PR Biologi Molekular

dra. Lusia M.Sc

Dr. Tiar Marina Octyvani
Dermatologi Venereologi
NIM: 04082771822001
Replication
REPLICATION
Human b-globin Gene
5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGC3’
3’ TACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCCG5’

5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGC3’
3’……………………………………………………………………………………………….5’

5’………………………………………………………………………………………………..3’
3’ TACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCCG5’

• Which one is the lagging strand?

• Answer: the upper one is the lagging strand.
1. The base composition of a virus was found to be 11%
A, 32% G, 18% U and 39% C.
• It this a DNA or RNA virus? How can you tell?
• Answer: It is an RNA virus because there is Uracil in
the base composition, the base composition is
unequal, so it has to be single stranded.
• Is it single-stranded or double-stranded? How can you
tell?
• Answer: The base composition is unequal, so it has
to be single stranded.
2. Which of these DNA fragments will have a higher
melting temperature? (circle one)

A) GCATTGACCGGAGGGACT
CGTAACTGGCCTCCCTGA

B) GGATTTCAATTACTTAAT
CCTAAAGTTAATGAATTA

Answer: A has a higher melting temperatiure. The

triple hydrogen bonds between C and G are harder
to break, so fagments with more GC content will
have higher melting temperature.
Transcription
 Which one is the template strand for transcription and
write down the mRNA sequences?

5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGC3’

3’ TACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCCG5’

Answer: the lower strand is the template strand, because it

runs in a 3’ to 5’ direction.
3. A eukaryotic structural gene has two introns and
three exons:
5’-exon1-intron1-exon2-intron2-exon3-3’
• The GU at the 5’ end of intron2 has been mutated so
it is no longer recognized. What would the mature
mRNA look like in the wild type and in the mutant?

Answer:
• Wild type: 5’cap-exon1-exon2-exon3-poly(A)tail
• Mutant: 5’cap-exon1-exon2-intron2-exon3-poly(A)tail
Which of the following statements about
eukaryotic mRNA is TRUE?

A)a cap is added to their 5' end

B)a poly-A tail is added to their 3' end
C)each usually specifies only a single protein
D)A and B
E)A, B, and C
Which of these events occur as a
prokaryotic mRNA is being transcribed?

A)splicing
B)addition of a cap
C)addition of a poly-A tail
D)binding of ribosomes
E)more than one of the above

Answer: NONE of the above.

Processing of eukaryotic mRNA occurs in
the cytoplasm prior to translation.

A)True
B)False
Translation
1. An anticodon of a tRNA has the sequence 5’GCA3’.

a. What amino acid does this tRNA carry?

Answer: Ala
b. What would be the effect of a mutation that changes
the C to a A?
Codon mutated to GAA, amino acid change into Glu.
• The antibiotic erythromycin disrupts protein synthesis by preventing
ribosomal translocation (movement of the ribosome relative to the
mRNA). It does not affect any other step in protein synthesis. Suppose you
are doing a translation reaction in vitro and you add erythromycin just
before the 3rd bond is about to be made. You wait a few minutes and
look at the ribosome.
a.The carboxyl end of AA #3 should now be covalently bonded directly to
(tRNA #2) (tRNA #3) (tRNA #4) (AA #2) (AA #3) (AA #4) (none of these).

Answer: it stars out attached to tRNA#3, but is transferred to AA#4 as

soon as it arrives.

b. Which tRNA will you find in the A site? (tRNA #1) (tRNA #2) (tRNA #3)
(tRNA #4) (tRNA #5).

• The tRNA in the A site will carry (an amino acid) (a polypeptide) (neither)
(either one).
• Initially, the tRNA simply carries an amino acid, but then the growing
polypeptide is transferred to A sute before translocation. That peptide
bond can still be formed in presence of erythromycin.
• Why is control of gene expression different in eukaryotes than in prokaryotes?
Answer:
Prokaryotic organisms are single-celled organisms that has no nucleus membrane;
therefore, their DNA floats freely within the cell cytoplasm. To synthesize a protein,
the processes of transcription (DNA to RNA) and translation (RNA to protein) occur
almost simultaneously. When the resulting protein is no longer needed,
transcription stops. Thus, the regulation of transcription is the primary method to
control what type of protein and how much of each protein is expressed in a
prokaryotic cell. All of the subsequent steps occur automatically. When more
protein is required, more transcription occurs. Therefore, in prokaryotic cells, the
control of gene expression is mostly at the transcriptional level.
Eukaryotic cells, have intracellular organelles that add to their complexity. In
eukaryotic cells, the DNA is contained inside the cell’s nucleus where it is
transcribed into RNA. The processes of transcription and translation are physically
separated by the nuclear membrane; transcription occurs within the nucleus,
translation occurs within the cytoplasm. The regulation of gene expression can
occur at all stages of the process: epigenetics, transcriptional level, post-
transcriptional level, translational level, or post-translational level.
Thank you