi.

Kalsium Fosfat

Teknik
Screening

Prinsip umumnya didasarkan


pada selectable marker yang
dimiliki oleh vektor.
Menggunakan teknik
screening seleksi antibiotik
karena mengandung gen
ampR
Metode seleksi ini juga
tergolong ke dalam salah
satu metode yang mudah
dan cepat dalam melakukan
penyeleksian.