Anda di halaman 1dari 23

TUGAS MATA KULIAH SISIPAN MIKROBIOLOGI

VIRUS PMK/FMDV

oleh :

Jefri Orienta Timoteus

NIM : E2A009181

FAKULTAS KESEHATAN MASYARAKAT

UNIVERSITAS DIPONEGORO`

2011
KATA PENGANTAR

Puji Syukur penulis ucapkan kepada Tuhan Ynang Maha Esa karena
berkat rahmat dan izin-Nya lah, penulis dapat menyelesaikan makalah ini
dengan tepat waktu. Makalah ini dibuat sebagai tugas mata kuliah sisipan
Mikrobiologi. Adapun judul dari tugas yang diberikan adalah ”VIRUS
PMK/FMDV”.

Penulis menyadari bahwa makalah ini masih jauh dari sempurna, oleh
karena itu penulis mengharapkan kritik dan saran yang membangun dari
para pembaca agar tercipta perbaikan makalah-makalah kami
selanjutnya. Semoga makalah ini dapat bermanfaat bagi mahasiswa
Fakultas Kesehatan Masyarakat khususnya dan bagi seluruh pembaca
pada umumnya.

Semarang, 9 Februari 2011

Penulis
BAB I

PENDAHULUAN

Pada umumnya virus bersifat rnerugikan.Virus sangat dikenal sebagai


penyebab penyakit infeksi pada manusia, hewan, dan tumbuhan. Sejauh
ini tidak ada makhluk hidup yang tahan terhadap virus. Tiap virus secara
khusus menyerang sel-sel tertentu dari inangnya. Virus dapat menginfeksi
tumbuhan, hewan, dan manusia sehingga menimbulkan penyakit.

Virus yang akan saya bahas dalam makalah ini adalah salah satu virus
yang menginfeksi pada hewan yaitu Virus PMK (Penyakit Kuku dan
Mulut).Virus ini menyebabkan suatu penyakit yang dinamakan Penyakit
Kuku dan Mulut. Variasi penyebutannya adalah Penyakit Kuku dan Mulut
atau singkatan dalam nama bahasa Inggrisnya, FMD (dari foot and mouth
disease, juga disebut hoof and mouth disease). Penyakit kuku dan mulut,
yakni jenis penyakit yang menyerang ternak sapi dan kerbau. penyakit
kuku dan mulut merupakan suatu penyakit yang disebabkan oleh virus
yang mudah menyerang hewan ternak berkuku belah diantaranya sapi,
kerbau, domba, kambing, dan babi.

Penyebaran penyakit itu dapat disebabkan oleh beberapa hal diantaranya


virus yang terbawa oleh angin, persinggungan badan dengan hewan
ternak yang sudah terinveksi, bercampurnya hewan ternak dalam
angkutan truk, serta pakan ternak yang mengandung virus. Penyakit kuku
dan mulut mengakibatkan sariawan yang mengganggu kuku dan mulut
sehingga ternak tidak nafsu makan selama hampir dua minggu, hingga
berangsur kurus dan akhirnya mati.

Penyakit Mulut dan Kuku merupakan penyakit epizootika yang


menyerang ternak besar, terutama sapi dan babi. Penyakit ini disebabkan
oleh virus dari familia Picornaviridae. Daya tular penyakit ini sangat tinggi,
dan dapat menulari rusa, kambing, domba, serta hewan berkuku genap
lainnya. Gajah, mencit, tikus, dan babi hutan juga dapat terserang. Namun
dapat menginfeksi manusia walaupun jarang ditemukan.

Ledakan wabah PMK pertama kali diketahui di Indonesia tahun 1887 di


daerah Malang, Jawa Timur, kemudian penyakit menyebar ke berbagai
daerah seperti Sumatera, Sulawesi dan Kalimantan. Kampanye vaksinasi
massal memberantas PMK dimulai tahun 1974 sehingga pada periode
1980-1982 tidak tercatat lagi kasus PMK. Pada tahun 1983 tiba-tiba
muncul lagi kasus di Jawa Tengah dan menular kemana-mana. Melalui
program vaksinasi secara teratur setiap tahun, wabah dapat dikendalikan
dan kasus PMK tidak muncul lagi. Pada tahun 1986 Indonesia
menyatakan bebas PMK. Hal ini diakui di lingkungan ASEAN sejak 1987
dan diakui secara internasional oleh organisasi Kesehatan Hewan Dunia
(Office International des Epizooties-OIE) sejak 1990.

Penyakit mulut dan kuku (PMK) merupakan penyakit yang sangat ditakuti
oleh banyak negara, terutama negara yang penghasilannya dari bidang
peternakan cukup besar.  Menurut organisasi kesehatan hewan dunia
Office International des Epizooties (OIE) yang berkedudukan di Paris, di
mana Indonesia termasuk sebagai anggota, penyakit ini termasuk dalam
daftar A, karena kerugian yang ditimbulkan sangat besar.  Penyakit ini
menyerang hewan berkuku genap (sapi, kerbau, babi, kambing, dan
domba).  Kerugian ekonomi yang ditimbulkan pada hewan berupa
penurunan produksi susu dan daging, pelarangan ekspor, dan biaya
pengendalian penyakit yang sangat besar.  Hewan liar berkuku genap,
misalnya rusa, antelop, gajah, dan jerapah, dapat terserang PMK, tetapi
onta tidak peka.

Angka kematian (case fatality rate) PMK pada hewan sangat kecil (kurang
dari 3%), namun angka kesakitan (morbidity rate) sangat besar (dapat
mencapai 90% atau lebih).  Kasus PMK pada manusia sangat jarang,
hanya dilaporkan di luar negeri, dan tidak digambarkan secara jelas. 
Pada kejadian wabah PMK di Pulau Jawa tahun 1983 dengan jumlah
kasus yang sangat besar pada sapi, kerbau, kambing, dan babi, tidak
ditemukan seorang pun yang tertular penyakit ini.

Saat ini Indonesia termasuk negara bebas PMK.  Selain Indonesia,


negara yang bebas PMK adalah Australia, New Zealand, Amerika Serikat,
dan Kanada.  Namun mengingat lalu lintas hewan dan produk hewan
sangat pesat, dan beberapa negara tetangga di sebelah Utara Indonesia
(Filipina, Thailand) belum bebas PMK, maka kewaspadaan terhadap
masuknya kembali virus PMK ke Indonesia harus diwaspadai secara
ketat.

Pada tahun 2002, terjadi wabah PMK di Jepang, Korea, dan Inggris. 
Wabah PMK di Korea dan Jepang diduga disebabkan oleh pemasukan
rumput asal China.  Pada kejadian wabah PMK di Inggris, sejumlah besar
ternak terserang dan hewan yang berdekatan dimusnahkan.

BAB II
ISI

Virus PMK dapat di klasifikasikan sebagai berikut : Kelas : Kelas IV


((+)ssRNA) Famili: Picornaviridae Genus: Aphthovirus Spesies: Virus
Penyakit Mulut dan Kuku (FMD virus).

Gambar 1.1 Protein pembungkus virus PMK

Virus ini menyebabkan penyakit yang dikenal dengan Penyakit kuku dan
mulut. Penyakit kuku dan mulut (Aphtae epizooticae) adalah penyakit virus
menular dan kadang-kadang fatal yang mempengaruhi binatang terbelah-
berkuku, termasuk bovids domestik dan liar. Virus ini menyebabkan
demam tinggi selama dua atau tiga hari, diikuti oleh lepuh dalam mulut
dan pada kaki yang dapat pecah dan menyebabkan ketimpangan.

Penyakit kuku dan mulut adalah wabah untuk peternakan, karena sangat
menular dan dapat disebarkan oleh hewan yang terinfeksi melalui aerosol,
melalui kontak dengan peralatan pertanian yang terkontaminasi,
kendaraan, pakaian atau pakan, dan dengan predator domestik dan
liar.Tuntutan upaya yang cukup besar di vaksinasi, pengawasan ketat,
pembatasan perdagangan dan karantina, dan kadang-kadang
penghapusan jutaan hewan.
Hewan rentan meliputi sapi, kerbau, domba, kambing, babi, kijang, rusa,
dan banteng. Ini juga telah diketahui menginfeksi landak dan gajah,dan
llama dan alpaka dapat mengembangkan gejala-gejala ringan, tetapi
tahan terhadap penyakit dan tidak lulus kepada orang lain dari spesies
yang sama. Di laboratorium percobaan, tikus dan tikus dan ayam telah
berhasil terinfeksi dengan cara artifisial, tetapi tidak percaya bahwa
mereka akan terjangkit penyakit di bawah kondisi alam.Manusia sangat
jarang terkena.

Virus yang bertanggung jawab untuk penyakit ini adalah picornavirus,


anggota prototypic dari Aphthovirus genus. Infeksi terjadi ketika partikel
virus diambil ke dalam sel tuan rumah. sel tersebut kemudian dipaksa
untuk memproduksi ribuan salinan virus, dan akhirnya meledak,
melepaskan partikel baru dalam darah. Virus ini sangat bervariasi,yang
membatasi efektivitas vaksinasi.

Sejarah

Penyebab PMK pertama kali terbukti virus pada tahun 1897 oleh Friedrich
Loeffler. Dia melewati darah hewan yang terinfeksi melalui Chamberland
filter dan menemukan bahwa cairan yang dikumpulkan masih bisa
menyebabkan penyakit pada hewan yang sehat.

PMK banyak terjadi di seluruh dunia, dan sementara beberapa negara


telah bebas dari PMK untuk beberapa waktu, luas jangkauan inangnya
dan menyebar cepat merupakan penyebab untuk perhatian internasional.
Setelah Perang Dunia II, penyakit ini secara luas di seluruh dunia. Pada
tahun 1996, daerah endemis termasuk Asia, Afrika, dan bagian dari
Amerika Selatan, pada Agustus 2007, Chile adalah penyakit gratis, [4] dan
Uruguay dan Argentina tidak memiliki wabah sejak tahun 2001. Amerika
Utara dan Australia telah bebas dari PMK selama bertahun-tahun.
Selandia Baru tidak pernah memiliki kasus penyakit kaki dan mulut
Sebagian besar negara-negara Eropa. Telah diakui sebagai negara bebas
penyakit, dan negara-negara yang tergabung dalam Uni Eropa telah
berhenti vaksinasi PMK

Namun, pada tahun 2001, wabah serius PMK di Inggris mengakibatkan


pembantaian banyak hewan, yang menunda pemilihan umum selama
sebulan, dan pembatalan banyak acara olahraga dan kegiatan rekreasi
seperti Isle of Man TT. Karena kebijakan pemerintah yang ketat penjualan
ternak, desinfeksi semua orang meninggalkan dan memasuki peternakan
dan pembatalan acara besar kemungkinan akan dihadiri oleh petani, yang
berpotensi bencana ekonomi epidemi dihindari di Republik Irlandia
[rujukan?], Hanya dengan satu kasus yang tercatat di Proleek, Co Pangkal
Pinang. Pada bulan Agustus 2007, PMK ditemukan di dua peternakan di
Surrey, Inggris. Semua ternak dimusnahkan dan karantina yang didirikan
atas wilayah tersebut. Ada sejak dua wabah dicurigai lainnya, meskipun
sekarang tampaknya tidak berkaitan dengan PMK. Kasus-kasus hanya
dilaporkan pada tahun 2010 adalah alarm palsu dari GIS Alex Baker,
sebagaimana dibuktikan palsu oleh Farm Florida dan Departemen
Pertanian, dan dikonfirmasi karantina / pembantaian sapi dan babi telah
dilaporkan dari Prefektur Miyazaki di Jepang pada bulan Juni setelah tiga
sapi diuji positif. Sebanyak 270.000 sapi beberapa telah diperintahkan
disembelih berikut wabah penyakit itu.

Penyebab
Penyebab PMK adalah virus dalam Famili Picornaviridae, Genus
Aphtovirus.  Ada tujuh tipe virus PMK, yakni A, O, C, Asia, South African
Teritorry (SAT) 1, 2, dan 3.  Setiap tipe virus PMK masih terbagi lagi
menjadi sub tipe dan galur (strain).  Sejauh ini di Indonesia hanya ada
satu tipe virus PMK, yakni virus tipe O.

Virus PMK tahan dalam suhu beku, namun tidak tahan pada pH 6 atau
lebih rendah.

Laboratorium referensi PMK internasional yang ditunjuk oleh Office


International des Epizooties (OIE)/FAO adalah Animal Virus Research
Institute yang terletak di Pirbright, sebuah kota kecil di sebelah Barat
London, Inggris.  Di samping itu, ada pula laboratorium yang ditunjuk
sebagai referensi regional, misalnya di Non Saray, Thailand, untuk
wilayah Asia Tenggara.  Negara-negara yang tertular PMK mengirimkan
spesimen untuk identifikasi virus ke laboratorium- laboratorium tersebut.

Virus PMK dapat terbawa oleh hewan yang sembuh selama 1-2 tahun
(sapi) dan untuk waktu yang sangat lama (beberapa tahun) pada kerbau
Afrika.

Sumber Penular

Sumber penular virus PMK adalah semua hewan yang peka terhadap
virus PMK, yakni hewan berkuku genap.

Penularan

Pada hewan, penularan virus PMK umumnya terjadi secara kontak dalam
kelompok hewan atau per os lewat makanan, minuman, atau alat-alat
yang tercemar virus.  Meskipun virus PMK relatif peka terhadap
lingkungan di luar tubuh hewan, namun angka kesakitan dapat sangat
tinggi karena hewan tertular mengeluarkan virus dalam jumlah sangat
banyak lewat ekskreta (tinja, urine), terutama air liur.

Penularan virus PMK dapat pula terjadi lewat bahan makanan beku yang
mengandung tulang atau kelenjar limfe.  Sebenarnya, virus PMK dalam
daging menjadi inaktif (mati) saat terjadi pelayuan daging, ketika pH
daging menjadi asam, namun virus PMK yang berada di dalam sumsum
tulang dan kelenjar limfe masih tetap hidup.  Oleh karena itu, beberapa
negara mensyaratkan pengiriman daging dari negara tertular PMK tidak
boleh mengandung tulang dan kelenjar limfe, di samping persyaratan lain.

Orang yang bertugas di kandang dokter hewan, dan petugas kesehatan


hewan dapat menularkan penyakit dari suatu peternakan tertular ke
peternakan lainnya lewat sepatu atau alat lain yang tercemar virus PMK. 
Penularan secara aerosol (lewat udara) pernah terjadi di Inggris.

Gejala Klinik

a.       Hewan

Masa inkubasi PMK bervariasi anatara 2-14 hari, tergantung pada


masuknya virus.  Mula-mula gejala yang muncul adalah demam, tetapi
sering tidak dikenali karena berlangsung sepat.  Lepuh atau vesikula pada
lidah dan daerah interdigit (celah kuku) merupakan gejala yang mencolok,
sehingga penyakit tersebut dinamakan penyakit mulut dan kuku.  Lepuh di
lidah yang kemudian pecah, maka akan ditemukan hipersalivasi (air liur
berlebihan) berwarna bening menggantung pada bibir.  Lepuh akan pecah
meninggalkan ulkus dangkal.  Pada saat demikian, hewan terserang tidak
mau makan, sehingga berat badan menurun drastis, sedangkan pada
ternak perah, prodksi susu menurun.  Pada sapi, lepuh dapat pula
ditemukan di puting dan kelenjar susu (mammae).
Lesi pada daerah inter-digit menyebabkan hewan pincang.  Apabila
merupakan hewan penarik bajak atau pedati, maka hewan tersebut tidak
dapat digunakan sebagai hewan kerja (penarik bajak, pedati).  Pada babi,
di samping lesi pada lidah dan kuku, lepuh dapat ditemukan pada pinggir
cungur (snout).

Kematian akibat serangan penyakit PMK sangat jarang terjadi.  Bila


terjadi, kematian anak sapi, biasanya pada anak sapi tersebut tidak mau
menyusu atau makan karena ada lepuh di mulut.

b.       Manusia

Kasus PMK pada manusia sangat jarang terjadi dan tidak menimbulkan
penyakit serius sehingga sering diabaikan.

Diagnosa

Pada sapi dan babi, gejala klinik PMK sulit dibedakan dengan vesicular
stomatitis yang disebabkan oleh virus dalam Famili Rhabdoviridae, Genus
Vesiculovirus.  Bila penyakit hanya terjadi pada babi, maka perlu
dibandingkan dengan vesicular exanthema yang disebabkan oleh virus
dalam Famili Caliciviridae.

Untuk isolasi virus, spesimen yang diambil dapat berupa jaringan lepuh
pada lidah atau daerah inter-digit, yang dimasukkan ke dalam Phosphate
Buffered Saline (PBS) pH 7,4 dan dikirimkan ke laboratorium referensi
dengan pesawat udara dengan ketentuan yang memenuhi persyaratan
pengiriman bahan biologik.

Pencegahan, Pengendalian, dan Pengobatan


Penyakit PMK pada hewan umumnya sembuh spontan tanpa
pengobatan.  Di daerah endemik, pengobatan hanya ditujukan untuk
infeksi sekunder oleh bakteria.

Ada beberapa tindakan pencegahan, pengendalian, dan pengobatan


terhadap wabah PMK, tergantung pada perkiraan besarnya kerugian yang
akan dialami dan kemamouan suatu negara.

Inggris melakukan tindakan stamping out, yaitu membunuh hewan tertular


dan hewan lain yang berdekatan, kemudian mengubur bangkainya di
daerah peternakan tersebut.  Sementara itu, lalu lintas hewan ditutup dan
kandang tempat ternak sebelumnya didesinfeksi dengan larutan asam
atau basa tertentu.

Di Indonesia, tindakan drastis seperti ini sulit dilakukan karena mendapat


tentangan dari masyarakat pemilik hewan, seperti pernah terjadi di Bali
sekitar tahun 1972.  Pemerintah memilih cara immunisasi massal
terhadap semua hewan peka PMK selama tiga tahun berturut-turut di
pulau tertular.

Vaksin yang digunakan untuk mencegah wabah PMK adalah vaksin inaktif
dari galur virus yang sesuai.  Pada masa lalu, vaksin PMK di Indonesia
diprodukdi oleh Pusat Veterinaria Farma yang terletak di Wonocolo,
Surabaya.  Pada manusia, tidak dilakukan tindakan pencegahan secara
khusus.

Tanda-tanda klinis

Masa inkubasi virus penyakit kaki dan mulut memiliki range antara 2 dan
12 hari .Penyakit ini ditandai dengan demam tinggi yang menurun dengan
cepat setelah dua atau tiga hari;. Lepuh dalam mulut yang mengakibatkan
sekresi berlebihan berserabut atau berbusa air liur dan air liur, dan lecet
pada kaki yang dapat pecah dan menyebabkan ketimpangan. hewan
dewasa mungkin menderita penurunan berat badan dari yang mereka
tidak pulih selama beberapa bulan serta pembengkakan di testis laki-laki
dewasa, dan pada sapi, produksi susu bisa turun secara signifikan.
Meskipun kebanyakan hewan akhirnya sembuh dari PMK, penyakit ini
dapat menyebabkan myocarditis (radang otot jantung) dan kematian,
terutama pada hewan baru lahir. Beberapa hewan yang terinfeksi tetap
tanpa gejala, tetapi mereka tetap membawa PMK dan dapat menularkan
kepada orang lain.

Kerugian Akibat PMK

PMK akan mendatangkan kerugian yang cukup besar karena hal-hal


berikut ini:

1. Penurunan produktivitas kerja ternak. Pada sapi potong,


produktivitas kerja ternak penderitan PMK akan menurun.
2. Penurunan bobot hidup. Ternak yang menderita PMK sulit
mengonsumsi, mengunyah dan menelan pakan, bahkan pada
kasus yang sangat parah, ternak tidak dapat makan sama sekali.
Akibatnya, cadangan energi tubuh akan terpakai terus hingga
akhirnya bobot hidup menurun dan ternak menjadi lemas.

3. Gangguan fertilitas. Ternak produktif yang terserang PMK akan


kehilangan kemampuan untuk melahirkan setahun setelah terserang
penyakit tersebut.Ternak baru dapat beranak kembali setelah dua
tahun kemudian. Jika pada awalnya seekor ternak mampu beranak
lima ekor, karena penyakit ini kemampuan melahirkan menurun
menjadi tiga ekor atau kemampuan menghasilkan anak menurun 40%.

4. Kerugian ekonomi akibat penutupan pasar hewan dan daerah


tertular. Dalam keadaan terjadi serangan PMK, seluruh kegiatan di
pasar hewan dan rumah pemotongan hewan (RPH) ditutup. Akibatnya
pekerja di pasar hewan dan RPH,pedagang ternak, serta pengumpul
rumput akan kehilangan mata pencaharian selama jangka waktu yang
tidak menentu.

5. Hilangnya peluang ekspor ternak,hasil ikutan ternak, hasil bahan


hewan, dan pakan.

Tindakan Kewaspadaan PMK Pemantauan dan Antisipasi oleh Petugas


Dinas Peternakan/Kehewanan dan Karantina Petugas Dinas
Peternakan/Kehewanan dan Karantina dapat mengantisipasi masuknya
PMK melalui impor ternak dan hasil ternak serta timbulnya kembali
kejadian PMK dengan melakukan tindakan sebagai berikut:

1. Pengamatan aktif di lapang, ditingkat kecamatan atau desa,terutama


pada lokasi yang pernah timbul wabah PMK serta tempat-tempat rawan
seperti pasar hewan, RPH, dan daerah penggembalaan.

2. Sosialisasi kepada peternak mengenai tanda-tanda khas PMK. Bila ada


kasus yang dicurigai,segera melapor ke Dinas Peternakan/Kehewanan
setempat.

3. Dalam waktu 24 jam petugas wajib lapor ke Dinas


Peternakan/Kehewanan setempat bila ada kasus yang dicurigai,
kemudian diteruskan ke Dinas Peternakan/Kehewanan Kabupaten,
Propinsi dan ke Pusat.

Pemantauan dan Antisipasi oleh Petugas Laboratorium Laboratorium


Pusat Veterinaria Farma (Pusvetma) di Surabaya dan Balai Penyidik
Penyakit Hewan (BPPH) Wilayah I, bekerja sama dengan Dinas
Peternakan/Kehewanan setempat, setiap tahun sekali mengadakan
pemantauan ke lapang, terutama di daerah-daerahyang berbatasan
dengan negara tetangga atau lokasi yang pernah timbul wabah.
Pemantauan secara laboratoris oleh Pusvetma dan ditujukan terutama
untuk uji serologis. Pengamatan laboratorium lebih lanjut dengan
pemeriksaan biologis dan isolasi virus perlu dilakukan bila ada kasus yang
dicurigai.

Pemantauan oleh Masyarakat Masyarakat wajib melapor dalam waktu 24


jam ke Dinas Peternakan/Kehewanan setempat bila ada kasus yang
dicurigai. Pelaporan bisa langsung ke petugas Dinas Peternakan/
Kehewanan, atau melalui pamong desa atau petugas penyuluh pertanian
setempat

Artikel mengenai penelitian Virus PMK :

Kapasitas penyebaran virus dan kemampuannya untuk mengubah


identitas antigen yang membuatnya menjadi ancaman serius bagi industri
daging sapi dan susu di banyak negara. FMDV memiliki 7 serotipe dan
lebih dari 70 subtipe. Karena tidak adanya perlindungan timbal balik
antara semua serotipe, sulit untuk mengendalikan PMK melalui vaksinasi
dan tidak mungkin untuk menghilangkan PMK dengan pemuliaan alam
konservatif. Sebuah kejadian baru-baru ini sebuah epidemiogenesis besar
telah membuat pengembangan strategi darurat antivirus penting untuk
mencegah wabah PMK.

interferensi RNA (RNAi) adalah suatu proses urutan-spesifik,


membungkam gen posttranscriptional (PTGS) pada hewan dan tanaman,
yang dapat disebabkan oleh 21 - to 23-nukleotida (nt) siRNA yang
menunjukkan homologi urutan ke gen target [2, 3]. Hal ini juga diketahui
bahwa satu fungsi potensi yang jelas untuk mesin RNAi akan
mempertahankan sel-sel terhadap virus yang mengekspresikan dsRNA
sebagai bagian dari siklus hidup mereka Memang, ada bukti kuat yang
menunjukkan bahwa RNAi sangat penting incurtailing infeksi virus di
kedua tanaman dan invertebrata. Selain itu dapat dengan mudah
menunjukkan bahwa induksi buatan respon RNAi antivirus dalam sel
mamalia dapat memberikan perlindungan yang kuat terhadap berbagai
virus patogen [5]. Namun demikian, masih belum jelas apakah RNAi
terlibat dalam pertahanan antivirus dalam sel mamalia dalam kondisi
fisiologis. sel mamalia pada awalnya dianggap tidak mungkin untuk
memiliki sebuah mesin RNA-silencing aktif , selain sebuah respon,
interferon nonspesifik dimediasi antivirus dimediasi oleh dsRNA , terutama
oleh virus lama (35-nt) dsRNA . Gambaran baru-baru ini RNAi dalam sel
mamalia membuktikan bahwa mesin pembungkaman RNA disimpan
dalam mamalia. Dalam beberapa kasus, efek antivirus yang kuat RNAi
diamati dalam kasus-kasus human immunodeficiency virus, virus hepatitis
B dan virus polio dan human papillomavirus. Bahkan, beberapa virus kini
telah terbukti baik untuk mengekspresikan miRNAs mereka sendiri di sel
yang terinfeksi atau mengambil keuntungan dari miRNAs sel inang untuk
meningkatkan replikasi mereka. Karena itu tampak masuk akal untuk
mengusulkan bahwa sistem interferon yang sangat potensial telah
mengungsi RNAi sebagai pertahanan utama terhadap infeksi virus pada
sel mamalia. SiRNA mungkin beroperasi pada beberapa tingkat pada
mamalia, tindakan utama diperkirakan akan dimediasi di tingkat
posttranscriptional oleh kerusakan yang cepat dari homolog mRNA.
Penggunaan siRNA sebagai agen antivirus dapat menyebabkan tekanan
selektif pada rangkaian target siRNA yang mungkin mengakibatkan
munculnya varian melarikan diri karena perubahan urutan target. Dengan
demikian, urutan virus yang dipilih sasaran terletak di daerah lestari virus
genom. Dalam studi ini, kami menjelaskan penggunaan RNAi dalam
menghambat replikasi virus dalam sel BHK-21 dan tikus menyusu. Target
siRNA yang dipilih memiliki identitas 100% bila dibandingkan dengan
semua urutan FMDV disimpan dalam GenBank, terlepas dari serotipe
mereka. Tingkat identitas merupakan indikasi adanya tekanan selektif
yang kuat terhadap mutasi karena urutan ini menolak perubahan selama
evolusi virus. Tekanan ini selektif dapat mempertahankan urutan target
siRNA tanpa perubahan, memastikan kegiatan efektif Sirnas dijelaskan
dalam penelitian ini. Karya ini menawarkan wawasan ke dalam
penggunaan RNAi dalam pemuliaan hewan untuk ketahanan penyakit.

Komersial plasmid pSilencer5. 1-H1 digunakan untuk mengekspresikan


mengulang-terbalik RNA sesuai dengan 3D homogen dan 2B1 coding
daerah dari 7 serotipe dari FMDV. 2 primer template Sirnas adalah
FMDV-2

(P1): 5'-
GATCCGCTACAGATCACCATACCTTTCAAGAGAAGGTATGGTGATCT
GTAGCTTTTTTGGAAA-3 '(p2): 5'-
AGCTTTTCCAAAAAAGCTACAGATCACCATACCTTCTCTTGAA
AGGTATGGTGATCTGTAGCG-3'
FMDV-3

(P1): 5'-
GATCCGCCAGATGCAGAGGGACATGTTCAAGAGACATGTCCCTCTGC
ATCTGGTTTTTTGGAAA-3 '

(P2): 5'-
AGCTTTTCCAAAAAACCAGATGCAGAGGGACATGTCTCTTGAACATGT
CCCTCTGCATCTGGCG-3 '

Pertama, 2 pasang primer dikeraskan dan diligasi dengan vektor


retrovirus linier pSilencer5. 1-H1 untuk menghasilkan 2 vektor ekspresi
siRNA - psi-FMD2 dan psi-FMD3. Sequencing menegaskan ligasi yang
benar dari dua plasmid. Primer yang digunakan untuk sequencing adalah:
5'-TTGTACACCCTAAG-CCTCCG 3 '.

Ditentukan terlebih dahulu apakah ekspresi transien Sirnas bisa memicu


respons antivirus pada BHK-21 sel yang terinfeksi dengan FMDV.
Transient transfeksi seluler dan identifikasi FMDV dilakukan di sel BHK-
21. Dua puluh empat jam pasca-transfeksi, sel-sel transfected terinfeksi
dengan 5 × 103 TCID50/cell dari FMDV serotipe A, O, dan Asia1. Para
CPE dari sel BHK-21 diamati pada 10, 12, 18, 24, 36 dan 48 postinfection
h. Sampel dari supernatan diperoleh pada titik-titik waktu yang ditentukan,
dan TCID50 itu ditentukan dengan rumus Reed-Muench. BHK-21 sel
fibroblastik, tumbuh di monolayer, dan memiliki kecenderungan yang jelas
untuk orientasi paralel. Infeksi virus menyebabkan CPE ditandai
mengakibatkan detasemen total selular, pembulatan, dan kehancuran,
yang dapat diamati di bawah mikroskop. Seperti ditunjukkan dalam
Gambar. 1, CPE muncul di sel BHK-21 yang terinfeksi dengan serotipe
FMDV A pada 12 postinfection jam, dan terutama berat diantara 4
kelompok antara 24 jam sampai 36 jam detasemen Cellular, pembulatan,
dan pemusnahan kelompok kontrol lebih parah dibandingkan dengan
kelompok eksperimental. Pada 48 postinfection h, sel-sel kelompok
kontrol sudah mati dan hampir terlepas. CPE muncul di sel BHK-21 yang
terinfeksi dengan serotipe FMDV O dan Asia saya di postinfection 6-8 jam,
dan terutama parah di 10-12 postinfection h. Untuk lebih memperkuat
aktivitas antivirus, kami menentukan hasil sel yang terinfeksi virus dengan
3 virus pada titik-titik waktu yang ditentukan. Para TCID50 dari FMDV
serotipe A, O, dan Asia saya terdeteksi pada supernatan dikumpulkan dari
sel transfected dengan plasmid siRNA-mengekspresikan FMDV-spesifik
lebih rendah daripada dalam sel kontrol (Gbr. 2) Namun., Tidak ada
hambatan yang signifikan terjadi setelah 48 jam (FMDV serotipe A) dan 18
jam (FMDV serotipe O dan Asia I). Hasil ini menunjukkan bahwa ekspresi
transien jepit rambut FMDV RNA layak untuk memicu respons antivirus
pada sel BHK-21.
CPE dari BHK-21 sel yang terinfeksi dengan FMDV pada waktu yang
berbeda. A. CPE dari sel BHK-21 transfected dengan FMDV-spesifik
siRNA-menyatakan plasmid;. B. CPE dari sel BHK-21 transfected dengan
plasmid kontrol;. C. Pengendalian CPE-21 sel BHK. Sebagaimana yang
terdapat dalam Gambar. 1, CPE muncul di sel BHK-21 yang terinfeksi
dengan serotipe FMDV A pada 12 postinfection jam, dan terutama berat
diantara 4 kelompok antara 24 jam sampai 36 jam detasemen Cellular,
pembulatan, dan pemusnahan kelompok kontrol lebih parah dibandingkan
dengan kelompok eksperimental. Pada 48 postinfection h, sel-sel
kelompok kontrol sudah mati dan hampir terlepas.

TCID50 dari FMDV serotipe A, O, dan Asia saya pada waktu yang
berbeda. (A): TCID50 dari FMDV A pada waktu yang berbeda. (B):
TCID50 dari FMDV O pada waktu yang berbeda. (C): TCID50 dari FMDV
AsiaI pada waktu yang berbeda. Para TCID50 dari FMDV serotipe A, O,
dan Asia saya terdeteksi pada supernatan dikumpulkan dari sel
transfected dengan plasmid siRNA-mengekspresikan FMDV-spesifik lebih
rendah daripada dalam sel kontrol.

Untuk lebih menguji aktivitas anti-FMDV dari Sirnas, kami menantang


Kunming White menyusui tikus (2-3 hari lama dan berat 3-4 g). Tikus
menyusui yang disuntikkan secara subkutan pada leher dengan 50-100 ug
dari plasmid dilarutkan dalam 100 ul dari garam. Mencit dari kelompok
kontrol secara subkutan disuntik dengan garam. Setelah 6 jam, tikus
menyusui ditantang dengan 5 dan 20 LD50 dari FMDV serotipe O, dan
Asia saya per 0,1 mililiter oleh injeksi subkutan di leher dekat situs yang
menerima DNA disuntik dan kemudian diamati selama 5-6 hari
postchallenge . Semua tikus salin-disuntikkan (_ n 10 tikus per kelompok)
meninggal dalam waktu 69 jam, dengan tikus paling mati dalam waktu 48
jam, setelah tantangan virus. Hanya 3 dari 9-10 tikus pretreated dengan
psi-FMD2 dan 4 dari 10 tikus pretreated dengan psi-FMD3, selamat
tantangan virus 5 LD50 selama 5 hari pengamatan. Selanjutnya, hanya 1
dari 9 tikus pretreated dengan psi-FMD2 dan 1 dari 9-10 tikus pretreated
dengan psi-FMD3 selamat tantangan virus 20 LD50 selama 5 hari
pengamatan. menunjukkan bahwa tikus yang diobati dengan siRNA-
mengekspresikan plasmid telah mengurangi kerentanan terhadap infeksi
virus.

Dalam karya ini, ditunjukkan bahwa transfeksi dari sel BHK-21 dengan 2
plasmid siRNA-menyatakan bisa membujuk CPE lebih rendah
dibandingkan dengan kontrol. Lebih lanjut, TCID50 dari FMDV serotipe A,
O, dan Asia saya terdeteksi pada supernatan dikumpulkan dari sel
transfected dengan plasmid siRNA-mengekspresikan FMDV-spesifik lebih
rendah dibandingkan sel kontrol. Di sisi lain, ekspresi siRNA 21-nt
heterolog ke genom FMDV tidak signifikan mengurangi replikasi virus.
Selain itu, ketika ditantang oleh 5 LD50 atau 20 LD50 dari FMDV serotipe
O, atau Asia saya setelah menyuntik FMDV-spesifik siRNA-
mengungkapkan plasmid, 10-40% menyusui tikus bisa menahan infeksi
virus. Laporan ini, serta hasil orang lain menunjukkan bahwa double-
stranded RNA (dsRNA) adalah alat yang sangat kuat untuk menghambat
replikasi virus dan memiliki potensi terapeutik yang tinggi. Dalam kasus
kami, efek inhibisi tidak begitu baik didefinisikan sebagai dalam hasil yang
dilaporkan oleh Chen et al dan Kahana Ronen et al. Namun, dalam studi
ini, Sirnas penargetan 2 urutan sangat lestari yang mampu menghambat 3
serotipe virus dirancang. penelitian lebih lanjut diperlukan untuk
menentukan apakah ini adalah kasus serotipe yang lain juga.
Berikut adalah gambar – gambar mengenai Penyakit PMK yg disebabkan
Virus FMDV

Gambar 1.2 Lesi terbuka antara teracak ternak (kiri) dan lesi terbuka pada
bantalan gigi kerbau penderita PMK (kanan).

Gambar 1.3 Sapi penderita PMK yang tidak mampu menelan air liurnya
BAB III

PENUTUP

Salah satu virus yang menginfeksi pada hewan yaitu Virus PMK (Penyakit
Kuku dan Mulut).Virus ini menyebabkan suatu penyakit yang dinamakan
Penyakit Kuku dan Mulut. Penyakit Mulut dan Kuku merupakan penyakit
epizootika yang menyerang ternak besar, terutama sapi dan babi.
Penyakit ini disebabkan oleh virus dari familia Picornaviridae. Daya tular
penyakit ini sangat tinggi, dan dapat menulari rusa, kambing, domba, serta
hewan berkuku genap lainnya. Hewan rentan meliputi sapi, kerbau,
domba, kambing, babi, kijang, rusa, dan banteng. Namun dapat
menginfeksi manusia walaupun jarang ditemukan. Penyakit kuku dan
mulut adalah wabah untuk peternakan, karena sangat menular dan dapat
disebarkan oleh hewan yang terinfeksi melalui aerosol, melalui kontak
dengan peralatan pertanian yang terkontaminasi, kendaraan, pakaian atau
pakan, dan dengan predator domestik dan liar.Tuntutan upaya yang cukup
besar di vaksinasi, pengawasan ketat, pembatasan perdagangan dan
karantina, dan kadang-kadang penghapusan jutaan hewan. Pada hewan,
penularan virus PMK umumnya terjadi secara kontak dalam kelompok
hewan atau per os lewat makanan, minuman, atau alat-alat yang tercemar
virus.  Meskipun virus PMK relatif peka terhadap lingkungan di luar tubuh
hewan, namun angka kesakitan dapat sangat tinggi karena hewan tertular
mengeluarkan virus dalam jumlah sangat banyak lewat ekskreta (tinja,
urine), terutama air liur. PMK merupakan salah satu penyakit hewan
menular yang paling ditakuti oleh dunia internasional. Indonesia telah
berhasil bebas dari penyakit tersebut, dan status bebas ini harus
dipertahankan dengan menerapkan sistem kewaspadaan dini secara
konsisten dan disiplin.
DAFTAR PUSTAKA

Pereira HG Foot-and-mouth disease. In Virus diseases of food animals.


Edited by: Gibbs EPJ. Academic Press, San Diego, Calif; 1981

Stram Y, Molad T A ribozyme targeted to cleave the polymerase gene


sequences of different foot-and-mouth disease virus (FMDV) serotypes.
Virus Genes 1997

http://arccjournals.com/forums/index.php?/topic/136-animal-health/
diakses pada tanggal 5 februari pukul 17.34

http://www.pustaka.litbang.deptan.go.id/publikasi/wr266046.pdf
diakses pada tanggal 5 februari pukul 17.48

http://www.virologyj.com/content/5/1/86 diakses pada tanggal 5


februari pukul 20.01