Tools in Biomedical

Research
Dr. dr. Mgs. Muhammad Irsan Saleh, M.Biomed
Dept of Pharmacology Faculty of Medicine
Universitas Sriwijaya
Biomedical Research
the area of science devoted
to the study of the
processes of life, the
prevention and treatment of
disease, and the genetic
and environmental factors
related to disease and
health.

The Scope Biomedical Research

 Basic Research
 Translational research
 Applied Reasearch
 Table of Contents

01 02 03 04
Genomic Transcriptomic Proteomic Experimental

Personal genes Expression of the Protein expression In vitro and in vivo

including gene-gene gene at RNA level using antigen- at celular, organ
and gene-environment antibody reaction and whole
interactions individual animal
01. Genomic Study
DNA excration
Polymerase Chain Reaction
Restriction Fragment Lenght Polymorphism
DNA Sequencing
DNA Cloning
 Cell and its organelle
Endoplasmic reticulum

nuclear DNA

Ribosome
mitochondrial DNA
(mtDNA)

Mitochondria
Golgi apparatus
Human
Chromosome:
- 22 pair autosomal
- 1 pair sex
Active (euchromatin) vs inactive (heterochromatin)
Nucleosome, basic building block of chromatin
 Rapid development of molecular biology
was based on three principles techniques:

Polymerase Chain Reaction (PCR)

DNA Sequencing
Cloning

To analyze genetic variants: PCR and Sequencing

DNA Extraction
Principles of DNA Extraction
1. Preparasi sel/jaringan
Darah: digunakan leukositnya, eritrosit dilisiskan dan dibuang.
Secepatnya diekstraksi untuk mendapat hasil optimal,
penyimpanan sebaiknya pada suhu 4oC, penyimpanan yang lama
(> 1 bulan) akan menurunkan hasil ekstraksi, volume 3 – 5 ml
whole blood
Jaringan : secepatnya diekstraksi. Penyimpanan pada suhu -80 oC.
Jaringan yang disimpan dalam paraffin blok sulit untuk diekstraksi
2. Lisis membran sel/organella (nukleus)
Phenol : senyawa yang sangat kuat untuk melisiskan membran,
tetapi toksik.
Guanidine isothicyanate : tidak toksik, digunakan sebagai
pengganti phenol

3. Denaturasi senyawa organik

Kloroform : paling banyak digunakan karena prosedur sederhana,
murah, mudah diperoleh
Proteinase K : denaturasi protein, perlu inkubasi
4. Presipitasi DNA
Isopropanol dengan volume 1:1
Ethanol absolut dan sodium asetat 1:10

5. Pencucian/washing
Ethanol 70%
 Methods of DNA Extraction

1. Phenol : chloroform
Phenol-choloroform-isoamyl alcohol
Metode standard untuk ekstraksi DNA
Akhir-akhir ini ditinggalkan, karena sifat toksik phenol

2. Salting-out
Menggunakan garam konsentrasi tinggi (NaCl 6 M)

Proteinase K untuk denaturasi protein

3. Guanidine isothiocyanate
Metode ini lebih cepat dibanding dua metode sebelumnya

Thiocyanate bersifat toksik, untuk lisis dinding sel

Memerlukan chloroform untuk denaturasi protein

4. Silica Gel
Silica gel dapat mengikat DNA dengan perantaraan
garam/buffer tertentu (NaI)
Cepat, tetapi recovery DNA kurang
 Measuring DNA Quality

Kualitas DNA
 Konsentrasi tinggi
 Utuh, tidak terputus-putus
 Tidak banyak terkontaminasi oleh protein

Menentukan Kualitas DNA

Spektrofotometer pada panjang gelombang 260 nm (protein 280
nm; DNA baik apabila pengukuran pada 260:280 = 1,7 – 1,9).
Satu OD = 50 ng DNA.

Dilihat dengan elektroforesis, band yang tebal secara kualitatif

menunjukkan DNA yang bagus
 Storing DNA

DNA disimpan dalam TE buffer (tris-hydroxymethyl amino

methana – EDTA)

Disimpan – 80 derajat bisa tahan bertahun-tahun

Untuk kerja, sebaiknya disiapkan DNA yang sudah diencerkan

menjadi 100 ng/mikroliter

Freezing – thawing berulang dapat meyebabkan kerusakan DNA

 Samples for DNA Extraction

1. Whole blood (leukosit : buffy coat)

Diambil leukositnya, sebelum itu eritrosit dilisiskan
dengan lisis buffer (EBL = erythrocyte lysis buffer).

Paling sering digunakan, 3 – 5 ml darah fresh cukup

banyak menghasilkan DNA

2. Jaringan biopsi/reseksi (otot, usus dll)

Sebelum ekstraksi, lebih dulu diinkubasi untuk
menghancurkan jaringan ikat
3. Amniotic fluid/Villi choriales
Untuk kepentingan prenatal diagnosis

Jumlah DNA yang diperoleh sangat sedikit

4. Jaringan lainnya
Untuk kepentingan forensik
Jaringan rusak/membusuk/terbakar

Folikel rambut, kuku, tulang dll

Polymerase Chain
Reaction
 Introduction
 DNA amplification in vitro using “PCR machine”
 Polymerase Chain Reaction is an exponential amplification of
a piece of DNA without a live cell
 Invented by Kary Mullis and colleagues in 1980s
 Use enzyme DNA polymerase to copy a selected region of
DNA
 Special heat-stable polymerases able to work after high
temperatures needed to separate strands make process “set
and forget” for many cycles
Type of PCR
1. Conventional (Qualitative) PCR/Standard
PCR
2. Multiplex PCR
3. Nested PCR
4. RT-PCR (Reverse Transcriptase PCR)
5. RT-PCR (Real Time PCR)/Quantitative PCR
6. Hot-Start PCR
7. Touchdown PCR
8. Asembly PCR
9. Colony PCR
10. Methylation-Specific PCR
 Standard PCR
● Use enzyme DNA polymerase to copy a selected region of
DNA
○ Add short pieces of DNA (primers) that hybridize to DNA sequences
on either side of piece of interest – causes initiation of DNA synthesis
through that area, X
○ Copies of both strands of X and original DNA strands are templates
for next round of DNA synthesis
○ Selected region DNA now doubles in amount with each synthesis
cycle
● Special heat-stable polymerases able to work after high
temperatures needed to separate strands make process
DNA amplification for many cycles
 Standard PCR
● A polymerase and free nucleotides are added to
the mixture of DNA and primers.
● A temperature change cause original DNA helix to
unwind
● The polymerase makes complementary strands of
the now separate strands.
● The temperature is lowered, primers bind to new
DNA strands, process is repeated.
POLYMERASE CHAIN REACTION (PCR)

DNA isolation/extraction usually produces a very small

amount of DNA concentration (several hundreds
nanogram / microliter)  difficult to analyze

It is necessary to amplify DNA / a fragment of DNA

PCR allows the production of more than 10 million

copies of a target DNA sequence from only a few
molecules
Primers Oligonucleotide
● Develop short oligonucleotides (~ 20bp)
called primers which are complementary to
sequences flanking the target DNA.
● Similar to RNA primers used in DNA
replication.
Oligonucleotide primers bind DNA
Each cycle of replication doubles amount of target DNA.

2
Exponential Amplification
 DNA Quality

All methods of DNA isolation (salting out, silica gel, phenol-

chloroform, guanidine isothiocyanate etc.) from fresh tissue
combine with good skills will provide high quality of DNA
 high concentration, pure, long DNA

Trace amounts of agents used in DNA purification

procedures (phenol, EDTA, Heparin, Proteinase K, etc.)
strongly inhibit Taq DNA Polymerase. Ethanol precipitation of
DNA and repetitive washing of DNA pellets with
70% ethanol is usually effective in removing traces of
contaminants from the DNA sample.
PCR REACTION MIXTURE

1. Template DNA
Usually the amount of template DNA is in the range of 0.01-1 ng
for plasmid or phage DNA and 0.1-1 µg for genomic DNA, for a
total reaction mixture of 50 µl.
Recently, with newest PCR technology, as low as 1 ng of genomic
DNA can be amplified.

Higher amounts of template DNA usually increase the yield of non

specific PCR products
2. Primers
Primer is oligonucleotide which is complement with the
flanking region of target DNA sequence
There are two primers; forward primer runs from 5’ to 3’ of
the sense template, reverse primer runs from 5’ to 3’ of the
antisense template
PCR primers are usually 15-30 (20 – 25) nucleotides in
length. Longer primers provide higher specificity.
The primer should not be self-complementary or
complementary to other primer in the reaction mixture, in
order to avoid primer-dimer and hairpin formation.
The melting temperature of flanking primers (forward and
reverse) should not differ by more than 5oC.
3. Deoxynucleotide triphosphates (dNTPs)  dATP, dGTP,
dCTP and dTTP)

The concentration of each dNTP in the reaction mixture

is usually 200 µM.
It is very important to have equal concentrations of each
dNTP as inaccuracy in the concentration of even a
single dNTP dramatically increases the
misincorporation level.
4. Taq DNA polymerase
Heat stable DNA polymerase, isolated from hot spring bacteria
Thermus aquaticus found in Yellowstone National Park, USA.

Usually 1-1.5 Units of Taq DNA Polymerase are used in 50 µl of

reaction mix.
Higher Taq DNA Polymerase concentrations may cause
synthesis of nonspecific products.

If inhibitors are present in the reaction mix (e.g., if the template

DNA used is not highly purified), higher amounts of Taq DNA
Polymerase (2-3 U) may be necessary to obtain a better yield of
amplification products.
5. MgCl2
The optimal concentration of MgCl2 has to be selected for each
experiment. Too few Mg2+ ions result in a low yield of PCR
product, and too many increase the yield of non-specific products
and promote misincorporation.
The recommended range of MgCl2 concentration is 1-4 mM
If the DNA samples contain EDTA or other chelators, the
MgCl2 concentration in the reaction mixture should be
raised proportionally.

Concentration of MgCl2
in 50 µl reaction mix, 1.0 1.25 1.5 1.75 2.0 2.5 3.0 4.0
mM

Volume of 25 mM
2 2.5 3 3.5 4 5 6 8
MgCl2, µl
6. PCR buffer
Standard PCR buffer contains 50 mM KCl, 10 mM Tris-HCl, pH 8.3
at room temperature

PCR Mixture
All components should be added one by one in thin-wall
PCR tube carefully on ice  high probability of mistake

Many companies produced PCR mix which contains Taq,

MgCl2, dNTPs and PCR buffer in one reagents. Additional
components are template and primers only.
 Final Quantity, for 50 µl
Reagent
concentration of reaction mixture

Sterile deionized water - variable

10X Taq buffer 1X 5 µl

2 mM dNTP mix 0.2 mM of each 5 µl

Primer I 0.1-1 µM variable

Primer II 0.1-1 µM variable

Taq DNA Polymerase 1.25 u / 50 µl variable

25 mM MgCl 2 1-4 mM variable*

Template DNA 10pg-1 µg variable

Amplification Exon 11 AE1 Gene

PCR Mixture:
PCR Buffer 2.50 mL
MgCl2 0.75 mL
dNTPs 0.50 mL
OVF 1098 0.50 mL
OVR 11272 0.50 mL
ddH2O 18.125 mL
Taq Polymerase 0.125 mL
DNA Template 2.0 mL

Total Volume 25.0 mL

PCR Conditions
1. Initial Denaturation Step
The initial denaturation should be performed over an
interval of 1-3 min at 95oC. This interval should be extended
up to 10 min for GC-rich templates.
The complete denaturation of the DNA template at the
start of the PCR reaction is of key importance. Incomplete
denaturation of DNA results in the inefficient utilization of
template in the first amplification cycle and in a poor yield
of PCR product.
2. Denaturation Step
Usually denaturation for 0.5-2 min at 94-95oC is sufficient,
since the PCR product synthesized in the first amplification
cycle is significantly shorter than the template DNA and is
completely denatured under these conditions.

3. Primer Annealing Step

Usually the optimal annealing temperature is 5oC lower
than the Tm; established based on experiments.
Incubation for 0.5-2 min is usually sufficient.
if nonspecific PCR products are obtained in addition to
the expected product, the annealing temperature should
be optimized by increasing it stepwise by 1-2oC.
4. Extending/Elongation Step
Usually the extending step is performed at 70-75oC. The
rate of DNA synthesis by Taq DNA Polymerase is highest at
this temperature.
Recommended extending time is 1 min for the synthesis of
PCR fragments up to 2 kb (or 1 kb). When larger DNA
fragments are amplified, the extending time is usually
increased by 1 min for each 1000 bp.

5. Final Extending Step

After the last cycle, the samples are usually incubated at
72oC for 5-15 min (7 min) to fill-in the protruding ends of
newly synthesized PCR products.
The terminal transferase activity of Taq DNA Polymerase
adds extra A nucleotides overhang to the 3'-ends of PCR
products.
Cycle Number

The number of PCR cycles depends on the amount of

template DNA in the reaction mix and on the expected yield
of the PCR product.
For less than 10 copies of template DNA, 40 cycles should
be performed. If the initial quantity of template DNA is
higher, 25-35 cycles are usually sufficient.
Denaturation

Annealing

Elongation
Gel electrophoresis of PCR product (amplicon)

Electrophoresis : separation based on different movement

in electrical field
Agarose gel is commonly used.
Reagents and equipment : gel frame (volume is 40 ml),
comb, agarose powder, ethidium bromide and buffer
(TBE = tris, boric acid, EDTA)
To make 2% agorose gel 40 ml, mix in erlenmeyer tube :
Agarose powder 0.8 gram
1 x TBE buffer 40 ml
Ethidium bromide 2 µl
Heat by microwave for 2 minutes, after cool down pour
the mixture on to gel frame equipped with comb.
 PCR RESULT
VISUALIZATION

Gel on non UV light UV Light Gel Doc UV

Amplification Exon 11 AE1 Gene
OVF 1098
OVRI 1272

5’ ACATCACAGAT GCATTCAGCCCCCAGGTCCTGGCTGCCGTCATCTTCAT
5’ ACATCACAGAT . . . . . . . . . . . . . . . . . . . . . . . . . . . GTCATCTTCAT
1197 1225

X/HaeIII 1 2 3

Legends:
1353
X/HaeIII DNA marker
Line 1 and 2 Deletion of 27 bp (SAO)
603
Line 3 No deletion 27 bp
310
281

175
148
Unspecific band
Using Reverse Transcriptase (RT-PCR) in
cDNA Cloning
● To clone a cDNA from just one mRNA whose sequence is
known, use type of PCR called reverse transcriptase PCR (RT-
PCR)
● Difference between PCR and RT-PCR
○ Start with an mRNA not double-stranded DNA

○ Begin by converting mRNA to DNA

○ Next use forward primer to convert ssDNA to dsDNA

○ Now standard PCR continues

Real-Time PCR

● Real-time PCR quantifies the amplification of

the DNA as it occurs
● As DNA strands separate, anneal to forward
and reverse primers, and to fluorescent-
tagged oligonucleotide complementary to
part of one DNA strand
Fluorescent Tags in Real-Time PCR

● This fluorescent-tagged
oligonucleotide serves as a
reporter probe
○ Fluorescent tag at 5’-end
○ Fluorescence quenching tag
at 3’-end
● With PCR rounds the 5’ tag
is separated from the 3’ tag
● Fluorescence increases with
incorporation into DNA
product
Mutasi DNA
● Kesalahan pada proses replikasi dan
kerusakan DNA dapat mengakibatkan
perubahan DNA yang permanen (mutasi)
● Mutasi dapat terjadi secara spontan
maupun akibat induksi oleh faktor luar,
seperti radiasi, mutagen
● Mutagen adalah senyawa yang
meningkatkan frekuensi mutagenesis
● Sel memiliki mekanisme perbaikan untuk
mengembalikan konfigurasi DNA setelah
mutagenesis
Mutasi DNA
● Dapat disebabkan oleh:
○ Mutagen kimia
○ Radiasi UV
○ Radiasi yang menyebabkan ionisasi
○ Kesalahan pada replikasi

 Perubahan struktur basa
 Kerusakan ikatan fosfodiester
Mutasi DNA
● Bila perubahan beberapa basa nukleotida DNA
bersifat ireversibel  perubahan organisme:
○ Perubahan morfologi
○ Perubahan sifat
○ Variasi metabolisme nutrisi
○ Perubahan regulasi ekspresi gen
○ Letal
 DNA  RNA  Protein
Gene Protein

Cell Phenotype

REPLICATION :

Old Strand 5’ A T T G C C A T T 3’

New Strand 3’ T A A C G G T A A 5’

3’ 5’
Direction of Replication
 Transcribed strand

DNA

Transcription

RNA

Start Stop
codon Translation codon

Polypeptide
Figure 10.8B
 Virtually all organisms share the same genetic code
“unity of life” Second Base

U C A G
UUU UCU UAU UGU U
phe tyr cys
UUC UCC UAC UGC C
U ser
UUA UCA UAA stop UGA stop A
leu
UUG UCG UAG stop UGG trp G
CUU CCU CAU his CGU U
CUC CCC CAC CGC C
C leu pro arg

Third Base
First Base

CUA CCA CAA gln CGA A

CUG CCG CAG CGG G
AUU ACU AAU AGU U
asn ser
AUC ile ACC AAC AGC C
A thr
AUA ACA AAA AGA A
lys arg
AUG met (start) ACG AAG AGG G
GUU GCU GAU GGU U
asp
GUC GCC GAC GGC C
G val ala gly
GUA GCA GAA GGA A
glu
GUG GCG GAG GGG G
Mutations can change the meaning of genes

● Mutations are changes in the DNA

base sequence
○ caused by errors in DNA
replication or by mutagens
○ change of a single DNA
nucleotide causes sickle-cell
disease
 Normal hemoglobin DNA Mutant hemoglobin DNA

mRNA mRNA

Normal hemoglobin Sickle-cell hemoglobin

Glu Val

Figure 10.16A
● Types of mutations

NORMAL GENE

mRNA
Protein Met Lys Phe Gly Ala

BASE SUBSTITUTION

Met Lys Phe Ser Ala

BASE DELETION Missing

Met Lys Leu Ala His

Figure 10.16B
● Types of mutations

NORMAL GENE

mRNA
Protein Met Lys Phe Gly Ala

BASE SUBSTITUTION

Met Lys Phe Ser Ala

BASE DELETION Missing

Met Lys Leu Ala His

Figure 10.16B
 Restriction Frgamen
Lenght Polymorphism
(RFLP)
 RESTRICTION ENDONUCLEASE
A restriction enzyme (or restriction endonuclease) is an
enzyme that cuts double-stranded DNA. The enzyme makes
two incisions, one through each of the sugar-phosphate
backbones (i.e., each strand) of the double helix without
damaging the nitrogenous bases  cleave the sugar-
phosphate backbone of DNA

Thousands of restriction enzymes have been isolated

from bacteria, where they appear to serve a host-
defense role.
Restriction enzymes are classified biochemically into four
types (classes), designated Type I,Type II, Type III, and
Type IV.

Type I and III, both the methylase and restriction

activities are carried out by a single large enzyme
complex. Both require ATP for their proper function.
In type II systems, the restriction enzyme is
independent of its methylase, and cleavage occurs at
very specific sites that are within or close to the
recognition sequence. The vast majority of known
restriction enzymes are of type II, and it is these that
find the most use as laboratory tools. The first to be
discovered and utilized was EcoRI, which is staggered
and its recognition sequence is 5'-GAATTC-3'. Most
type II enzymes cut palindromic DNA sequences
 In type IV, the restriction enzymes target only
methylated DNA.
Restriction enzymes are named based on the bacteria in
which they are isolated in the following manner:
E : Escherichia (genus); co : coli (species); R : RY13
(strain); I : First identified Order ID'd in bacterium
The substrates for restriction enzymes are specific
sequences of double-stranded DNA called recognition
sequences.
The length of restriction recognition sites varies: The
enzymes EcoRI, SacI and SstI each recognize a 6 base-
pair (bp) sequence of DNA, whereas NotI recognizes a
sequence 8 bp in length, and the recognition site for
Sau3AI is only 4 bp in length.
Different restriction enzymes which have the same
recognition site are called isoschizomers (SacI and SstI)
Pattern of DNA Cutting by Restriction Endonuclease

1. 5' overhangs: The enzyme cuts asymmetrically within

the recognition site such that a short single-stranded
segment extends from the 5' ends. BamHI cuts in this
manner.

The 5' or 3' overhangs generated by enzymes that cut

asymmetrically are called sticky ends or cohesive ends,
because they will readily stick or anneal with their partner
by base pairing.
2. 3' overhangs: asymmetrical cutting within the recognition
site, the result is a single-stranded overhang from the two 3'
ends. KpnI cuts in this manner.

3. Blunts: Enzymes that cut at precisely opposite sites in

the two strands of DNA generate blunt ends without
overhangs. SmaI is an example of an enzyme that
generates blunt ends.
Restriction fragment length
polymorphism (RFLP)
 RFLP

● A technique that exploits variations in homologous DNA

sequences
● It refers to a difference between samples of homologous
DNA molecules that come from differing locations of
restriction enzyme.
● the DNA sample is broken into pieces (digested) by
restriction enzymes and the resulting restriction fragments
are separated according to their lengths by gel
electrophoresis
RFLP
● A restriction enzyme (or restriction endonuclease) is an
enzyme that cuts double-stranded or single stranded DNA
at specific recognition nucleotide sequences known as
restriction sites
● It works on palindromic manner, which correspond to
nitrogenous base sequences that read the same backwards
and forwards
● Ex: EcoRI
Produk PCR
300 bp

Uncut

Cut
180 bp 120 bp
EcoRI
PCR – RFLP (Restriction Fragment Length Polymorphisms)

A combination of PCR – restriction method to detect

SNPs (single nucleotide polymorphsims)
The sample is first run in a restriction digest to cut the DNA,
then gel electrophoresis is performed on this digest.
Example : In the case of MTHFR C677T polymorphism,
single band of 198 bp denotes CC genotype, two bands of
198 and 175 bp denote CT genotype and single band of
175 bp denotes TT genotype.

After gel electrophoresis, DNA can be visualized by

staining with ethidium bromide, an intercalating agent
and fluorescent dye.
 PCR amplification of MTHFR exon 4

Enzyme digestion (HinfI) G A N T C

C T N A G
CC (wild type) G A G C C 198 bp
Ala
~23 bp ~175 bp
TT (mutant) G A G T
C Val

Gel Electrophoresis
M CC CT TT

198 bp

175 bp
 Mk 3 5 7 8 9 11 19 20 21 22 23 24 C+ C
-
SMN1 Exon
A 7
SMN2 Exon 7

SMN2 Exon 8
B
SMN2 Exon 8
SMN2 Exon 8

NAIP Exon 5
C
 DNA SEQUENCING

The term DNA sequencing encompasses biochemical

methods for determining the order of the nucleotide bases in a
DNA fragment
The advent of DNA sequencing has significantly accelerated
biological research and discovery.

The rapid speed of sequencing attainable with modern DNA

sequencing technology has been instrumental in the large-
scale sequencing of the human genome, in the Human
Genome Project.
Chain Termination Methods (Sanger)

Reagents
1. mixture of all four dNTPs (dATP, dGTP, dCTP, dTTP)
2. mixture of all four dideoxynucleotides, each present in
limiting quantities and each labeled with a "tag" that
fluoresces a different color: ddATP, ddGTP, ddCTP,ddTTP
3. DNA polymerase I
4. Template DNA (only single strand is needed)
5. One primer
PCR  cycle sequencing/terminator cycle

Because all four normal nucleotides are present, chain

elongation proceeds normally until, by chance, DNA
polymerase inserts a dideoxy nucleotide (shown as
colored letters) instead of the normal deoxynucleotide.
Once ddNTP was incorporated, DNA elongation will be
failed. The ddNTPs posses hydrogen instead of hydroxyl
moeities at 3’ position.
At the end of the incubation period, the fragments are
separated by length from longest to shortest. The resolution
is capable to recognize one nucleotide different. Each of the
four dideoxynucleotides fluoresces a different color when
illuminated by a laser beam and an automatic scanner
provides a printout of the sequence.
ddNTPs
 M I R M D R R G G T
W
ATGATCCGCATGGACCGGCGGGGAGGCACCTGG

M I R M D W R G G T
W
ATGATCCGCATGGACTGGCGGGGAGGCACCTGG

M I R M D R R G G T
W
ATGATCCGCATGGACCGGCGGGGAGGCACCTGG
 DISKUSI

Mencari sekuens gena dari genatlas/gen bank

Menentukan posisi primer pada sekuens gena

Mencari dan menentukan posisi restriction site

Mencari sekuens gena dari genatlas/gen bank

Buka homepage genatlas/gen bank

Pilih full search
Masukkan symbol name
Pilih see the exons

Pilih exon yang diinginkan

Menentukan posisi primer pada sekuens gene

Buka homepage ncbi

Pilih menu blast
Setelah BLAST tampil, pilih align (di bagian bawah)
Masukkan sekuens gena dan primer

Klik align
Mencari dan menentukan posisi restriction site

Buka google, entry : restriction endonuclease

Pilih homepage NEB (New England Biolabs)
Pilih nama enzim endonuklease restriksi
Lihat informasi mengenai recognition site
Pendahuluan
Dogma Sentral:
 Our Center
Venus has a beautiful name and is the second planet from
the Sun. It’s terribly hot—even hotter than Mercury—and its
atmosphere is extremely poisonous
Mission and Vision

Mercury is the closest planet Venus has a beautiful name

to the Sun and the smallest and is the second planet
one in the Solar System from the Sun. It’s terribly hot
“This is a quote, words full of wisdom
that someone important said and can
make the reader get inspired”

—Someone Famous
 Key Numbers

20,000 50,000 5,000

Number of patients Number of visitors Number of transplants
we’ve had so far we’ve had so far performed so far
2. Transcriptomic
Study
 Transcriptomic Study
Transkriptomik adalah studi tentang
Reverse Transcriptase PCR
transkriptom — paket lengkap transkrip RNA
yang diproduksi oleh genom, baik dalam
keadaan tertentu atau dalam sel tertentu.
Perbandingan transkriptom memungkinkan
qReal Time PCR
identifikasi gen yang diekspresikan secara
berbeda dalam populasi sel yang berbeda,
atau sebagai respons terhadap perlakuan
yang berbeda.
Epigenetic
To modify this graph, click on it, follow the link,
change the data and paste the new graph here
 DNA  RNA  Protein
Gene Protein

Cell Phenotype

REPLICATION :

Old Strand 5’ A T T G C C A T T 3’

New Strand 3’ T A A C G G T A A 5’

3’ 5’
Direction of Replication
 Transcribed strand

DNA

Transcription Reverse Transcriptase

Enzyme

RNA

Start Stop
codon Translation codon

Polypeptide
Figure 10.8B
A Brief Story
Mercury is the closest planet to the Sun and the smallest
one in the Solar System—it’s only a bit larger than the
Moon
 Milestones Reached

2001-2003 2007-2012 2015-2019

Saturn is a gas giant Despite being red, Jupiter is the biggest
and has rings Mars is a cold place planet of them all

2003-2007 2012-2015
Earth is the planet Venus has a
where we live on beautiful name
 Our Process

The Sun is the star at Despite being red,

the center of Mars is actually a very
the Solar System cold place

Jupiter is the Venus has a

biggest planet in beautiful name,
the Solar System but it’s terribly hot
Patient Care
Mercury is the closest planet to
the Sun and the smallest one in
the Solar System—it’s only a bit
larger than the Moon. The
planet’s name has nothing to do
with the liquid metal, since it was
named after the Roman
messenger god
 Innovations

30% 40% 20%

Mars Venus Mercury

Despite being red, Mars is Venus has a beautiful Mercury is the closest
a cold place name, but it’s very hot planet to the Sun
Areas We Cover

Mercury Mars
01 Mercury is the closest
planet to the Sun
02 Despite being red, Mars is
a cold place

Venus Saturn
03 Venus has a beautiful
name, but it’s very hot
04 Yes, this is the ringed one.
It’s a gas giant
 Key Accomplishments

Mercury Venus Saturn

Mercury is the Venus has a Yes, this is the
smallest planet in beautiful name, but ringed one. It’s a
the Solar System it’s very hot gas giant
 Patient Satisfaction

95%
Mercury is the closest planet to
the Sun and the smallest one in
the Solar System—it’s only a bit
larger than the Moon
Areas We Cover

Venus has a beautiful

name, but it’s terribly hot

Despite being red, Mars is

a cold place

Jupiter is the biggest

planet in the Solar System
Sneak Peek
You can replace the image on
the screen with your own work.
Just delete this one, add yours
and center it properly
 Quality Improvement Measures

Mercury Venus Mars

Mercury is the closest planet Venus has a beautiful name, Despite being red, Mars is a
to the Sun but it’s very hot cold place

Saturn Jupiter Neptune

Yes, this is the ringed one. It’s the biggest planet in the Neptune is the farthest
It’s a gas giant Solar System planet from the Sun
 Testimonials
Jenna Doe John James
“Neptune is the fourth- “Mercury is the
largest planet by closest planet to the
diameter” Sun and the smallest
one”

Fred Bloggs H. Patterson

“Despite being red, “Saturn is composed
Mars is actually a very mostly of hydrogen
cold place” and helium”
A Picture is Worth
a Thousand
Words
Map

Neptune
2016-2017

Mars
2018

Mercury
2015-2016
 Awards

01 02 03 04
Award Award Award Award
Here you could talk Here you could talk Here you could talk Here you could talk
about this award about this award about this award about this award
 This Is a Table!
Mass Diameter Surface gravity
(earths) (earths) (earths)

Mercury 0.06 0.38 0.38

Mars 0.11 0.53 0.38

Saturn 95.2 9.4 1.16

Neptune 1.2 0.85 1.05

 Our Team

Lab Technician Scientist Chemist

Here you can talk a bit Here you can talk a bit Here you can talk a bit
about this person about this person about this person
Thanks
Do you have any
questions?

addyouremail@freepik.com CREDITS: This presentation template was

+91 620 421 838 created by Slidesgo, including icons by Flaticon,
yourcompany.com infographics & images by Freepik

Please keep this slide for attribution

Alternative Resources
PHOTOS

1. Close-up scientist in laboratory

2. Close-up view of science concept with copy space
3. Close-up hands holding tablet
4. Scientist woman explaining reaction
5. Woman looking through microscope
6. Young female chemist working with microscope
Resources
Did you like the resources on this template? Get them for free at our other websites.

PHOTOS

1. Medium shot scientist wearing goggles

2. Close-up scientist holding balloon flask
3. Side view of female scientist with surgical gloves looking through microscope
4. Female scientist analyzing stuff on the microscope
5. Side view science woman
6. Close-up view of science concept with copy space
7. Young female chemist and chemistry tubes
8. Close-up scientist holding flask
9. Young female chemist and microscope
10. Young woman researcher wearing a mask
11. Side view of smiley female scientist posing in the lab
12. Young ginger woman chemist working in her lab
13. Front view woman scientist in lab
 Instructions for use (free users)
In order to use this template, you must credit Slidesgo by keeping the Thanks slide.

You are allowed to:

● Modify this template.
● Use it for both personal and commercial purposes.

You are not allowed to:

● Sublicense, sell or rent any of Slidesgo Content (or a modified version of Slidesgo Content).
● Distribute this Slidesgo Template (or a modified version of this Slidesgo Template) or include it in a database or in
any other product or service that offers downloadable images, icons or presentations that may be subject to
distribution or resale.
● Use any of the elements that are part of this Slidesgo Template in an isolated and separated way from this
Template.
● Delete the “Thanks” or “Credits” slide.
● Register any of the elements that are part of this template as a trademark or logo, or register it as a work in an
intellectual property registry or similar.

For more information about editing slides, please read our FAQs or visit Slidesgo School:
https://slidesgo.com/faqs and https://slidesgo.com/slidesgo-school
 Instructions for use (premium users)
In order to use this template, you must be a Premium user on Slidesgo.

You are allowed to:

● Modify this template.
● Use it for both personal and commercial purposes.
● Hide or delete the “Thanks” slide and the mention to Slidesgo in the credits.
● Share this template in an editable format with people who are not part of your team.

You are not allowed to:

● Sublicense, sell or rent this Slidesgo Template (or a modified version of this Slidesgo Template).
● Distribute this Slidesgo Template (or a modified version of this Slidesgo Template) or include it in a database or in
any other product or service that offers downloadable images, icons or presentations that may be subject to
distribution or resale.
● Use any of the elements that are part of this Slidesgo Template in an isolated and separated way from this
Template.
● Register any of the elements that are part of this template as a trademark or logo, or register it as a work in an
intellectual property registry or similar.

For more information about editing slides, please read our FAQs or visit Slidesgo School:
https://slidesgo.com/faqs and https://slidesgo.com/slidesgo-school
 Fonts & colors used
This presentation has been made using the following fonts:

Josefin Slab
(https://fonts.google.com/specimen/Josefin+Slab)

Proxima Nova
(https://fonts.google.com/specimen/Proxima+Nova)

#ed3247 #fefadd #bde0d9 #b8e5fa #fae0cf #bac8c9 #000000

 Stories by Freepik
Create your Story with our illustrated concepts. Choose the style you like the most, edit its colors, pick
the background and layers you want to show and bring them to life with the animator panel! It will boost
your presentation. Check out How it Works.

Pana Amico Bro Rafiki Cuate

 Use our editable graphic resources...
You can easily resize these resources without losing quality. To change the color, just ungroup the resource
and click on the object you want to change. Then, click on the paint bucket and select the color you want.
Group the resource again when you’re done. You can also look for more infographics on Slidesgo.
 JANUARY FEBRUARY MARCH APRIL MAY JUNE

PHASE 1

Task 1

Task 2

PHASE 2

Task 1

Task 2

JANUARY FEBRUARY MARCH APRIL

PHASE 1

Task 1

Task 2
 ...and our sets of editable icons
You can resize these icons without losing quality.
You can change the stroke and fill color; just select the icon and click on the paint bucket/pen.
In Google Slides, you can also use Flaticon’s extension, allowing you to customize and add even more icons.
Educational Icons Medical Icons
Business Icons Teamwork Icons
Help & Support Icons Avatar Icons
Creative Process Icons Performing Arts Icons
Nature Icons
SEO & Marketing Icons