BAHAN DISKUSI BAHAN GENETIK DAN PENGENALAN EKSPRESI GEN

1. Diketahui suatu pita DNA memiliki urutan basa sebagai berikut:

5’-CTACGTAATGGTGCAGTT-3’

a. Buatlah rantai DNA komplementernya

b. Bagaimanakah urutan DNA yang ditranskripsi ke m-RNA
c. Bagaimanakah urutan asam amino yang merupakan hasil translasi

2. Diketahui suatu pita DNA memiliki urutan basa sebagai berikut: 3’- TTGCCAAAATACATGACGGCG …
(60 basa)….. GGTTGTTCGCCGATTCTTAAA -5’
a. Apabila pita DNA tersebut merupakan template dari suatu mRNA, maka apabila ditranslasi maka mRNA
tersebut akan menghasilkan ……… asam amino.
b. Buatlah urutan asam amino tersebut (mulai dari start codon sampai stop codon). Khusus untuk bagian 60
basa hanya ditulis jumlah asam amino yang dibentuk.

Given the following sequence of nucleotides for a single strand DNA : 5’- AAATCGATTGCGCTATCG – 3’
a. Construct the complementary sequence that would be incorporated during replication to complete the
double helix of a DNA molecule
b. Construct the molecule of mRNA that will be transcribed

3. Jika DNA E. coli memiliki 4,2 x 106 pasang nukleotida dalam DNA-nya, dan sebuah gen rata-rata
mengandung 1.500 pasang nukleotida, berapa banyak gen yang mungkin dimiliki oleh bakteri itu ?
.......................................................

4. A DNA molecule has 20 percent of adenine. How many percentage of cytosine is present in this molecule of
DNA

Keterangan Kode Genetik

BAHAN DISKUSI STRUKTUR & FUNGSI KROMOSOM; SIKLUS SEL & MEIOSIS

1. Look at the following karyotype.

1. Is this organism male or female?
2. How many chromosomes are found in the somatic cells of this
organism?
3. How many chromosomes would be found in this organism’s sperm
cells
4. How many pairs of chromosomes does this organism’s karyotype
contain?
5. How many chromosomes would be found in this organism’s skin
cells?

2. Jumlah kromosom diploid (2n) kuda (Equus caballus) adalah 64

a. Berapa jumlah autosom dan kromosom kelamin
b. Berapa jumlah kromosom, autosom dan kromosom kelamin pada sel telur
c. Berapa jumlah kromosom, autosom dan kromosom kelamin pada sel somatis

3. A grasshopper sperm cell contains 12 chromosomes

a. How many pairs of chromosomes are found in the somatic cells of the grasshopper?
b. How many autosomes do the grasshopper have?
c. How many sex chromosomes do the grasshopper have?

4. Suatu organisme memiliki jumlah kromosom diploid (2n) = 20, maka

a. Jumlah kromosom pada saat interfase (G1)-mitosis adalah = ..
b. Jumlah kromatid pada saat interfase (G1)-mitosis adalah = ..
c. Jumlah kromosom pada saat profase-mitosis adalah = ....
d. Jumlah kromatid pada saat profase-mitosis adalah = .....
e. Jumlah kromosom pada saat metafase-mitosis adalah = ....
g. Jumlah kromosom pada saat metafase-meiosis I adalah = ...
i. Jumlah kromosom pada saat metafase-meiosis II adalah = ...

5. A plant has four pairs of chromosomes designated as : AA, BB, CC, and DD. If this plant is self fertilized,
what chromosome complement (s) would be found in the
a. roots of the offspring
b. leaves of the offsprings
c. egg cells of the offsprings

6. How many sperm will be formed from :

a. 60 primary spermatocytes
b. 60 secondary spermatocytes
c. 60 spermatids

7. Anjing betina memiliki jumlah kromosom 78.

a. Berapa jumlah kromosom pada tiap sel oosit primer
b. Berapa jumlah kromosom pada sel tiap oosit sekunder
c. Berapa jumlah kromosom pada sel ovum

8. Dari soal no. 7 di atas, maka

a. Jumlah kromosom pada saat profase-mitosis adalah….
b. Jumlah kromatid pada saat metaphase-mitosis adalah…
c. jumlh kromosom pada saat metaphase-meiosis II adalah …..